13231 files changed, 2716835 insertions, 455740 deletions

diff --git a/.cvsignore b/.cvsignore
deleted file mode 100644
index 0c885edbf7..0000000000
--- a/.cvsignore
+++ /dev/null
@@ -1,54 +0,0 @@
-*.bak
-*.orig
-*.rej
-*.sav
-*~
-.ccmalloc
-.ppack
-.ext
-.rbconfig.time
-COPYING.LIB
-ChangeLog.pre-alpha
-ChangeLog.pre1_1
-Makefile
-README.fat-patch
-README.v6
-README.atheos
-archive
-autom4te*.cache
-automake
-beos
-config.cache
-config.h
-config.h.in
-config.log
-config.status
-configure
-libruby.so.*
-miniruby
-miniruby.elhash
-miniruby.elhash2
-miniruby.orig2
-miniruby.plhash
-miniruby.plhash2
-newdate.rb
-newver.rb
-parse.c
-parse.y.try
-pitest.rb
-ppack
-preview
-rbconfig.rb
-rename2.h
-repack
-riscos
-rubicon
-ruby
-ruby-man.rd.gz
-rubyunit
-st.c.power
-this that
-tmp
-web
-y.output
-y.tab.c
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
+;;
+;; This file is a part of  the programming language Ruby.  Permission is hereby
+;; granted, to either  redistribute and/or modify this file,  provided that the
+;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
+;; details.
+
+((nil .
+     ((indent-tabs-mode . nil)
+      (require-final-newline . t)
+      (tab-width . 8)
+      (show-trailing-whitespace . t)
+      (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+     ((buffer-file-coding-system . us-ascii)
+      (indent-tabs-mode . t)
+      (change-log-indent-text . 2)
+      (add-log-time-format . (lambda (&optional x y)
+        (let* ((time (or x (current-time)))
+	       (system-time-locale "C")
+	       (diff (+ (cadr time) 32400))
+	       (lo (% diff 65536))
+	       (hi (+ (car time) (/ diff 65536))))
+        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index 230c50e387..753d6f9892 100644
--- a/.document
+++ b/.document
@@ -5,12 +5,55 @@
 
 # Process all the C source files
 *.c
+*.y
 
-# the lib/ directory (which has its own .document file)
+# prelude
+prelude.rb
+rbconfig.rb
 
-lib
+array.rb
+ast.rb
+dir.rb
+gc.rb
+hash.rb
+io.rb
+kernel.rb
+marshal.rb
+numeric.rb
+nilclass.rb
+pack.rb
+pathname_builtin.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
+zjit.rb
 
+# Errno::*
+known_errors.inc
 
-# and some of the ext/ directory (which has its own .document file)
+# the lib/ directory (which has its own .document file)
+lib
 
+# and some of the ext/ directory (which has its own .document file)
 ext
+
+# For `prism`, ruby code is in lib and c in the prism folder
+prism
+
+# rdoc files
+NEWS.md
+
+README.md
+README.ja.md
+
+COPYING
+COPYING.ja
+
+LEGAL
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..4633a7acae
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,30 @@
+root = true
+
+[*]
+end_of_line = lf
+indent_size = 4
+indent_style = space
+insert_final_newline = true
+tab_width = 8
+trim_trailing_whitespace = true
+
+[*.bat]
+end_of_line = crlf
+
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..4457f6f12b
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,1332 @@
+define ruby_gdb_init
+  init-if-undefined $color_type = "\033[31m"
+  init-if-undefined $color_highlite = "\033[36m"
+  init-if-undefined $color_end = "\033[m"
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+  ruby_gdb_init
+  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+  else
+  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+    printf "%sSYMBOL%s: ", $color_type, $color_end
+    rp_id $id
+  else
+  if ($arg0) == RUBY_Qfalse
+    echo false\n
+  else
+  if ($arg0) == RUBY_Qtrue
+    echo true\n
+  else
+  if ($arg0) == RUBY_Qnil
+    echo nil\n
+  else
+  if ($arg0) == RUBY_Qundef
+    echo undef\n
+  else
+  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+    if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+      printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+    else
+      echo immediate\n
+    end
+  else
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+    printf "[PROMOTED] "
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+    printf "%sT_NONE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+    printf "%sT_NIL%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+    printf "%sT_OBJECT%s: ", $color_type, $color_end
+    print ((struct RObject *)($arg0))->basic
+    if ($flags & ROBJECT_EMBED)
+      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (RSHAPE_CAPACITY(rb_obj_shape_id($arg0)))
+    else
+      print (((struct RObject *)($arg0))->as.heap)
+      if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+        print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+      end
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+    printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+    printf "%sT_ICLASS%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+    printf "%sT_MODULE%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+    printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
+    print (struct RFloat *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    printf "%sT_STRING%s: ", $color_type, $color_end
+    rp_string $arg0 $flags
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+    set $regsrc = ((struct RRegexp*)($arg0))->src
+    set $rsflags = ((struct RBasic*)$regsrc)->flags
+    printf "%sT_REGEXP%s: ", $color_type, $color_end
+    set $len = ((struct RString*)($arg0))->len
+    set print address off
+    output *(char *)(($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.ptr : \
+            ((struct RString*)$regsrc)->as.embed.ary) @ $len
+    set print address on
+    printf " len:%ld ", $len
+    if $flags & RUBY_FL_USER6
+      printf "(none) "
+    end
+    if $flags & RUBY_FL_USER5
+      printf "(literal) "
+    end
+    if $flags & RUBY_FL_USER4
+      printf "(fixed) "
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    print (struct RRegexp *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if ($flags & RUBY_FL_USER1)
+      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      printf "(embed) "
+      if ($len == 0)
+        printf "{(empty)} "
+      else
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+        printf " "
+      end
+    else
+      set $len = ((struct RArray*)($arg0))->as.heap.len
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      if ($flags & RUBY_FL_USER2)
+        printf "(shared) shared="
+        output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
+        printf " "
+      else
+        printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+      end
+      if ($len == 0)
+        printf "{(empty)} "
+      else
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+        printf " "
+      end
+    end
+    print (struct RArray *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+    printf "%sT_FIXNUM%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+    printf "%sT_HASH%s: ", $color_type, $color_end,
+    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+      set $st = (struct st_table *)((uintptr_t)($arg0) + sizeof(struct RHash))
+      printf "st len=%ld ", $st->num_entries
+      print $st
+    else
+      printf "li len=%ld bound=%ld ", \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+	print (struct ar_table_struct *)((uintptr_t)($arg0) + sizeof(struct RHash))
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+    set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+       ((struct RStruct *)($arg0))->as.heap.len)
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
+    print (struct RStruct *)($arg0)
+    output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+              ((struct RStruct *)($arg0))->as.ary : \
+              ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+    rp_bignum $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+    printf "%sT_RATIONAL%s: ", $color_type, $color_end
+    print (struct RRational *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+    printf "%sT_COMPLEX%s: ", $color_type, $color_end
+    print (struct RComplex *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+    printf "%sT_FILE%s: ", $color_type, $color_end
+    print (struct RFile *)($arg0)
+    output *((struct RFile *)($arg0))->fptr
+    printf "\n"
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+    printf "%sT_TRUE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+    printf "%sT_FALSE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+    set $data = (struct RTypedData *)($arg0)
+    set $type = (const rb_data_type_t *)($data->type & ~1)
+    printf "%sT_DATA%s(%s): ", $color_type, $color_end, $type->wrap_struct_name
+    print *$type
+    if ($data->type & 1)
+      print (void *)&$data->data
+    else
+      print $data
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+    printf "%sT_MATCH%s: ", $color_type, $color_end
+    print (struct RMatch *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+    printf "%sT_SYMBOL%s: ", $color_type, $color_end
+    print (struct RSymbol *)($arg0)
+    set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
+    if $id_type == RUBY_ID_LOCAL
+      printf "l"
+    else
+    if $id_type == RUBY_ID_INSTANCE
+      printf "i"
+    else
+    if $id_type == RUBY_ID_GLOBAL
+      printf "G"
+    else
+    if $id_type == RUBY_ID_ATTRSET
+      printf "a"
+    else
+    if $id_type == RUBY_ID_CONST
+      printf "C"
+    else
+    if $id_type == RUBY_ID_CLASS
+      printf "c"
+    else
+      printf "j"
+    end
+    end
+    end
+    end
+    end
+    end
+    set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+    rp_string $id_fstr
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+    printf "%sT_UNDEF%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+    printf "%sT_IMEMO%s(", $color_type, $color_end
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
+    printf "): "
+    rp_imemo $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+    printf "%sT_NODE%s(", $color_type, $color_end
+    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+    printf "): "
+    print *(NODE *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+    printf "%sT_ZOMBIE%s: ", $color_type, $color_end
+    print (struct RData *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+    printf "%sT_MOVED%s: ", $color_type, $color_end
+    print *(struct RMoved *)$arg0
+  else
+    printf "%sunknown%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp
+  Print a Ruby's VALUE.
+end
+
+define rp_id
+  set $id = (ID)$arg0
+  if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+    printf "(:%c)\n", $id
+  else
+  if $id == idDot2
+    printf "(:..)\n"
+  else
+  if $id == idDot3
+    printf "(:...)\n"
+  else
+  if $id == idUPlus
+    printf "(:+@)\n"
+  else
+  if $id == idUMinus
+    printf "(:-@)\n"
+  else
+  if $id == idPow
+    printf "(:**)\n"
+  else
+  if $id == idCmp
+    printf "(:<=>)\n"
+  else
+  if $id == idLTLT
+    printf "(:<<)\n"
+  else
+  if $id == idGTGT
+    printf "(:>>)\n"
+  else
+  if $id == idLE
+    printf "(:<=)\n"
+  else
+  if $id == idGE
+    printf "(:>=)\n"
+  else
+  if $id == idEq
+    printf "(:==)\n"
+  else
+  if $id == idEqq
+    printf "(:===)\n"
+  else
+  if $id == idNeq
+    printf "(:!=)\n"
+  else
+  if $id == idEqTilde
+    printf "(:=~)\n"
+  else
+  if $id == idNeqTilde
+    printf "(:!~)\n"
+  else
+  if $id == idAREF
+    printf "(:[])\n"
+  else
+  if $id == idASET
+    printf "(:[]=)\n"
+  else
+  if $id == idCOLON2
+    printf "(:'::')\n"
+  else
+  if $id == idANDOP
+    printf "(:&&)\n"
+  else
+  if $id == idOROP
+    printf "(:||)\n"
+  else
+  if $id == idANDDOT
+    printf "(:&.)\n"
+  else
+    if $id <= tLAST_OP_ID
+      printf "O"
+    else
+      set $id_type = $id & RUBY_ID_SCOPE_MASK
+      if $id_type == RUBY_ID_LOCAL
+        printf "l"
+      else
+      if $id_type == RUBY_ID_INSTANCE
+        printf "i"
+      else
+      if $id_type == RUBY_ID_GLOBAL
+        printf "G"
+      else
+      if $id_type == RUBY_ID_ATTRSET
+        printf "a"
+      else
+      if $id_type == RUBY_ID_CONST
+        printf "C"
+      else
+      if $id_type == RUBY_ID_CLASS
+        printf "c"
+      else
+        printf "j"
+      end
+      end
+      end
+      end
+      end
+      end
+    end
+    printf "(%ld): ", $id
+    print_id $id
+    echo \n
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp_id
+  Print an ID.
+end
+
+define output_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set $len = ((struct RString*)($arg0))->len
+  if $len > 0
+    output *(char *)(($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
+  else
+    output ""
+  end
+end
+
+define print_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set $len = ((struct RString*)($arg0))->len
+  if $len > 0
+    printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
+  end
+end
+
+define rp_string
+  output_string $arg0
+  printf " bytesize:%ld ", $len
+  if !($flags & RUBY_FL_USER1)
+    printf "(embed) "
+  else
+    if ($flags & RUBY_FL_USER2)
+      printf "(shared) "
+    end
+    if ($flags & RUBY_FL_USER3)
+      printf "(assoc) "
+    end
+  end
+  printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+    printf "coderange:unknown "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+    printf "coderange:7bit "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+    printf "coderange:valid "
+  else
+    printf "coderange:broken "
+  end
+  end
+  end
+  print (struct RString *)($arg0)
+end
+document rp_string
+  Print the content of a String.
+end
+
+define rp_bignum
+  set $flags = ((struct RBignum*)($arg0))->basic.flags
+  set $len = (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+  printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+         (($flags & RUBY_FL_USER1) != 0), $len
+  if $flags & RUBY_FL_USER2
+    printf "(embed) "
+  end
+  print (struct RBignum *)($arg0)
+  set $ptr = (($flags & RUBY_FL_USER2) ? \
+              ((struct RBignum*)($arg0))->as.ary : \
+              ((struct RBignum*)($arg0))->as.heap.digits)
+  set $len = $len-1
+  printf "0x%x", $ptr[$len]
+  while $len > 0
+    set $len = $len-1
+    set $val = $ptr[$len]
+    set $w = sizeof($ptr[0])
+    printf "_"
+    if $w > 8
+      printf "%.32x", $val
+    else
+    if $w > 4
+      printf "%.16x", $val
+    else
+    if $w > 2
+      printf "%.8x", $val
+    else
+    if $w > 1
+      printf "%.4x", $val
+    else
+      printf "%.2x", $val
+    end
+    end
+    end
+    end
+  end
+  printf "\n"
+end
+document rp_bignum
+  Print the content of a Bignum.
+end
+
+define rp_class
+  set $class_and_classext = (struct RClass_and_rb_classext_t *)($arg0)
+  printf "(struct RClass *) %p", (void*)$arg0
+  if $class_and_classext->classext->origin_ != (VALUE)$arg0
+    printf " -> %p", $class_and_classext->classext->origin_
+  end
+  printf "\n"
+  rb_classname $arg0
+  print/x *$class_and_classext
+end
+document rp_class
+  Print the content of a Class/Module.
+end
+
+define rp_imemo
+  set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
+  if $flags == imemo_cref
+    printf "(rb_cref_t *) %p\n", (void*)$arg0
+    print *(rb_cref_t *)$arg0
+  else
+  if $flags == imemo_svar
+    printf "(struct vm_svar *) %p\n", (void*)$arg0
+    print *(struct vm_svar *)$arg0
+  else
+  if $flags == imemo_throw_data
+    printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+    print *(struct vm_throw_data *)$arg0
+  else
+  if $flags == imemo_ifunc
+    printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+    print *(struct vm_ifunc *)$arg0
+  else
+  if $flags == imemo_memo
+    printf "(struct MEMO *) %p\n", (void*)$arg0
+    print *(struct MEMO *)$arg0
+  else
+  if $flags == imemo_ment
+    printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+    print *(rb_method_entry_t *)$arg0
+  else
+  if $flags == imemo_iseq
+    printf "(rb_iseq_t *) %p\n", (void*)$arg0
+    print *(rb_iseq_t *)$arg0
+  else
+    printf "(struct RIMemo *) %p\n", (void*)$arg0
+    print *(struct RIMemo *)$arg0
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp_imemo
+  Print the content of a memo
+end
+
+define nd_type
+  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+  Print a Ruby' node type.
+end
+
+define nd_file
+  print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+  Print the source file name of a node.
+end
+
+define nd_line
+  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+  Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_alen
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_next
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_cond
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_body
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_else
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_orig
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+
+define nd_resq
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_ensr
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_1st
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_2nd
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+
+define nd_stts
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_vid
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_cflag
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_cval
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+define nd_tbl
+  printf "%su1.tbl%s: ", $color_highlite, $color_end
+  p ($arg0).u1.tbl
+end
+
+
+define nd_var
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_ibdy
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_iter
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_value
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_aid
+  printf "%su3.id%s: ", $color_highlite, $color_end
+  p ($arg0).u3.id
+end
+
+
+define nd_lit
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+define nd_rest
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_opt
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_recv
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_mid
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_args
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+define nd_defn
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_old
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_new
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+
+define nd_cname
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_super
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_modl
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_clss
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+
+define nd_beg
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_end
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_state
+  printf "%su3.state%s: ", $color_highlite, $color_end
+  p ($arg0).u3.state
+end
+
+define nd_rval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+
+define nd_nth
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
+define nd_tag
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_tval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+define nd_tree
+  set $buf = (struct RString *)rb_str_buf_new(0)
+  call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
+  printf "%s\n", $buf->as.heap.ptr
+end
+
+define rb_p
+  call rb_p($arg0)
+end
+
+define rb_numtable_entry
+  set $rb_numtable_tbl = $arg0
+  set $rb_numtable_id = (st_data_t)$arg1
+  set $rb_numtable_key = 0
+  set $rb_numtable_rec = 0
+  if $rb_numtable_tbl->entries_packed
+    set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+      if $rb_numtable_p.k == $rb_numtable_id
+        set $rb_numtable_key = $rb_numtable_p.k
+        set $rb_numtable_rec = $rb_numtable_p.v
+        set $rb_numtable_p = 0
+      else
+        set $rb_numtable_p = $rb_numtable_p + 1
+      end
+    end
+  else
+    set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
+    while $rb_numtable_p
+      if $rb_numtable_p->key == $rb_numtable_id
+        set $rb_numtable_key = $rb_numtable_p->key
+        set $rb_numtable_rec = $rb_numtable_p->record
+        set $rb_numtable_p = 0
+      else
+        set $rb_numtable_p = $rb_numtable_p->next
+      end
+    end
+  end
+end
+
+define rb_id2name
+  ruby_gdb_init
+  printf "%sID%s: ", $color_type, $color_end
+  rp_id $arg0
+end
+document rb_id2name
+  Print the name of id
+end
+
+define rb_method_entry
+  set $rb_method_entry_klass = (struct RClass *)$arg0
+  set $rb_method_entry_id = (ID)$arg1
+  set $rb_method_entry_me = (rb_method_entry_t *)0
+  while !$rb_method_entry_me && $rb_method_entry_klass
+    rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
+    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+    if !$rb_method_entry_me
+      set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
+    end
+  end
+  if $rb_method_entry_me
+    print *$rb_method_entry_klass
+    print *$rb_method_entry_me
+  else
+    echo method not found\n
+  end
+end
+document rb_method_entry
+  Search method entry by class and id
+end
+
+define rb_classname
+  set $rb_classname = ((struct RClass_and_rb_classext_t*)$arg0)->classext->classpath
+  if $rb_classname != RUBY_Qfalse
+    print_string $rb_classname
+    printf "\n"
+  else
+    echo anonymous class/module\n
+  end
+end
+
+define rb_ancestors
+  set $rb_ancestors_module = $arg0
+  while $rb_ancestors_module
+    rp_class $rb_ancestors_module
+    set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+  end
+end
+document rb_ancestors
+  Print ancestors.
+end
+
+define rb_backtrace
+  call rb_backtrace()
+end
+
+define iseq
+  if ruby_dummy_gdb_enums.special_consts
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_NONE
+    echo [none]\n
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_LABEL
+    print *(LABEL*)($arg0)
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_INSN
+    print *(INSN*)($arg0)
+    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+      set $i = 0
+      set $operand_size = ((INSN*)($arg0))->operand_size
+      set $operands = ((INSN*)($arg0))->operands
+      while $i < $operand_size
+        rp $operands[$i++]
+      end
+    end
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+    print *(ADJUST*)($arg0)
+  end
+end
+
+define rb_ps
+  rb_ps_vm ruby_current_vm_ptr
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+  print $ps_vm = (rb_vm_t*)$arg0
+  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
+  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+  while 1
+    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+    set $ps_thread = (VALUE)($ps_thread_th->self)
+    rb_ps_thread $ps_thread
+    if $ps_thread_ln == $ps_thread_ln_last
+      loop_break
+    end
+    set $ps_thread_ln = $ps_thread_ln->next
+  end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define print_lineno
+  set $cfp = $arg0
+  set $iseq = rb_get_cfp_iseq($cfp)
+  set $pos = $cfp->pc - $iseq->body->iseq_encoded
+  if $pos != 0
+    set $pos = $pos - 1
+  end
+
+  set $index = 0
+  set $size = $iseq->body->insns_info.size
+  set $table = $iseq->body->insns_info.body
+  set $positions = $iseq->body->insns_info.positions
+  #printf "size: %d\n", $size
+  if $size == 0
+  else
+  if $size == 1
+    printf "%d", $table[0].line_no
+  else
+    if $positions
+      # get_insn_info_linear_search
+      set $index = 1
+      while $index < $size
+        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+        if $positions[$index] > $pos
+          loop_break
+        end
+        set $index = $index + 1
+        if $positions[$index] == $pos
+          loop_break
+        end
+      end
+    else
+      # get_insn_info_succinct_bitvector
+      set $sd = $iseq->body->insns_info.succ_index_table
+      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+      if $pos < $immediate_table_size
+        set $i = $pos / 9
+        set $j = $pos % 9
+        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+      else
+        set $block_index = ($pos - $immediate_table_size) / 512
+        set $block = &$sd->succ_part[$block_index]
+        set $block_bit_index = ($pos - $immediate_table_size) % 512
+        set $small_block_index = $block_bit_index / 64
+        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+        set $index = $block->rank + $small_block_popcount + $popcnt
+      end
+    end
+    printf "%d", $table[$index-1].line_no
+  end
+  end
+end
+
+define check_method_entry
+  set $imemo = (struct RBasic *)$arg0
+  if $imemo != RUBY_Qfalse
+    set $type = ($imemo->flags >> 12) & 0x07
+    if $type == imemo_ment
+      set $me = (rb_callable_method_entry_t *)$imemo
+    else
+    if $type == imemo_svar
+      set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+      check_method_entry $imemo
+    end
+    end
+  end
+end
+
+define print_id
+  set $id = $arg0
+  # rb_id_to_serial
+  if $id > tLAST_OP_ID
+    set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+  else
+    set $serial = (rb_id_serial_t)$id
+  end
+  if $serial && $serial < ruby_global_symbols.next_id
+    set $idx = $serial / ID_ENTRY_UNIT
+    set $ids = (struct RArray *)ruby_global_symbols.ids
+    set $flags = $ids->basic.flags
+    if ($flags & RUBY_FL_USER1)
+      set $idsptr = $ids->as.ary
+      set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+    else
+      set $idsptr = $ids->as.heap.ptr
+      set $idslen = $ids->as.heap.len
+    end
+    if $idx < $idslen
+      set $t = 0
+      set $ary = (struct RArray *)$idsptr[$idx]
+      if $ary != RUBY_Qnil
+        set $flags = $ary->basic.flags
+        if ($flags & RUBY_FL_USER1)
+          set $aryptr = $ary->as.ary
+          set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+        else
+          set $aryptr = $ary->as.heap.ptr
+          set $arylen = $ary->as.heap.len
+        end
+        set $result = $aryptr[($serial % ID_ENTRY_UNIT) + $t]
+        if $result != RUBY_Qnil
+          print_string $result
+        else
+          echo undef
+        end
+      end
+    end
+  end
+end
+
+define print_pathobj
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    print_string $arg0
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if $flags & RUBY_FL_USER1
+      set $str = ((struct RArray*)($arg0))->as.ary[0]
+    else
+      set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+    end
+    print_string $str
+  end
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+    $ps_thread, $ps_thread_th, $ps_thread_th->nt
+  set $cfp = $ps_thread_th->ec->cfp
+  set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+  while $cfp < $cfpend
+    if $cfp->_iseq
+      set $iseq = rb_get_cfp_iseq($cfp)
+      if !((VALUE)$iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+        printf "%d:ifunc ", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $iseq.body
+        set print symbol-filename off
+        printf "\n"
+      else
+      if $cfp->pc
+        set $location = $iseq->body->location
+        printf "%d:", $cfpend-$cfp
+        print_pathobj $location.pathobj
+        printf ":"
+        print_lineno $cfp
+        printf ":in `"
+        print_string $location.label
+        printf "'\n"
+      else
+        printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+      end
+      end
+    else
+      # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+      set $ep = $cfp->ep
+      if ($ep[0] & 0xffff0001) == 0x55550001
+        #define VM_ENV_FLAG_LOCAL 0x02
+        #define VM_ENV_PREV_EP(ep)   GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+        set $me = 0
+        set $env_specval = $ep[-1]
+        set $env_me_cref = $ep[-2]
+        while ($env_specval & 0x02) != 0
+          check_method_entry $env_me_cref
+          if $me != 0
+            loop_break
+          end
+          set $ep = $ep[0]
+          set $env_specval = $ep[-1]
+          set $env_me_cref = $ep[-2]
+        end
+        if $me == 0
+          check_method_entry $env_me_cref
+        end
+        printf "%d:", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $me->def->body.cfunc.func
+        set print symbol-filename off
+        set $mid = $me->def->original_id
+        printf ":in `"
+        print_id $mid
+        printf "'\n"
+      else
+        printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+      end
+    end
+    set $cfp = $cfp + 1
+  end
+end
+
+define rb_count_objects
+  set $objspace = ruby_current_vm_ptr->objspace
+  set $counts_00 = 0
+  set $counts_01 = 0
+  set $counts_02 = 0
+  set $counts_03 = 0
+  set $counts_04 = 0
+  set $counts_05 = 0
+  set $counts_06 = 0
+  set $counts_07 = 0
+  set $counts_08 = 0
+  set $counts_09 = 0
+  set $counts_0a = 0
+  set $counts_0b = 0
+  set $counts_0c = 0
+  set $counts_0d = 0
+  set $counts_0e = 0
+  set $counts_0f = 0
+  set $counts_10 = 0
+  set $counts_11 = 0
+  set $counts_12 = 0
+  set $counts_13 = 0
+  set $counts_14 = 0
+  set $counts_15 = 0
+  set $counts_16 = 0
+  set $counts_17 = 0
+  set $counts_18 = 0
+  set $counts_19 = 0
+  set $counts_1a = 0
+  set $counts_1b = 0
+  set $counts_1c = 0
+  set $counts_1d = 0
+  set $counts_1e = 0
+  set $counts_1f = 0
+  set $total = 0
+  set $i = 0
+  while $i < $objspace->heap_pages.allocated_pages
+    printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+    set $page = $objspace->heap_pages.sorted[$i]
+    set $p = $page->start
+    set $pend = $p + $page->total_slots
+    while $p < $pend
+      set $flags = $p->as.basic.flags & 0x1f
+      eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+      set $p = $p + 1
+    end
+    set $total = $total + $page->total_slots
+    set $i = $i + 1
+  end
+  printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+  printf "T_OBJECT: %d\n", $counts_01
+  printf "T_CLASS: %d\n", $counts_02
+  printf "T_MODULE: %d\n", $counts_03
+  printf "T_FLOAT: %d\n", $counts_04
+  printf "T_STRING: %d\n", $counts_05
+  printf "T_REGEXP: %d\n", $counts_06
+  printf "T_ARRAY: %d\n", $counts_07
+  printf "T_HASH: %d\n", $counts_08
+  printf "T_STRUCT: %d\n", $counts_09
+  printf "T_BIGNUM: %d\n", $counts_0a
+  printf "T_FILE: %d\n", $counts_0b
+  printf "T_DATA: %d\n", $counts_0c
+  printf "T_MATCH: %d\n", $counts_0d
+  printf "T_COMPLEX: %d\n", $counts_0e
+  printf "T_RATIONAL: %d\n", $counts_0f
+  #printf "UNKNOWN_10: %d\n", $counts_10
+  printf "T_NIL: %d\n", $counts_11
+  printf "T_TRUE: %d\n", $counts_12
+  printf "T_FALSE: %d\n", $counts_13
+  printf "T_SYMBOL: %d\n", $counts_14
+  printf "T_FIXNUM: %d\n", $counts_15
+  printf "T_UNDEF: %d\n", $counts_16
+  #printf "UNKNOWN_17: %d\n", $counts_17
+  #printf "UNKNOWN_18: %d\n", $counts_18
+  #printf "UNKNOWN_19: %d\n", $counts_19
+  printf "T_IMEMO: %d\n", $counts_1a
+  printf "T_NODE: %d\n", $counts_1b
+  printf "T_ICLASS: %d\n", $counts_1c
+  printf "T_ZOMBIE: %d\n", $counts_1d
+  #printf "UNKNOWN_1E: %d\n", $counts_1e
+  printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+  Counts all objects grouped by type.
+end
+
+# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
+define trace_machine_instructions
+  set logging enabled
+  set height 0
+  set width 0
+  display/i $pc
+  while !$exit_code
+    info line *$pc
+    si
+  end
+end
+
+define SDR
+  call rb_vmdebug_stack_dump_raw_current()
+end
+
+define rbi
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+    p *(LABEL*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+    p *(INSN*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+    p *(ADJUST*)$arg0
+  else
+    print *$arg0
+  end
+  end
+  end
+end
+
+define dump_node
+  set $str = rb_parser_dump_tree($arg0, 0)
+  set $flags = ((struct RBasic*)($str))->flags
+  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+                        ((struct RString*)$str)->as.heap.ptr : \
+                        ((struct RString*)$str)->as.embed.ary)
+end
+
+define print_flags
+  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+  printf "RUBY_FL_PROMOTED    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED ? "1" : "0"
+  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
+
+source -s misc/gdb.py
+
+# Moved from beginning, since it fails on older gdbs
+set startup-with-shell off
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..d752612085
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,54 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+c5e9af9c9d890578182a21e7b71b50334cd5579e
+e63a2115f64433b21cb5dd67c5bf8b30f87ef293
+712ac99e4d0384a941c80a9f48f62943ba7d97c0
+d1474affa8e105bece209cc9d594bb0a989859e1
+2da92388b948821269b18d6b178a680f17e41750
+5062c0c621d887367af8a054e5e5d83d7ec57dd3
+
+# Indentation
+0e4bad888e605d424b9222ae0ca43f85c1634e5e
+61aa46c41648c6d1e9b0daa1a292de551fde78df
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
+
+# Make prism_compile.c indentation consistent
+40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
+d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
+
+# Miss-and-revived commits
+a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
+d4e24021d39e1f80f0055b55d91f8d5f22e15084
+7a56c316418980b8a41fcbdc94067b2bda2ad112
+e90282be7ba1bc8e3119f6e1a2c80356ceb3f80a
+26a9e0b4e31f7b5a9cbd755e0a15823a8fa51bae
+2f53985da9ee593fe524d408256835667938c7d7
+bf01f6ae89a95d8f5572e050facfe311c8c28aaf
+7480cd8d37fd71a41ce12b759090051c7e14fb5a
+
+# Win32: EOL code of batch files
+23f9a0d655c4d405bb2397a147a1523436205486
+b839989fd22fef85e2af19de1bc83aa72a5b22bd
+
+# ZJIT cargo-insta snapshot raw string literals
+b78e0a6ddf7df8a7568ea71284f593423c739551
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..f98c091e3f
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,14 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+*.inc.rs linguist-generated=true
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
+
+# To strip CR from the batch files, set the `diff.dos.textconv` filter
+# like as `git config diff.dos.textconv $'sed \'s/\r$//\''`.
+*.bat diff=dos
+*.cmd diff=dos
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/actions/capiext/action.yml b/.github/actions/capiext/action.yml
new file mode 100644
index 0000000000..ed69c8ac5e
--- /dev/null
+++ b/.github/actions/capiext/action.yml
@@ -0,0 +1,86 @@
+name: rubyspec C-API extensions
+
+inputs:
+  builddir:
+    required: false
+    default: '.'
+  make:
+    required: false
+    default: 'make -s'
+
+outputs:
+  key:
+    value: >-
+      ${{
+      !steps.restore.outputs.cache-hit &&
+      github.ref == 'refs/heads/master' &&
+      steps.config.outputs.key
+      }}
+
+runs:
+  using: composite
+
+  steps:
+    - id: config
+      shell: bash
+      run: |
+        eval $(grep -e '^arch *=' -e '^ruby_version *=' -e '^DLEXT *=' Makefile |
+            sed 's/ *= */=/')
+        case "${ruby_version}" in
+        *+*) key=capiexts-${arch}-${ruby_version}-${{ hashFiles('src/spec/ruby/optional/capi/ext/*.[ch]') }};;
+        *)   key=;;
+        esac
+        echo version=$ruby_version >> $GITHUB_OUTPUT
+        echo key="$key" >> $GITHUB_OUTPUT
+        echo DLEXT=$DLEXT >> $GITHUB_OUTPUT
+      working-directory: ${{ inputs.builddir }}
+
+    - name: Restore previous CAPI extensions
+      uses: actions/cache/restore@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      id: cache
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.config.outputs.key }}
+
+    - name: Run test-spec with previous CAPI extension binaries
+      id: check
+      shell: bash
+      run: | # zizmor: ignore[template-injection]
+        touch spec/ruby/optional/capi/ext/*.$DLEXT
+        [ ! -f spec/ruby/optional/capi/ext/\*.$DLEXT ]
+        ${{ inputs.make }} SPECOPTS=optional/capi test-spec
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: ${{ steps.cache.outputs.cache-hit }}
+
+    - name: Strip CAPI extensions
+      id: strip
+      shell: bash
+      run: |
+        rm -f spec/ruby/optional/capi/ext/*.c
+        [ "$DLEXT" = bundle ] || # separated to .dSYM directories
+        strip spec/ruby/optional/capi/ext/*.$DLEXT
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: >-
+        ${{true
+        && ! steps.cache.outputs.cache-hit
+        && github.ref_name == 'master'
+        }}
+
+    - name: Save CAPI extensions
+      uses: actions/cache/save@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.strip.outcome == 'success' }}
+
+    - shell: bash
+      run: |
+        echo "::error::Change from ${prev} detected; bump up ABI version"
+      env:
+        prev: ${{ steps.config.outputs.version }}
+      if: ${{ always() && steps.check.outcome == 'failure' }}
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
new file mode 100644
index 0000000000..c700bbfe9e
--- /dev/null
+++ b/.github/actions/compilers/action.yml
@@ -0,0 +1,164 @@
+name: Compiles ruby in a container
+description: >-
+  Makes ruby using a dedicated container
+
+inputs:
+  tag:
+    required: false
+    default: clang-20
+    description: >-
+      container image tag to use in this run.
+
+  with_gcc:
+    required: false
+    description: >-
+      override compiler path & flags.
+
+  CFLAGS:
+    required: false
+    description: >-
+      C compiler flags to override.
+
+  CXXFLAGS:
+    required: false
+    description: >-
+      C++ compiler flags to override.
+
+  optflags:
+    required: false
+    # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+    # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
+    # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
+    # because compilers tend not understand what the CPU is.
+    default: '-O1'
+    description: >-
+      Compiler flags for optimisations.
+
+  cppflags:
+    required: false
+    description: >-
+      Additional preprocessor flags.
+
+  append_configure:
+    required: false
+    default: >-
+      --without-valgrind
+      --without-jemalloc
+      --without-gmp
+    description: >-
+      flags to append to configure.
+
+  enable_shared:
+    required: false
+    default: true
+    description: >-
+      Whether to build libruby.so.
+
+  check:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make check`
+
+  test_all:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-all` with options for test-all.
+
+  test_spec:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-spec` with options for mspec.
+
+  static_exts:
+    required: false
+    description: >-
+      whitespace separated list of extensions that need be linked statically.
+
+runs:
+  using: composite
+  steps:
+    - shell: bash
+      run: docker pull --quiet "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}"
+      env:
+        INPUT_TAG: ${{ inputs.tag }}
+
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        github.repository == 'ruby/ruby' ||
+        (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
+        }}
+
+    - name: compile
+      shell: bash
+      run: >-
+        docker run
+        --rm
+        --user=root
+        --volume "${GITHUB_WORKSPACE}:/github/workspace:ro"
+        --workdir=/github/workspace
+        --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
+        --env CI
+        --env GITHUB_ACTION
+        --env INPUT_WITH_GCC
+        --env INPUT_CFLAGS
+        --env INPUT_CXXFLAGS
+        --env INPUT_OPTFLAGS
+        --env INPUT_CPPFLAGS
+        --env INPUT_APPEND_CONFIGURE
+        --env INPUT_CHECK
+        --env INPUT_TEST_ALL
+        --env INPUT_TEST_SPEC
+        --env INPUT_ENABLE_SHARED
+        --env INPUT_STATIC_EXTS
+        --env LAUNCHABLE_ORGANIZATION
+        --env LAUNCHABLE_WORKSPACE
+        --env LAUNCHABLE_ENABLED
+        --env GITHUB_PR_HEAD_SHA
+        --env GITHUB_PULL_REQUEST_URL
+        --env GITHUB_REF
+        --env GITHUB_ACTIONS
+        --env GITHUB_RUN_ID
+        --env GITHUB_REPOSITORY
+        --env GITHUB_WORKFLOW
+        --env GITHUB_RUN_NUMBER
+        --env GITHUB_EVENT_NAME
+        --env GITHUB_SHA
+        --env GITHUB_HEAD_REF
+        --env GITHUB_SERVER_URL
+        "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}"
+      env:
+        INPUT_TAG: ${{ inputs.tag }}
+        INPUT_WITH_GCC: ${{ inputs.with_gcc || inputs.tag }}
+        INPUT_CFLAGS: ${{ inputs.CFLAGS }}
+        INPUT_CXXFLAGS: ${{ inputs.CXXFLAGS }}
+        INPUT_OPTFLAGS: ${{ inputs.OPTFLAGS }}
+        INPUT_CPPFLAGS: ${{ inputs.cppflags }}
+        INPUT_APPEND_CONFIGURE: ${{ inputs.append_configure }}
+        INPUT_CHECK: ${{ inputs.check }}
+        INPUT_TEST_ALL: ${{ inputs.test_all }}
+        INPUT_TEST_SPEC: ${{ inputs.test_spec }}
+        INPUT_ENABLE_SHARED: ${{ inputs.enable_shared }}
+        INPUT_STATIC_EXTS: ${{ inputs.static_exts }}
+        LAUNCHABLE_ORGANIZATION: ${{ github.repository_owner }}
+        LAUNCHABLE_WORKSPACE: ${{ github.event.repository.name }}
+        LAUNCHABLE_ENABLED: ${{ steps.enable-launchable.outputs.enable-launchable || false }}
+        GITHUB_PR_HEAD_SHA: ${{ github.event.pull_request.head.sha || github.sha }}
+        GITHUB_PULL_REQUEST_URL: ${{ github.event.pull_request.html_url }}
+        GITHUB_REF: ${{ github.ref }}
+
+    # Clean up non-default docker images to save disk space.
+    # The default image (clang-20) is reused across multiple steps
+    # within the same job, so we keep it to avoid redundant pulls.
+    - name: clean up docker image
+      shell: bash
+      run: docker rmi "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}" || true
+      if: ${{ always() && inputs.tag != 'clang-20' }}
+      env:
+        INPUT_TAG: ${{ inputs.tag }}
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
new file mode 100755
index 0000000000..b554151091
--- /dev/null
+++ b/.github/actions/compilers/entrypoint.sh
@@ -0,0 +1,90 @@
+#! /bin/bash
+
+# Copyright (c) 2024 Ruby developers.  All rights reserved.
+#
+# This file is  a part of the programming language  Ruby.  Permission is hereby
+# granted, to  either redistribute and/or  modify this file, provided  that the
+# conditions  mentioned in  the file  COPYING are  met.  Consult  the file  for
+# details.
+
+grouped()
+{
+    echo "::group::${@}"
+    "${@}"
+    echo "::endgroup::"
+}
+
+set -e
+set -u
+set -o pipefail
+
+srcdir="/github/workspace/src"
+builddir="$(mktemp -dt)"
+
+export GITHUB_WORKFLOW='Compilations'
+export CONFIGURE_TTY='never'
+export RUBY_DEBUG='ci rgengc'
+export RUBY_TESTOPTS='-q --color=always --tty=no'
+export RUBY_DEBUG_COUNTER_DISABLE='1'
+export GNUMAKEFLAGS="-j$((1 + $(nproc)))"
+
+case "x${INPUT_ENABLE_SHARED}" in
+x | xno | xfalse )
+    enable_shared='--disable-shared'
+    ;;
+*)
+    enable_shared='--enable-shared'
+    ;;
+esac
+
+pushd ${builddir}
+
+grouped git config --global --add safe.directory ${srcdir}
+
+grouped ${srcdir}/configure        \
+    -C                             \
+    --with-gcc="${INPUT_WITH_GCC}" \
+    --enable-debug-env             \
+    --disable-install-doc          \
+    --with-ext=-test-/cxxanyargs,+ \
+    --without-git                  \
+    ${enable_shared}               \
+    ${INPUT_APPEND_CONFIGURE}      \
+    CFLAGS="${INPUT_CFLAGS}"       \
+    CXXFLAGS="${INPUT_CXXFLAGS}"   \
+    optflags="${INPUT_OPTFLAGS}"   \
+    cppflags="${INPUT_CPPFLAGS}"   \
+    debugflags='-ggdb3' # -g0 disables backtraces when SEGV.  Do not set that.
+
+popd
+
+if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
+    echo "::group::ext/Setup"
+    set -x
+    mkdir ${builddir}/ext
+    (
+        for ext in ${INPUT_STATIC_EXTS}; do
+            echo "${ext}"
+        done
+    ) >> ${builddir}/ext/Setup
+    set +x
+    echo "::endgroup::"
+fi
+
+if [ -n "$INPUT_TEST_ALL" ]; then
+  tests=" -- $INPUT_TEST_ALL"
+else
+  tests=" -- ruby -ext-"
+fi
+
+pushd ${builddir}
+
+grouped make showflags
+grouped make all
+# grouped make install
+
+# Run only `make test` by default. Run other tests if specified.
+grouped make test
+if [[ -n "$INPUT_CHECK" ]]; then grouped make test-tool; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_ALL" ]]; then grouped make test-all TESTS="$tests"; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_SPEC" ]]; then grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_TEST_SPEC"; fi
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
new file mode 100644
index 0000000000..305878492c
--- /dev/null
+++ b/.github/actions/launchable/setup/action.yml
@@ -0,0 +1,337 @@
+name: Set up Launchable
+description: >-
+  Install the required dependencies and execute the necessary Launchable commands for test recording
+
+inputs:
+  os:
+    required: true
+    description: The operating system that CI runs on. This value is used in Launchable flavor.
+
+  test-opts:
+    default: none
+    required: false
+    description: >-
+      Test options that determine how tests are run.
+      This value is used in the Launchable flavor.
+
+  launchable-token:
+    required: false
+    description: >-
+      Launchable token is needed if you want to run Launchable on your forked repository.
+      See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to create Launchable report file.
+
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes. Launchable retrieves the commit information
+      from the directory.
+
+  test-task:
+    required: false
+    default: ${{ matrix.test_task }}
+    description: >-
+      Specifies a single test task to be executed.
+      This value is used in the Launchable flavor.
+      Either 'test-task' or 'multi-test-tasks' must be configured.
+
+  test-tasks:
+    required: false
+    default: '[]'
+    description: >-
+      Specifies an array of multiple test tasks to be executed.
+      For example: '["test", "test-all"]'.
+      If you want to run a single test task, use the 'test-task' input instead.
+
+  is-yjit:
+    required: false
+    default: 'false'
+    description: >-
+      Whether this workflow is executed on YJIT.
+
+  is-zjit:
+    required: false
+    default: 'false'
+    description: >-
+      Whether this workflow is executed on ZJIT.
+
+outputs:
+  stdout_report_path:
+    value: ${{ steps.global.outputs.stdout_report_path }}
+    description: >-
+      Report file path for standard output.
+
+  stderr_report_path:
+    value: ${{ steps.global.outputs.stderr_report_path }}
+    description: >-
+      Report file path for standard error.
+
+runs:
+  using: composite
+
+  steps:
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        (github.repository == 'ruby/ruby'
+          || (github.repository != 'ruby/ruby'
+          && env.LAUNCHABLE_TOKEN))
+        && (inputs.test-task == 'check'
+          || inputs.test-task == 'test-all'
+          || inputs.test-task == 'test'
+          || contains(fromJSON(inputs.test-tasks), 'test-all')
+          || contains(fromJSON(inputs.test-tasks), 'test'))
+        }}
+
+    # Launchable CLI requires Python and Java.
+    # https://www.launchableinc.com/docs/resources/cli-reference/
+    - name: Set up Python
+      uses: actions/setup-python@a26af69be951a213d495a4c3e4e4022e16d87065 # v5.6.0
+      with:
+        python-version: "3.x"
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java
+      uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+      with:
+        distribution: 'temurin'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java ppc64le
+      uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+      with:
+        distribution: 'semeru'
+        architecture: 'ppc64le'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 'ppc64le') }}
+
+    - name: Set up Java s390x
+      uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+      with:
+        distribution: 'semeru'
+        architecture: 's390x'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 's390x') }}
+
+    - name: Set global vars
+      id: global
+      shell: bash
+      run: |
+        test_all_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
+        btest_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
+        test_spec_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
+        echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
+        echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
+        echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
+        echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
+        echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
+        echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
+        echo stdout_report_path="launchable_stdout.log" >> $GITHUB_OUTPUT
+        echo stderr_report_path="launchable_stderr.log" >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set environment variables for Launchable
+      shell: bash
+      run: | # zizmor: ignore[github-env]
+        : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
+        echo "GITHUB_PULL_REQUEST_URL=${INPUT_PR_HTML_URL}" >> $GITHUB_ENV
+        : # The following envs are necessary in Launchable tokenless authentication.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
+        echo "LAUNCHABLE_ORGANIZATION=${INPUT_REPOSITORY_OWNER}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_WORKSPACE=${INPUT_REPOSITORY_NAME}" >> $GITHUB_ENV
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
+        echo "GITHUB_PR_HEAD_SHA=${INPUT_PR_HEAD_SHA}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_TOKEN=${INPUT_LAUNCHABLE_TOKEN}" >> $GITHUB_ENV
+        : # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
+        echo "LAUNCHABLE_SKIP_TIMEOUT_RETRY=1" >> $GITHUB_ENV
+        echo "LAUNCHABLE_COMMIT_TIMEOUT=1" >> $GITHUB_ENV
+      env:
+        INPUT_PR_HTML_URL: ${{ github.event.pull_request.html_url }}
+        INPUT_REPOSITORY_OWNER: ${{ github.repository_owner }}
+        INPUT_REPOSITORY_NAME: ${{ github.event.repository.name }}
+        INPUT_PR_HEAD_SHA: ${{ github.event.pull_request.head.sha || github.sha }}
+        INPUT_LAUNCHABLE_TOKEN: ${{ inputs.launchable-token }}
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set up path
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
+      # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
+      run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH # zizmor: ignore[github-env]
+      if: >-
+        ${{
+        steps.enable-launchable.outputs.enable-launchable
+        && (startsWith(inputs.os, 'macos')
+          || endsWith(inputs.os, 'ppc64le')
+          || endsWith(inputs.os, 's390x'))
+        }}
+
+    - name: Set up Launchable
+      id: setup-launchable
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: | # zizmor: ignore[github-env]
+        set -x
+        pip install --user launchable
+        : # The build name cannot include a slash, so we replace the string here.
+        github_ref="${INPUT_GITHUB_REF}"
+        github_ref="${github_ref//\//_}"
+        : # With the --name option, we need to configure a unique identifier for this build.
+        : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
+        build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
+        test_opts="${INPUT_TEST_OPTS}"
+        test_opts="${test_opts// /}"
+        test_opts="${test_opts//=/:}"
+        test_all_test_suite='test-all'
+        btest_test_suite='btest'
+        test_spec_test_suite='test-spec'
+        if [ "${INPUT_IS_YJIT}" = "true" ]; then
+          test_all_test_suite="yjit-${test_all_test_suite}"
+          btest_test_suite="yjit-${btest_test_suite}"
+          test_spec_test_suite="yjit-${test_spec_test_suite}"
+        fi
+        if [ "${INPUT_IS_ZJIT}" = "true" ]; then
+          test_all_test_suite="zjit-${test_all_test_suite}"
+          btest_test_suite="zjit-${btest_test_suite}"
+          test_spec_test_suite="zjit-${test_spec_test_suite}"
+        fi
+        # launchable_setup target var -- refers ${target} prefixed variables
+        launchable_setup() {
+          local target=$1 session
+          eval [ "\${${target}_enabled}" = "true" ] || return
+          eval local suite=\${${target}_test_suite}
+          session=$(launchable record session \
+            --build "${build_name}" \
+            --observation \
+            --flavor os="${INPUT_OS}" \
+            --flavor test_task="${INPUT_TEST_TASK}" \
+            --flavor test_opts="${test_opts}" \
+            --flavor workflow="${INPUT_WORKFLOW}" \
+            --test-suite ${suite} \
+            )
+          echo "${target}_session=${session}" >> $GITHUB_OUTPUT
+        }
+
+        launchable record build --name "${build_name}"
+        if launchable_setup test_all; then
+          echo "TESTS=${TESTS:+$TESTS }--launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup btest; then
+          echo "BTESTS=${BTESTS:+$BTESTS }--launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup test_spec; then
+          echo "SPECOPTS=${SPECOPTS:$SPECOPTS }--launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
+          echo test_spec_enabled=true >> $GITHUB_OUTPUT
+        fi
+
+        echo launchable_setup_dir=$(pwd) >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+      env:
+        INPUT_GITHUB_REF: ${{ github.ref }}
+        INPUT_TEST_OPTS: ${{ inputs.test-opts }}
+        INPUT_IS_YJIT: ${{ inputs.is-yjit }}
+        INPUT_IS_ZJIT: ${{ inputs.is-zjit }}
+        INPUT_OS: ${{ inputs.os }}
+        INPUT_TEST_TASK: ${{ inputs.test-task }}
+        INPUT_WORKFLOW: ${{ github.workflow }}
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: make test-spec report directory in build directory
+      shell: bash
+      working-directory: ${{ inputs.builddir }}
+      run: mkdir "${test_spec_report_dir}"
+      if: ${{ steps.setup-launchable.outputs.test_spec_enabled == 'true' }}
+      env:
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Clean up test results in Launchable
+      uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          rm -f "${test_all_report_file}"
+          rm -f "${btest_report_file}"
+          rm -fr "${test_spec_report_dir}"
+          rm -f launchable_stdout.log
+          rm -f launchable_stderr.log
+      if: always() && steps.setup-launchable.outcome == 'success'
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Record test results in Launchable
+      uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          if [[ "${test_all_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_all_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_all_session}" \
+              raw "${test_all_report_file}" || true; \
+          fi
+
+          if [[ "${btest_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${btest_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${btest_session}" \
+              raw "${btest_report_file}" || true; \
+          fi
+
+          if [[ "${test_spec_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_spec_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_spec_session}" \
+              raw ${test_spec_report_dir}/* || true; \
+          fi
+      if: ${{ always() && steps.setup-launchable.outcome == 'success' }}
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_session: ${{ steps.setup-launchable.outputs.test_all_session }}
+        btest_session: ${{ steps.setup-launchable.outputs.btest_session }}
+        test_spec_session: ${{ steps.setup-launchable.outputs.test_spec_session }}
+        stdout_report_path: ${{ steps.global.outputs.stdout_report_path }}
+        stderr_report_path: ${{ steps.global.outputs.stderr_report_path }}
+        LAUNCHABLE_SETUP_DIR: ${{ steps.setup-launchable.outputs.launchable_setup_dir }}
diff --git a/.github/actions/make-snapshot/action.yml b/.github/actions/make-snapshot/action.yml
new file mode 100644
index 0000000000..4552f0e067
--- /dev/null
+++ b/.github/actions/make-snapshot/action.yml
@@ -0,0 +1,77 @@
+name: 'make-snapshot'
+description: 'Make snapshot tarballs'
+inputs:
+  archname:
+    description: 'archname passed to tool/make-snapshot (e.g. snapshot-master)'
+    required: true
+  version:
+    description: 'Target Version'
+    required: false
+  shallow-since:
+    description: 'git fetch --shallow-since'
+    required: true
+    default: '2018-12-25 00:00:00'
+  fetch-branch:
+    description: 'fetch branch'
+    required: false
+  srcdir:
+    description: 'srcdir for tool/make-snapshot. Empty = clone ruby/ruby into ./ruby.'
+    required: false
+    default: ''
+  upload-artifact:
+    description: 'Upload Packages and Info as workflow artifacts. Pass "false" when callers run in a matrix that would collide on artifact names.'
+    required: false
+    default: 'true'
+
+runs:
+  using: "composite"
+  steps:
+    - name: Install libraries
+      run: |
+        set -x
+        sudo apt-get update -q || :
+        sudo apt-get install --no-install-recommends -q -y build-essential git bison autoconf ruby p7zip-full curl
+      shell: bash
+    - name: Checkout ruby/ruby for tool/make-snapshot
+      if: inputs.srcdir == ''
+      run: git clone --single-branch --depth=1 https://github.com/ruby/ruby ruby
+      shell: bash
+    - name: Fetch branches and notes (clone mode)
+      if: inputs.srcdir == ''
+      env:
+        SHALLOW_SINCE: ${{ inputs.shallow-since }}
+        FETCH_BRANCH: ${{ inputs.fetch-branch }}
+      run: |
+        set -x
+        cd ruby
+        git fetch --shallow-since="$SHALLOW_SINCE"
+        [ -n "$FETCH_BRANCH" ] && git fetch origin "+$FETCH_BRANCH:$FETCH_BRANCH"
+        git fetch origin '+refs/notes/commits:refs/notes/commits'
+        git fetch origin '+refs/notes/log-fix:refs/notes/log-fix'
+      shell: bash
+    - name: Fetch notes (local srcdir mode)
+      if: inputs.srcdir != ''
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        git fetch origin '+refs/notes/commits:refs/notes/commits' || :
+        git fetch origin '+refs/notes/log-fix:refs/notes/log-fix' || :
+      shell: bash
+    - name: Make snapshot
+      env:
+        ARCHNAME: ${{ inputs.archname }}
+        SRCDIR: ${{ inputs.srcdir }}
+        VERSION: ${{ inputs.version }}
+      run: |
+        [ -z "$SRCDIR" ] && SRCDIR=ruby
+        ruby "$SRCDIR/tool/make-snapshot" "-archname=$ARCHNAME" -srcdir="$SRCDIR" -packages=gzip,xz,zip pkg $VERSION
+      shell: bash
+    - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+      with:
+        name: Packages
+        path: pkg
+      if: ${{ inputs.upload-artifact == 'true' }}
+    - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+      with:
+        name: Info
+        path: pkg/info
+      if: ${{ inputs.upload-artifact == 'true' }}
diff --git a/.github/actions/setup/baseruby/action.yml b/.github/actions/setup/baseruby/action.yml
new file mode 100644
index 0000000000..76fe068897
--- /dev/null
+++ b/.github/actions/setup/baseruby/action.yml
@@ -0,0 +1,73 @@
+name: Setup directories etc.
+description: >-
+  Build baseruby for cross-compiling
+
+inputs:
+  srcdir:
+    required: true
+    default: ${{ github.workspace }}
+    description: >-
+      Directory of source codes.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}/baseruby
+    description: >-
+      Where baseruby will be built.
+
+  installdir:
+    required: false
+    default: install
+    description: >-
+      The path where the baseruby will be installed to.
+      This is relative from the workspace.
+
+outputs:
+  ruby:
+    value: ${{ steps.build.outputs.installdir }}/bin/ruby
+    description: >-
+      The path of the executable baseruby.
+  dump_ast:
+    value: ${{ steps.build.outputs.installdir }}/bin/dump_ast
+    description: >-
+      The path of the executable dump_ast.
+
+runs:
+  using: composite
+
+  steps:
+    - name: Build baseruby
+      shell: bash
+      id: build
+      run: |
+        case "$installdir" in /*) ;; *) installdir="$PWD/$installdir";; esac
+        mkdir "$builddir"
+        ln -sr "$srcdir" "$builddir/.src"
+        pushd "$builddir"
+        .src/configure "--prefix=${installdir}" --disable-install-doc
+        CONFIGURE_ARGS=--with-out-ext=-test- make install
+        install dump_ast "${installdir}/bin"
+        {
+          echo "${installdir}/bin/dump_ast"
+          echo "${installdir}/.installed.list"
+          echo "${installdir}/"
+        } >> .installed.list
+        cp .installed.list "${installdir}/"
+        make distclean
+        rm .src
+        popd
+        rmdir "$builddir"
+        {
+          echo "installdir=${installdir}"
+        } | tee -a "$GITHUB_OUTPUT"
+      env:
+        srcdir: ${{ inputs.srcdir }}
+        builddir: ${{ inputs.builddir }}
+        installdir: ${{ inputs.installdir }}
+
+    - name: clean
+      uses: gacts/run-and-post-run@598d7a875d5620e0457490555b5e18e46082aa47 # v1.4.4
+      with:
+        working-directory: ${{ inputs.srcdir }}
+        post: |
+          ruby tool/rbuninstall.rb "${{ steps.build.outputs.installdir }}/.installed.list" > /dev/null
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
new file mode 100644
index 0000000000..589049a4b8
--- /dev/null
+++ b/.github/actions/setup/directories/action.yml
@@ -0,0 +1,205 @@
+name: Setup directories etc.
+description: >-
+  Set up the source code and build directories (plus some
+  environmental tweaks)
+
+inputs:
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes.  This will be created
+      if absent.  If there is no `configure` file that is also
+      generated inside.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Where binaries and other generated contents go.  This will be
+      created if absent.
+
+  make-command:
+    required: false
+    type: string
+    default: 'make'
+    description: >-
+      The command of `make`.
+
+  makeup:
+    required: false
+    type: boolean
+    # Note that `default: false` evaluates to a string constant
+    # `'false'`, which is a truthy value :sigh:
+    # https://github.com/actions/runner/issues/2238
+    default: ''
+    description: >-
+      If set to true, additionally runs `make up`.
+
+  checkout:
+    required: false
+    type: boolean
+    default: true
+    description: >-
+      If set to '' (false), skip running actions/checkout. This is useful when
+      you don't want to overwrite a GitHub token that is already set up.
+
+  dummy-files:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, creates dummy files in build dir.
+
+  fetch-depth:
+    required: false
+    default: '1'
+    description: The depth of commit history fetched from the remote repository
+
+  clean:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, clean build directory.
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    # Note that `shell: bash` works on both Windows and Linux, but not
+    # `shell: sh`.  This is because GitHub hosted Windows runners have
+    # their bash manually installed.
+    - shell: bash
+      run: |
+        mkdir -p "${INPUT_SRCDIR}"
+        mkdir -p "${INPUT_BUILDDIR}"
+      env:
+        INPUT_SRCDIR: ${{ inputs.srcdir }}
+        INPUT_BUILDDIR: ${{ inputs.builddir }}
+
+    # Did you know that actions/checkout works without git(1)?  We are
+    # checking that here.
+    - id: which
+      shell: bash
+      run: |
+        echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
+        echo "sudo=`sudo true && command -v sudo`" >> "$GITHUB_OUTPUT"
+        echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
+
+    - if: steps.which.outputs.git
+      shell: bash
+      run: |
+        git config --global core.autocrlf false
+        git config --global core.eol lf
+        git config --global advice.detachedHead 0
+        git config --global init.defaultBranch garbage
+
+    - if: inputs.checkout
+      uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+      with:
+        path: ${{ inputs.srcdir }}
+        fetch-depth: ${{ inputs.fetch-depth }}
+        persist-credentials: false
+
+    - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+      with:
+        path: ${{ inputs.srcdir }}/.downloaded-cache
+        key: ${{ runner.os }}-${{ runner.arch }}-downloaded-cache
+
+    - if: steps.which.outputs.autoreconf
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: ./autogen.sh --install
+
+    # This is for MinGW.
+    - if: runner.os == 'Windows'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV # zizmor: ignore[github-env]
+
+    - if: runner.os == 'Linux'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc)))" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+
+    # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
+    - if: runner.os == 'macOS'
+      shell: bash
+      run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+
+    - if: inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        touch config.status .rbconfig.time
+        for mk in Makefile GNUmakefile; do
+          sed -f tool/prereq.status template/$mk.in > $mk
+        done
+        make up
+
+    # Cleanup, runs even on failure
+    - if: always() && inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        rm -f config.status .rbconfig.time \
+          Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
+        rm -f prism/.time prism/util/.time
+
+    - if: steps.which.outputs.sudo
+      shell: bash
+      run: |
+        sudo chmod -R go-w /usr/share
+        chmod -v go-w $HOME $HOME/.config || :
+        declare -a dirs # -A is not supported by old bash, e.g. macos
+        SAVE_IFS="$IFS" IFS=:; set $PATH
+        for d do
+          while [ -d "$d" ]; do
+            case "$IFS${dirs[*]}$IFS" in *"$IFS$d$IFS"*) ;; *) dirs+=("$d");; esac
+            d="${d%/*}"
+          done
+        done
+        IFS="$SAVE_IFS"
+        sudo chmod -v go-w "${dirs[@]}" || :
+
+    - if: inputs.dummy-files == 'true'
+      shell: bash
+      id: dummy-files
+      working-directory: ${{ inputs.builddir }}
+      run: |
+        : Create dummy files in build dir
+        set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
+        for file; do \
+          echo > $file "raise 'do not load $file'"; \
+        done
+        # drop {a..z}.rb if case-insensitive filesystem
+        grep -F A.rb a.rb > /dev/null && set "${@:27}"
+        echo clean="cd ${INPUT_BUILDDIR} && rm $*" >> $GITHUB_OUTPUT
+      env:
+        INPUT_BUILDDIR: ${{ inputs.builddir }}
+
+    - if: inputs.clean == 'true'
+      shell: bash
+      id: clean
+      run: |
+        echo distclean="cd ${INPUT_BUILDDIR} && ${INPUT_MAKE_COMMAND} distclean" >> $GITHUB_OUTPUT
+        echo remained-files="find ${INPUT_BUILDDIR} -ls" >> $GITHUB_OUTPUT
+        [ "${INPUT_BUILDDIR}" = "${INPUT_SRCDIR}" ] ||
+        echo final="rmdir ${INPUT_BUILDDIR}" >> $GITHUB_OUTPUT
+      env:
+        INPUT_BUILDDIR: ${{ inputs.builddir }}
+        INPUT_SRCDIR: ${{ inputs.srcdir }}
+        INPUT_MAKE_COMMAND: ${{ inputs.make-command }}
+
+    - name: clean
+      uses: gacts/run-and-post-run@598d7a875d5620e0457490555b5e18e46082aa47 # v1.4.4
+      with:
+        working-directory:
+        post: |
+          ${{ steps.dummy-files.outputs.clean }}
+          ${{ steps.clean.outputs.distclean }}
+          ${{ steps.clean.outputs.remained-files }}
+          ${{ steps.clean.outputs.final }}
+      # rmdir randomly fails due to launchable files
+      continue-on-error: true
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
new file mode 100644
index 0000000000..9cd37a9b12
--- /dev/null
+++ b/.github/actions/setup/macos/action.yml
@@ -0,0 +1,29 @@
+name: Setup macOS environment
+description: >-
+  Installs necessary packages via Homebrew.
+
+inputs: {} # nothing?
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - name: brew
+      shell: bash
+      run: |
+        brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
+
+    - name: Set ENV
+      shell: bash
+      run: | # zizmor: ignore[github-env]
+        dir_config() {
+          local args=() lib var="$1"; shift
+          for lib in "$@"; do
+            args+=("--with-${lib%@*}-dir=$(brew --prefix $lib)")
+          done
+          echo "$var=${args[*]}" >> $GITHUB_ENV
+        }
+        dir_config ruby_configure_args gmp
+        dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
new file mode 100644
index 0000000000..5209ccc03f
--- /dev/null
+++ b/.github/actions/setup/ubuntu/action.yml
@@ -0,0 +1,72 @@
+name: Setup ubuntu environment
+description: >-
+  At the beginning there was no way but to copy & paste `apt-get`
+  everywhere.  But now that we have composite actions, it seems better
+  merge them into one.
+
+inputs:
+  arch:
+    required: false
+    default: ''
+    description: >-
+      Architecture.  Because we run this on a GitHub-hosted runner
+      acceptable value for this input is very limited.
+
+outputs:
+  arch:
+    value: ${{ steps.uname.outputs.uname }}
+    description: >-
+      Actual architecture.  This could be different from the one
+      passed to the `inputs.arch`.  For instance giving `i386` to this
+      action yields `i686`.
+
+runs:
+  using: composite
+
+  steps:
+    - id: uname
+      name: uname
+      shell: bash
+      env:
+        arch: ${{ inputs.arch }}
+      run: |
+        setarch="${arch:+setarch $arch --}"
+        # normalize `uname`
+        if uname=$(${setarch} uname -m 2> /dev/null); then
+          # `setarch` works, `$arch` is a valid architecture name.
+          echo "setarch=${setarch}" >> "$GITHUB_OUTPUT"
+        else
+          # if `setarch` failed, take the given `arch` as-is.
+          uname="${arch}"
+          setarch=""
+        fi
+        echo "uname=$uname" >> "$GITHUB_OUTPUT"
+        echo "dpkg=${uname/686/386}" >> "$GITHUB_OUTPUT"
+
+    - name: set SETARCH
+      shell: bash
+      run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+      env:
+        setarch: ${{ steps.uname.outputs.setarch }} # validated
+
+    - name: dpkg setup
+      shell: bash
+      run: sudo dpkg --add-architecture "${dpkg}"
+      # `dpkg` is valid, also `uname`.
+      if: ${{ inputs.arch }}
+      env:
+        dpkg: ${{ steps.uname.outputs.dpkg }}
+
+    - name: apt-get
+      shell: bash
+      env:
+        arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
+      run: |
+        set -x
+        sudo apt-get update -qq || :
+        sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
+        ${arch:+cross}build-essential${arch/:/-} \
+        libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+        zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+        autoconf ruby
+        sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
new file mode 100644
index 0000000000..6f89bef11a
--- /dev/null
+++ b/.github/actions/slack/action.yml
@@ -0,0 +1,51 @@
+name: Post a message to slack
+description: >-
+  We have our ruby/action-slack webhook.  However its arguments are
+  bit verbose to be listed in every workflow files.  Better merge them
+  into one.
+
+inputs:
+  SLACK_WEBHOOK_URL:
+    required: true
+    description: >-
+      The URL to post the payload.  This is an input because it tends
+      to be stored in a secrets vault and a composite action cannot
+      look into one.
+
+  label:
+    required: false
+    description: >-
+      Human-readable description of the run, something like "DEBUG=1".
+      This need not be unique among runs.
+
+  event_name:
+    required: false
+    default: 'push'
+    description: >-
+      Target event to trigger notification. Notify only push by default.
+
+  extra_channel_id:
+    required: false
+    description: >-
+      Slack channel ID to notify besides #alerts and #alerts-emoji.
+
+outputs: {} # Nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+      with:
+        payload: |
+          {
+            "ci": "GitHub Actions",
+            "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
+            "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+            "commit": "${{ github.sha }}",
+            "branch": "${{ github.ref_name }}"
+            ${{ inputs.extra_channel_id && format(', "extra_channel_id": "{0}"', inputs.extra_channel_id) }}
+          }
+      env:
+        SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
+      if: ${{ github.event_name == inputs.event_name && startsWith(github.repository, 'ruby/') }}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
new file mode 100644
index 0000000000..9e20cb7459
--- /dev/null
+++ b/.github/auto_request_review.yml
@@ -0,0 +1,21 @@
+files:
+  'yjit*': [team:jit]
+  'yjit/**/*': [team:jit]
+  'yjit/src/cruby_bindings.inc.rs': []
+  'bootstraptest/test_yjit*': [team:jit]
+  'test/ruby/test_yjit*': [team:jit]
+  'zjit*': [team:jit]
+  'zjit/**/*': [team:jit]
+  'zjit/src/cruby_bindings.inc.rs': []
+  'test/ruby/test_zjit*': [team:jit]
+  'defs/jit.mk': [team:jit]
+  'tool/zjit_bisect.rb': [team:jit]
+  'doc/jit/*': [team:jit]
+  # Skip files updated by dependabot. It's noisy in notifications, and they're auto-merged anyway.
+  'yjit/Cargo.lock': []
+  'zjit/Cargo.lock': []
+  '.github/workflows/yjit-*.yml': []
+  '.github/workflows/zjit-*.yml': []
+options:
+  ignore_draft: true
+  last_files_match_only: true
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
new file mode 100644
index 0000000000..f5d33545c1
--- /dev/null
+++ b/.github/codeql/codeql-config.yml
@@ -0,0 +1,22 @@
+paths-ignore:
+  - benchmark
+  - sample
+  - spec/ruby/command_line/fixtures
+  - spec/ruby/core/enumerable/shared/inject.rb
+  - spec/ruby/core/exception/fixtures
+  - spec/ruby/core/proc/parameters_spec.rb
+  - spec/ruby/core/proc/ruby2_keywords_spec.rb
+  - spec/ruby/core/range/reverse_each_spec.rb
+  - spec/ruby/language/fixtures
+  - spec/ruby/language/lambda_spec.rb
+  - spec/ruby/language/method_spec.rb
+  - spec/ruby/language/string_spec.rb
+  - test/error_highlight/test_error_highlight.rb
+  - test/prism/result/named_capture_test.rb
+  - test/ruby/test_call.rb
+  - test/ruby/test_signal.rb
+  - test/ruby/test_super.rb
+  - test/ruby/test_syntax.rb
+  - test/ruby/test_unicode_escape.rb
+  - test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspec
+  - trace_point.rb
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..57da742e5c
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,29 @@
+version: 2
+updates:
+  - package-ecosystem: 'github-actions'
+    directories:
+      - '/'
+      - '/.github/actions/slack'
+      - '/.github/actions/setup/directories'
+    schedule:
+      interval: 'daily'
+    groups:
+      github-actions:
+        patterns:
+          - "*"
+  - package-ecosystem: 'cargo'
+    directories:
+      - '/yjit'
+      - '/zjit'
+    exclude-paths:
+      - 'gc/mmtk/**'
+    schedule:
+      interval: 'monthly'
+    groups:
+      jit:
+        patterns:
+          - "*"
+  - package-ecosystem: 'vcpkg'
+    directory: '/'
+    schedule:
+      interval: 'daily'
diff --git a/.github/labeler.yml b/.github/labeler.yml
new file mode 100644
index 0000000000..f39fcec386
--- /dev/null
+++ b/.github/labeler.yml
@@ -0,0 +1,7 @@
+Documentation:
+- changed-files:
+  - all-globs-to-all-files: doc/**
+
+Backport:
+- base-branch: 'ruby_3_\d'
+- base-branch: 'ruby_4_\d'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
new file mode 100644
index 0000000000..1d23c38fcd
--- /dev/null
+++ b/.github/workflows/annocheck.yml
@@ -0,0 +1,111 @@
+name: Annocheck
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  compile:
+    name: test-annocheck
+
+    runs-on: ubuntu-latest
+
+    container:
+      image: ghcr.io/ruby/ruby-ci-image:gcc-11
+      options: --user root
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    env:
+      CONFIGURE_TTY: never
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci rgengc
+      RUBY_TESTOPTS: >-
+        -q
+        --color=always
+        --tty=no
+      # FIXME: Drop skipping options
+      # https://bugs.ruby-lang.org/issues/18061
+      # https://sourceware.org/annobin/annobin.html/Test-pie.html
+      TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
+
+    steps:
+      - run: id
+        working-directory:
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      # Minimal flags to pass the check.
+      # -g0 disables backtraces when SEGV.  Do not set that.
+      - name: Run configure
+        run: >
+          ../src/configure -C
+          --enable-debug-env
+          --disable-install-doc
+          --with-ext=-test-/cxxanyargs,+
+          --without-valgrind
+          --without-jemalloc
+          --without-gmp
+          --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
+          --enable-shared
+          debugflags=-ggdb3
+          optflags=-O2
+          LDFLAGS=-Wl,-z,now
+
+      - run: make showflags
+
+      - run: make
+
+      - run: make test-annocheck
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
new file mode 100644
index 0000000000..1be2b11b86
--- /dev/null
+++ b/.github/workflows/auto_request_review.yml
@@ -0,0 +1,20 @@
+name: Auto Request Review
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+
+permissions:
+  contents: read
+
+jobs:
+  auto-request-review:
+    name: Auto Request Review
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+    steps:
+      - name: Request review based on files changes and/or groups the author belongs to
+        uses: necojackarc/auto-request-review@5d3060495e58e9cb41f51de50e808d3135d5374e # master
+        with:
+          # scope: public_repo
+          token: ${{ secrets.MATZBOT_AUTO_REQUEST_REVIEW_TOKEN }}
diff --git a/.github/workflows/auto_review_pr.yml b/.github/workflows/auto_review_pr.yml
new file mode 100644
index 0000000000..24859ad0b0
--- /dev/null
+++ b/.github/workflows/auto_review_pr.yml
@@ -0,0 +1,41 @@
+name: Auto Review PR
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+  workflow_dispatch:
+    inputs:
+      pr_number:
+        description: 'PR number to review'
+        required: true
+        type: number
+
+permissions:
+  contents: read
+
+jobs:
+  auto-review-pr:
+    name: Auto Review PR
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && (github.base_ref == 'master' || github.event_name == 'workflow_dispatch') }}
+
+    permissions:
+      pull-requests: write
+      contents: read
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Auto Review PR
+        run: ruby tool/auto_review_pr.rb "$GITHUB_PR_NUMBER"
+        env:
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GITHUB_PR_NUMBER: ${{ github.event.pull_request.number || github.event.inputs.pr_number }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..1acfbe19ac
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,76 @@
+name: BASERUBY Check
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  baseruby:
+    name: BASERUBY
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        ruby:
+          - ruby-3.1
+          - ruby-3.2
+          - ruby-3.3
+
+    steps:
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+
+      - run: ./configure --disable-install-doc
+
+      - run: make all
+
+      - run: make test
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..d890ed2495
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,186 @@
+name: bundled_gems
+
+env:
+  UPDATE_ENABLED: true
+
+on:
+  push:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  pull_request:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  merge_group:
+  schedule:
+    - cron: '45 6 * * *'
+  workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  update:
+    permissions:
+      contents: write # for Git to git push
+
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+
+    name: update ${{ github.workflow }}
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: 4.0
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Set ENV
+        run: |
+          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+      - name: Download previous gems list
+        run: |
+          mkdir -p .downloaded-cache
+          for data in bundled_gems.json default_gems.json; do
+            ln -s .downloaded-cache/$data .
+            curl --retry 5 --retry-connrefused --retry-delay 2 --retry-max-time 60 -O -R -z ./$data https://stdgems.org/$data
+          done
+
+      - name: Update bundled gems list
+        id: bundled_gems
+        run: |
+          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb bundled
+          ruby tool/update-NEWS-github-release.rb --update
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          news= gems=
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
+          news=true
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
+          gems=true
+          git add -- NEWS.md gems/bundled_gems
+          echo news=$news >> $GITHUB_OUTPUT
+          echo gems=$gems >> $GITHUB_OUTPUT
+          echo update=${news:-$gems} >> $GITHUB_OUTPUT
+
+      - name: Commit
+        id: commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          message="Update bundled gems list"
+          if [ -z "${gems}" ]; then
+            git commit --message="[DOC] ${message} at ${GITHUB_SHA:0:30}"
+          else
+            git commit --message="${message} as of ${TODAY}"
+          fi
+        env:
+          TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          gems: ${{ steps.diff.outputs.gems }}
+        if: ${{ steps.diff.outputs.update }}
+
+      - name: Development revision of bundled gems
+        run: |
+          #!ruby
+          file = "gems/bundled_gems"
+
+          SECONDS_IN_DAY = 86400
+          today = Time.new("#{ENV['TODAY']}Z")
+          if !(december = today.month == 12)
+            days = 30
+          elsif (days = 26 - today.day).positive?
+            days += 4
+          else
+            puts "::info:: just after released"
+            exit
+          end
+
+          since = "#{today.year-1}-12-26"
+          ref = ENV['GITHUB_REF']
+          puts "::group::\e[94mfetching \e[1m#{file}\e[22m since \e[1m#{since}\e[22m from \e[1m#{ref}\e[m"
+          system(*%W[git fetch --shallow-since=#{since} --no-tags origin #{ref}], exception: true)
+          puts "::endgroup::"
+
+          puts "\e[94mchecking development version bundled gems older than \e[1m#{days}\e[22m days\e[m"
+          limit = today.to_i - days * SECONDS_IN_DAY
+          old = 0
+          IO.popen(%W"git blame --line-porcelain -- #{file}") do |blame|
+            while head = blame.gets("\n\t") and s = blame.gets
+              next unless (gem = s.split(/\s+|#.*/)).size > 3
+              time = head[/^committer-time \K\d+/].to_i
+              next if (d = limit - time) <= 0
+              d /= SECONDS_IN_DAY
+              line = head[/\A\h+ \d+ \K\d+/].to_i
+              level = if d < days; 'warning'; else old += 1; 'error'; end
+              d += days
+              puts "::#{level} file=#{file},line=#{line},title=Older than #{d} days::#{gem[0]} #{gem[3]}"
+            end
+          end
+          abort "::error title=Too long-standing gems::The release comes soon." if december and old.nonzero?
+        shell: ruby {0}
+        env:
+          file: ${{ steps.logs.outputs.file }}
+          days: ${{ steps.logs.outputs.days }}
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Build
+        run: |
+          ./autogen.sh
+          ./configure -C --disable-install-doc
+          make
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Prepare bundled gems
+        run: |
+          make -s prepare-gems
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Test bundled gems
+        run: |
+          make -s test-bundled-gems
+        timeout-minutes: 30
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Push
+        run: |
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.commit.outcome == 'success'
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..ad399b264f
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,61 @@
+name: Check Dependencies
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update-deps:
+    name: Dependency checks
+
+    strategy:
+      matrix:
+        os: [ubuntu-latest]
+      fail-fast: true
+
+    runs-on: ${{ matrix.os }}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - uses: ./.github/actions/setup/directories
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - name: Run configure
+        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+
+      - run: make fix-depends
+
+      - run: git diff --color --no-ext-diff --ignore-submodules --exit-code
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / Dependencies need to update
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
new file mode 100644
index 0000000000..f194d00779
--- /dev/null
+++ b/.github/workflows/check_misc.yml
@@ -0,0 +1,151 @@
+name: Misc
+on: [push, pull_request, merge_group]
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  checks:
+    name: Miscellaneous checks
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: head
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Re-generate Makefiles
+        run: |
+          # config.status needs to run as a shell script
+          { echo ':&&exit'; cat tool/prereq.status; } > config.status
+          : # same as actions/setup/directories/action.yml
+          for mk in Makefile GNUmakefile; do
+            sed -f tool/prereq.status template/$mk.in > $mk
+          done
+
+      - name: Check for code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA"
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.pull_request.base.sha }}
+          GITHUB_NEW_SHA: ${{ github.event.pull_request.merge_commit_sha }}
+        # Skip 'push' events because post_push.yml fixes them on push
+        if: ${{ github.repository == 'ruby/ruby' && startsWith(github.event_name, 'pull') }}
+
+      - name: Check if date in man pages is up-to-date
+        run: |
+          git fetch origin --depth=1 "${GITHUB_OLD_SHA}"
+          git diff --exit-code --name-only "${GITHUB_OLD_SHA}" HEAD -- man ||
+          make V=1 GIT=git BASERUBY=ruby update-man-date
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- man
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.pull_request.base.sha }}
+        if: ${{ startsWith(github.event_name, 'pull') }}
+
+      - name: Check for bash specific substitution in configure.ac
+        run: |
+          git grep -n '\${[A-Za-z_0-9]*/' -- configure.ac && exit 1 || :
+
+      - name: Check for header macros
+        run: |
+          fail=
+          for header in ruby/*.h; do
+            git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null && continue
+            fail=1
+            echo $header
+          done
+          exit $fail
+        working-directory: include
+
+      - id: now
+        run: |
+          date +"mon=%-m"%n"day=%-d" >> $GITHUB_OUTPUT
+        env:
+          TZ: Asia/Tokyo
+
+      - id: deprecation
+        run: |
+          eval $(sed -n 's/^#define RUBY_API_VERSION_\(MAJOR\|MINOR\) /\1=/p' include/ruby/version.h)
+          if git --no-pager grep --color -o 'rb_warn_deprecated_to_remove_at('$MAJOR'\.'$MINOR',.*' -- '*.c' >&2; then
+              false
+          else
+              true
+          fi
+        continue-on-error: ${{ steps.now.outputs.mon < 12 }}
+
+      - name: Check if to generate documents
+        id: rdoc
+        run: |
+          set -- $(sed 's/#.*//;/^rdoc /!d' gems/bundled_gems)
+          { echo version=$2; echo ref=$4; } >> $GITHUB_OUTPUT
+
+      - name: Checkout rdoc
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          repository: ruby/rdoc
+          ref: ${{ steps.rdoc.outputs.ref }}
+          path: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+          persist-credentials: false
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Generate rdoc scripts
+        run: |
+          set -x
+          gempath=$(ruby -e 'print Gem.user_dir, "/bin"')
+          PATH=$gempath:$PATH
+          gem install --user bundler
+          bundle config --local path vendor/bundle
+          bundle install --jobs 4
+          bundle exec rake generate
+        working-directory: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Core docs coverage
+        run: |
+          make XRUBY=ruby RDOC_DEPENDS= RBCONFIG=update-rbconfig rdoc-coverage
+
+      - name: Generate docs
+        id: docs
+        run: |
+          make XRUBY=ruby RDOC_DEPENDS= RBCONFIG=update-rbconfig HTMLOUT=html html
+          echo htmlout=ruby-html-${GITHUB_SHA:0:10} >> $GITHUB_OUTPUT
+        # Generate only when document commit/PR
+        if: >-
+          ${{false
+          || contains(github.event.head_commit.message, '[ruby/rdoc]')
+          || contains(github.event.head_commit.message, '[DOC]')
+          || contains(github.event.pull_request.title, '[DOC]')
+          || contains(github.event.pull_request.labels.*.name, 'Documentation')
+          }}
+
+      - name: Upload docs
+        uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        with:
+          path: html
+          name: ${{ steps.docs.outputs.htmlout }}
+        if: ${{ steps.docs.outcome == 'success' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_sast.yml b/.github/workflows/check_sast.yml
new file mode 100644
index 0000000000..6fd1be6542
--- /dev/null
+++ b/.github/workflows/check_sast.yml
@@ -0,0 +1,133 @@
+name: 'Check SAST tool'
+
+on:
+  push:
+    branches: ['master']
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  schedule:
+    - cron: '0 12 * * *'
+  workflow_dispatch:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  zizmor:
+    name: zizmor
+
+    runs-on: ubuntu-latest
+
+    permissions:
+      contents: read
+      security-events: write
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Run zizmor
+        uses: zizmorcore/zizmor-action@5f14fd08f7cf1cb1609c1e344975f152c7ee938d # v0.5.6
+        continue-on-error: true
+
+  analyze:
+    name: Analyze
+    runs-on: ubuntu-latest
+    permissions:
+      actions: read # for github/codeql-action/init to get workflow details
+      contents: read # for actions/checkout to fetch code
+      security-events: write # for github/codeql-action/upload-sarif to send a status report
+    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - language: cpp
+          - language: ruby
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Initialize CodeQL
+        uses: github/codeql-action/init@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          languages: ${{ matrix.language }}
+          build-mode: none
+          config-file: .github/codeql/codeql-config.yml
+
+      - name: Perform CodeQL Analysis
+        uses: github/codeql-action/analyze@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          category: '/language:${{ matrix.language }}'
+          upload: False
+          output: sarif-results
+
+      - name: filter-sarif
+        uses: advanced-security/filter-sarif@2da736ff05ef065cb2894ac6892e47b5eac2c3c0 # v1.1
+        with:
+          patterns: |
+            +**/*.rb
+            -lib/uri/mailto.rb:rb/overly-large-range
+            -lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/mailto.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -spec/ruby/core/regexp/timeout_spec.rb:rb/redos
+            -test/ruby/test_io.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_open-uri.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_ssl.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/binread_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/readlines_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/foreach_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/write_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/read_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/kernel/open_spec.rb:rb/non-constant-kernel-open
+          input: sarif-results/${{ matrix.language }}.sarif
+          output: sarif-results/${{ matrix.language }}.sarif
+        if: ${{ matrix.language == 'ruby' }}
+        continue-on-error: true
+
+      - name: filter-sarif
+        uses: advanced-security/filter-sarif@2da736ff05ef065cb2894ac6892e47b5eac2c3c0 # v1.1
+        with:
+          patterns: |
+            +**/*.c
+            +**/*.h
+          input: sarif-results/${{ matrix.language }}.sarif
+          output: sarif-results/${{ matrix.language }}.sarif
+        if: ${{ matrix.language == 'cpp' }}
+        continue-on-error: true
+
+      - name: Upload SARIF
+        uses: github/codeql-action/upload-sarif@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          sarif_file: sarif-results/${{ matrix.language }}.sarif
+        continue-on-error: true
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..147470f38a
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,333 @@
+# Some tests depending on this name 'Compilations' via $GITHUB_WORKFLOW. Make sure to update such tests when renaming this workflow.
+name: Compilations
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Each job is split so that they roughly take 30min to run through.
+jobs:
+  compile-if:
+    name: 'omnibus compilations, trigger'
+    runs-on: ubuntu-latest
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+    steps:
+      - run: true
+        working-directory:
+
+  compile1:
+    name: 'omnibus compilations, #1'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      # Set fetch-depth: 10 so that Launchable can receive commits information.
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'clang 22 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: clang-22
+          with_gcc: 'clang-22 -flto=auto'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 30
+      - { uses: './.github/actions/compilers', name: '-O0', with: { optflags: '-O0 -march=x86-64 -mtune=generic' }, timeout-minutes: 5 }
+      # - { uses: './.github/actions/compilers', name: '-O3', with: { optflags: '-O3 -march=x86-64 -mtune=generic', check: true } }
+
+  compile2:
+    name: 'omnibus compilations, #2'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'GCC 15 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: gcc-15
+          with_gcc: 'gcc-15 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 10
+      - { uses: './.github/actions/compilers', name: 'ext/Setup', with: { static_exts: 'etc json/* */escape' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 15', with: { tag: 'gcc-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 14', with: { tag: 'gcc-14' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 13', with: { tag: 'gcc-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 12', with: { tag: 'gcc-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 11', with: { tag: 'gcc-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 10', with: { tag: 'gcc-10' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 9',  with: { tag: 'gcc-9'  }, timeout-minutes: 5 }
+
+  compile3:
+    name: 'omnibus compilations, #3'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 20', with: { tag: 'clang-20' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 19', with: { tag: 'clang-19' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 18', with: { tag: 'clang-18' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 17', with: { tag: 'clang-17' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 16', with: { tag: 'clang-16' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 15', with: { tag: 'clang-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 14', with: { tag: 'clang-14' }, timeout-minutes: 5 }
+
+  compile4:
+    name: 'omnibus compilations, #4'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 13', with: { tag: 'clang-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 12', with: { tag: 'clang-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 11', with: { tag: 'clang-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 10', with: { tag: 'clang-10' }, timeout-minutes: 5 }
+        # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o and fail `make test-leaked-globals`.
+      - { uses: './.github/actions/compilers', name: 'clang 9',  with: { tag: 'clang-9',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 8',  with: { tag: 'clang-8',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 7',  with: { tag: 'clang-7',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 6',  with: { tag: 'clang-6.0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compile5:
+    name: 'omnibus compilations, #5'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      # -Wno-strict-prototypes is necessary with current clang-15 since
+      # older autoconf generate functions without prototype and -pedantic
+      # now implies strict-prototypes. Disabling the error but leaving the
+      # warning generates a lot of noise from use of ANYARGS in
+      # rb_define_method() and friends.
+      # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+      - { uses: './.github/actions/compilers', name: 'C99',      with: { CFLAGS: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C11',   with: { CFLAGS:   '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C17',   with: { CFLAGS:   '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C23',   with: { CFLAGS:   '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++98', with: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++11', with: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++14', with: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++17', with: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+
+  compile6:
+    name: 'omnibus compilations, #6'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'C++20', with: { CXXFLAGS: '-std=c++20 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++23', with: { CXXFLAGS: '-std=c++23 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++26', with: { CXXFLAGS: '-std=c++26 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'gmp',                 with: { append_configure: '--with-gmp', test_all: 'ruby/test_bignum.rb', test_spec: "/github/workspace/src/spec/ruby/core/integer" }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'jemalloc',            with: { append_configure: '--with-jemalloc' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'valgrind',            with: { append_configure: '--with-valgrind' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=ucontext',  with: { append_configure: '--with-coroutine=ucontext' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=pthread',   with: { append_configure: '--with-coroutine=pthread' }, timeout-minutes: 5 }
+
+  compile7:
+    name: 'omnibus compilations, #7'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'disable-jit',         with: { append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-yjit',        with: { append_configure: '--disable-yjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-zjit',        with: { append_configure: '--disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-dln',         with: { append_configure: '--disable-dln' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'enable-mkmf-verbose', with: { append_configure: '--enable-mkmf-verbose' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-rubygems',    with: { append_configure: '--disable-rubygems' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEVEL',          with: { append_configure: '--enable-devel' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=0',            with: { cppflags: '-DOPT_THREADED_CODE=0' }, timeout-minutes: 5 }
+
+  compile8:
+    name: 'omnibus compilations, #8'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'NDEBUG',                         with: { cppflags: '-DNDEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEBUG',                     with: { cppflags: '-DRUBY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ARRAY_DEBUG',                    with: { cppflags: '-DARRAY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CCAN_LIST_DEBUG',                with: { cppflags: '-DCCAN_LIST_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CPDEBUG=-1',                     with: { cppflags: '-DCPDEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ENC_DEBUG',                      with: { cppflags: '-DENC_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG',                       with: { cppflags: '-DGC_DEBUG' }, timeout-minutes: 5 }
+
+  compile9:
+    name: 'omnibus compilations, #9'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'HASH_DEBUG',                     with: { cppflags: '-DHASH_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ID_TABLE_DEBUG',                 with: { cppflags: '-DID_TABLE_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_DEBUG=-1',                with: { cppflags: '-DRGENGC_DEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SYMBOL_DEBUG',                   with: { cppflags: '-DSYMBOL_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_CHECK_MODE',              with: { cppflags: '-DRGENGC_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_CHECK_MODE',                  with: { cppflags: '-DVM_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_EMBED_CI=0',                 with: { cppflags: '-DUSE_EMBED_CI=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_FLONUM=0',                   with: { cppflags: '-DUSE_FLONUM=0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compileX:
+    name: 'omnibus compilations, #10'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'USE_LAZY_LOAD',                  with: { cppflags: '-DUSE_LAZY_LOAD' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_RUBY_DEBUG_LOG=1',           with: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_DEBUG_COUNTER',              with: { cppflags: '-DUSE_DEBUG_COUNTER=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SHARABLE_MIDDLE_SUBSTRING',      with: { cppflags: '-DSHARABLE_MIDDLE_SUBSTRING=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_FIND_TIME_NUMGUESS',       with: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_INTEGER_PACK',             with: { cppflags: '-DDEBUG_INTEGER_PACK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=1',            with: { cppflags: '-DOPT_THREADED_CODE=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=2',            with: { cppflags: '-DOPT_THREADED_CODE=2' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 21', with: { tag: 'clang-21' }, timeout-minutes: 5 }
+
+  compileB:
+    name: 'omnibus compilations, #11'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG_STRESS_TO_CLASS',       with: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_ENABLE_LAZY_SWEEP=0',         with: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_DETAIL_MEMORY',       with: { cppflags: '-DGC_PROFILE_DETAIL_MEMORY' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_MORE_DETAIL',         with: { cppflags: '-DGC_PROFILE_MORE_DETAIL' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'MALLOC_ALLOCATED_SIZE_CHECK',    with: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_ESTIMATE_OLDMALLOC',      with: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_PROFILE',                 with: { cppflags: '-DRGENGC_PROFILE' }, timeout-minutes: 5 }
+
+  compileC:
+    name: 'omnibus compilations, #12'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_BP_CHECK',              with: { cppflags: '-DVM_DEBUG_BP_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_VERIFY_METHOD_CACHE',   with: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'YJIT_FORCE_ENABLE',              with: { cppflags: '-DYJIT_FORCE_ENABLE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'UNIVERSAL_PARSER',               with: { cppflags: '-DUNIVERSAL_PARSER' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 23', with: { tag: 'clang-23' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 22', with: { tag: 'clang-22' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 8',  with: { tag: 'gcc-8'  }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 7',  with: { tag: 'gcc-7'  }, timeout-minutes: 5 }
+
+  compilemax:
+    name: 'omnibus compilations, result'
+    runs-on: ubuntu-latest
+    if: ${{ always() }}
+    needs:
+      - 'compile1'
+      - 'compile2'
+      - 'compile3'
+      - 'compile4'
+      - 'compile5'
+      - 'compile6'
+      - 'compile7'
+      - 'compile8'
+      - 'compile9'
+      - 'compileX'
+      - 'compileB'
+      - 'compileC'
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - uses: ./.github/actions/slack
+        with:
+          label: 'omnibus'
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+      - run: false
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/crosscompile.yml b/.github/workflows/crosscompile.yml
new file mode 100644
index 0000000000..4c28516e25
--- /dev/null
+++ b/.github/workflows/crosscompile.yml
@@ -0,0 +1,123 @@
+name: Cross compile
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    name: make (${{ matrix.host }} host on ${{ matrix.build }})
+    strategy:
+      matrix:
+        include:
+          - host: aarch64-linux-gnu
+            arch: arm64
+            build: x86_64-linux-gnu
+            runs-on: ubuntu-24.04
+            file_arch: ARM aarch64
+          - host: x86_64-linux-gnu
+            arch: amd64
+            build: aarch64-linux-gnu
+            runs-on: ubuntu-24.04-arm
+            file_arch: x86-64
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ${{ matrix.runs-on }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Setup cross-compilation toolchain sources
+        run: |
+          native_arch=$(dpkg --print-architecture)
+          # Restrict existing sources to native arch
+          sudo sed -i '/^Architectures:/d' /etc/apt/sources.list.d/ubuntu.sources
+          sudo sed -i "/^Types:/a Architectures: ${native_arch}" /etc/apt/sources.list.d/ubuntu.sources
+          # Add cross-arch sources
+          if [ "${{ matrix.arch }}" = "arm64" ]; then
+            cross_uri="http://ports.ubuntu.com/"
+          else
+            cross_uri="http://archive.ubuntu.com/ubuntu/"
+          fi
+          printf '%s\n' \
+            "Types: deb" \
+            "URIs: ${cross_uri}" \
+            "Suites: noble noble-updates noble-security" \
+            "Components: main universe" \
+            "Architectures: ${{ matrix.arch }}" \
+            | sudo tee /etc/apt/sources.list.d/cross-${{ matrix.arch }}.sources
+
+      - uses: ./.github/actions/setup/ubuntu
+        with:
+          arch: ${{ matrix.arch }}
+
+      - uses: ./.github/actions/setup/baseruby
+        id: baseruby
+        with:
+          srcdir: src
+
+      - name: Run configure
+        run: >-
+          ../src/configure -C --disable-install-doc
+          --prefix=/usr
+          --build=${{ matrix.build }}
+          --host=${{ matrix.host }}
+          --with-baseruby="$baseruby"
+        env:
+          baseruby: ${{ steps.baseruby.outputs.ruby }}
+
+      - run: make
+
+      - run: make install DESTDIR=$PWD/install
+
+      - name: Verify cross-compiled binary
+        run: |
+          file install/usr/bin/ruby
+          file install/usr/bin/ruby | grep -q '${{ matrix.file_arch }}'
+
+      - uses: ./.github/actions/slack
+        with:
+          label: cross ${{ matrix.host }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
new file mode 100644
index 0000000000..5ab86c7b19
--- /dev/null
+++ b/.github/workflows/cygwin.yml
@@ -0,0 +1,75 @@
+name: Cygwin
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    runs-on: windows-2022
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - run: git config --global core.autocrlf input
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Setup Cygwin
+        uses: cygwin/cygwin-install-action@711d29f3da23c9f4a1798e369a6f01198c13b11a # v6.1
+        with:
+          packages: ruby gcc-core make autoconf libtool libssl-devel libyaml-devel libffi-devel zlib-devel rubygems
+          site: |
+            https://cygwin.osuosl.org/
+
+      - name: configure
+        run: |
+          ./autogen.sh
+          ./configure --disable-install-doc
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: Extract bundled gems
+        run: |
+          make ruby -j5
+          make extract-gems
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4 V=1
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Cygwin
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/default_gems_list.yml b/.github/workflows/default_gems_list.yml
new file mode 100644
index 0000000000..f52b83103c
--- /dev/null
+++ b/.github/workflows/default_gems_list.yml
@@ -0,0 +1,99 @@
+name: Update default gems list
+on: [push, pull_request, merge_group]
+
+env:
+  UPDATE_NEWS_ENABLED: true
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update_default_gems_list:
+    name: Update default gems list
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - id: gems
+        run: true
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Download previous gems list
+        run: |
+          data=default_gems.json
+          mkdir -p .downloaded-cache
+          ln -s .downloaded-cache/$data .
+          curl --retry 5 --retry-connrefused --retry-delay 2 --retry-max-time 60 -O -R -z ./$data https://stdgems.org/$data
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Make default gems list
+        run: |
+          #!ruby
+          require 'rubygems'
+          $:.unshift "lib"
+          rgver = File.foreach("lib/rubygems.rb") do |line|
+            break $1 if /^\s*VERSION\s*=\s*"([^"]+)"/ =~ line
+          end
+          gems = Dir.glob("{ext,lib}/**/*.gemspec").map do |f|
+            spec = Gem::Specification.load(f)
+            "#{spec.name} #{spec.version}"
+          end.sort
+          File.open("gems/default_gems", "w") do |f|
+            f.puts "RubyGems #{rgver}"
+            f.puts gems
+          end
+        shell: ruby --disable=gems {0}
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb default
+        if: ${{ steps.gems.outcome == 'success' && env.UPDATE_NEWS_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          git diff --color --no-ext-diff --ignore-submodules --exit-code NEWS.md ||
+          echo update=true >> $GITHUB_OUTPUT
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          git commit --message="Update default gems list at ${GITHUB_SHA:0:30} [ci skip]" NEWS.md
+          git push origin ${GITHUB_REF#refs/heads/}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.diff.outputs.update
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/dependabot_automerge.yml b/.github/workflows/dependabot_automerge.yml
new file mode 100644
index 0000000000..2e4dc8d7a2
--- /dev/null
+++ b/.github/workflows/dependabot_automerge.yml
@@ -0,0 +1,32 @@
+# from https://github.com/gofiber/swagger/blob/main/.github/workflows/dependabot_automerge.yml
+name: Dependabot auto-merge
+on:
+  pull_request:
+
+permissions:
+  contents: write
+  pull-requests: write
+
+jobs:
+  automerge:
+    runs-on: ubuntu-latest
+    if: github.event.pull_request.user.login == 'dependabot[bot]' && github.repository == 'ruby/ruby'
+    steps:
+      - name: Dependabot metadata
+        uses: dependabot/fetch-metadata@25dd0e34f4fe68f24cc83900b1fe3fe149efef98 # v3.1.0
+        id: metadata
+
+      - name: Wait for status checks
+        uses: lewagon/wait-on-check-action@9312864dfbc9fd208e9c0417843430751c042800 # v1.7.0
+        with:
+          repo-token: ${{ secrets.GITHUB_TOKEN }}
+          ref: ${{ github.event.pull_request.head.sha || github.sha }}
+          check-regexp: 'make \(check, .*\)'
+          wait-interval: 30
+
+      - name: Auto-merge for Dependabot PRs
+        if: ${{ steps.metadata.outputs.update-type == 'version-update:semver-minor' || steps.metadata.outputs.update-type == 'version-update:semver-patch' }}
+        run: gh pr merge --auto --rebase "$PR_URL"
+        env:
+          PR_URL: ${{ github.event.pull_request.html_url }}
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_DEPENDABOT_MERGE_TOKEN }}
diff --git a/.github/workflows/labeler.yml b/.github/workflows/labeler.yml
new file mode 100644
index 0000000000..d0a8024b05
--- /dev/null
+++ b/.github/workflows/labeler.yml
@@ -0,0 +1,15 @@
+name: "Pull Request Labeler"
+on:
+- pull_request_target
+
+permissions:
+  contents: read
+
+jobs:
+  labeler:
+    permissions:
+      contents: read
+      pull-requests: write
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/labeler@f27b608878404679385c85cfa523b85ccb86e213 # v6.1.0
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..501d35698b
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,191 @@
+name: macOS
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: macos-26
+          - test_task: check
+            os: macos-15
+            configure_args: '--with-gcc=gcc-14'
+          - test_task: check
+            os: macos-26
+            configure_args: '--with-jemalloc --with-opt-dir=$(brew --prefix jemalloc)'
+          - test_task: check
+            os: macos-26
+            configure_args: '--with-gmp'
+          - test_task: test-all
+            test_opts: --repeat-count=2
+            os: macos-26
+          - test_task: test-bundler-parallel
+            os: macos-26
+          - test_task: test-bundled-gems
+            os: macos-26
+          - test_task: check
+            os: macos-15
+          - test_task: check
+            os: macos-15-intel
+          - test_task: check
+            os: macos-14
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 0 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${ruby_configure_args} ${{ matrix.configure_args }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - run: make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os }}
+          test-opts: ${{ matrix.test_opts }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: Set extra test options
+        run: |
+          echo "TESTS=$TESTS ${{ matrix.test_opts }}" >> $GITHUB_ENV
+          echo "RUBY_TEST_TIMEOUT_SCALE=10" >> $GITHUB_ENV # With --repeat-count=2, flaky test by timeout occurs frequently for some reason
+        if: matrix.test_opts
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          ulimit -c unlimited
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..1efae8be59
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,246 @@
+name: MinGW
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+  make:
+    runs-on: windows-${{ matrix.os }}
+
+    name: ${{ github.workflow }} (${{ matrix.msystem }})
+
+    env:
+      MSYSTEM: ${{ matrix.msystem }}
+      MSYS2_ARCH: >-
+        ${{ case(
+        contains(matrix.msystem, 'arm64'), 'aarch64',
+        contains(matrix.msystem, '64'), 'x86_64',
+        'i686'
+        ) }}
+      MINGW_PACKAGE_PREFIX: >-
+        mingw-w${{
+        case(endsWith(matrix.msystem, '64'), '64', '32')
+        }}-${{ case(
+        startsWith(matrix.msystem, 'clang'), 'clang',
+        startsWith(matrix.msystem, 'ucrt'), 'ucrt',
+        'mingw'
+        ) }}-${{ case(
+        contains(matrix.msystem, 'arm64'), 'aarch64',
+        endsWith(matrix.msystem, '64'), 'x86_64',
+        'i686'
+        ) }}
+      CFLAGS: '-mtune=generic -O3 -pipe'
+      CXXFLAGS: '-mtune=generic -O3 -pipe'
+      CPPFLAGS: '-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048'
+      LDFLAGS: '-pipe'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    strategy:
+      matrix:
+        include:
+          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+          # Ruby 3.2 is the first Windows Ruby to use OpenSSL 3.x
+          - msystem: 'UCRT64'
+            os: 2022
+            test_task: 'check'
+            test-all-opts: '--name=!/TestObjSpace#test_reachable_objects_during_iteration/'
+          - msystem: 'CLANGARM64'
+            os: 11-arm
+            test_task: 'check'
+      fail-fast: false
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/vcpkg'))
+      )}}
+
+    steps:
+      - uses: msys2/setup-msys2@e9898307ac31d1a803454791be09ab9973336e1c # v2.31.1
+        id: msys2
+        with:
+          msystem: ${{ matrix.msystem }}
+          update: true
+          install: >-
+            git
+            make
+            ruby
+            autoconf
+            ${{ env.MINGW_PACKAGE_PREFIX }}-gcc
+            ${{ env.MINGW_PACKAGE_PREFIX }}-ragel
+            ${{ env.MINGW_PACKAGE_PREFIX }}-openssl
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libyaml
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libffi
+
+      - name: Set up env
+        id: setup-env
+        working-directory:
+        run: |
+          $msys2 = ${env:MSYS2_LOCATION}
+          $msystem = ${env:MSYSTEM}.ToLower()
+          echo $msys2\usr\bin $msys2\$msystem\bin |
+            Tee-Object ${env:GITHUB_PATH} -Append -Encoding utf-8
+
+          # Use the fast device for the temporary directory.
+          # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+          # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+          $tmp = ${env:RUNNER_TEMP}
+          echo HOME=$home TMP=$tmp TEMP=$tmp TMPDIR=$tmp |
+            Tee-Object ${env:GITHUB_ENV} -Append -Encoding utf-8
+        shell: pwsh             # cmd.exe does not strip spaces before `|`.
+        env:
+          MSYS2_LOCATION: ${{ steps.msys2.outputs.msys2-location }}
+          MSYSTEM: ${{ matrix.msystem }}
+
+      - name: Remove Strawberry Perl pkg-config
+        working-directory:
+        # `pkg-config.bat` included in Strawberry Perl is written in
+        # Perl and doesn't work when another msys2 `perl` precede its
+        # own `perl`.
+        #
+        # ```
+        # Can't find C:\Strawberry\perl\bin\pkg-config.bat on PATH, '.' not in PATH.
+        # ```
+        run: |
+          Get-Command pkg-config.bat | % { ren $_.path ($_.path + "~") }
+        shell: pwsh
+
+      - name: Misc system & package info
+        working-directory:
+        run: |
+          group() { echo ::group::$'\e[94;1m'"$*"$'\e[m'; }
+          endgroup() { echo ::endgroup::; }
+
+          group Path
+          cygpath -wa / . $(type -p cygpath bash sh)
+          endgroup
+
+          I() {
+              group $1
+              run Where type -pa $1 && { [ $# -eq 1 ] || run Version "$@"; } ||
+                  failed+=($1)
+              endgroup
+          }
+          run() { local w m=$1; shift; w="$("$@")" && show "$m" && indent "$w"; }
+          indent() { [ -z "$1" ] || echo "$1" | /bin/sed '/^$/!s/^/  /'; }
+          show() { echo $'\e[96m'"$*"$'\e[m'; }
+
+          failed=()
+
+          I gcc.exe --version
+          I ragel.exe --version
+          I make.exe --version
+          I openssl.exe version
+          I libcrypto-3-x64.dll
+          I libssl-3-x64.dll
+
+          group Packages
+          pacman -Qs $MINGW_PACKAGE_PREFIX-* | /bin/sed -n "s,local/$MINGW_PACKAGE_PREFIX-,,p"
+          endgroup
+
+          [ ${#failed[@]} -eq 0 ]
+        shell: sh
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: configure
+        run: >
+          ../src/configure --disable-install-doc --prefix=/.
+          --build=$CHOST --host=$CHOST --target=$CHOST
+        shell: sh
+        env:
+          CHOST: ${{ env.MSYS2_ARCH }}-w64-mingw32
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4
+
+      - name: make install
+        run: make DESTDIR=../install install-nodoc
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-2022
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-tasks: '["test", "test-all", "test-spec"]'
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: test
+        timeout-minutes: 30
+        run: make test test-tool
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test' }}
+
+      - name: test-all
+        timeout-minutes: 45
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+        env:
+          RUBY_TESTOPTS: >-
+            --retry --job-status=normal --show-skip --timeout-scale=1.5 -j4
+            ${{ matrix.test-all-opts }}
+            ${{ env.TESTS }}
+          BUNDLER_VERSION:
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/') }}
+
+      - name: test-spec
+        timeout-minutes: 10
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/') }}
+
+      - uses: ./src/.github/actions/slack
+        with:
+          label: ${{ matrix.msystem }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/modgc.yml b/.github/workflows/modgc.yml
new file mode 100644
index 0000000000..bd3c6ab575
--- /dev/null
+++ b/.github/workflows/modgc.yml
@@ -0,0 +1,179 @@
+name: ModGC
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  check:
+    strategy:
+      matrix:
+        gc:
+          - name: default
+          - name: mmtk
+            mmtk_build: release
+        os: [macos-26, ubuntu-latest]
+        include:
+          - test_task: check
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries (macOS)
+        uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Install libraries (Ubuntu)
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: false
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Setup Ruby GC Directory
+        run: |
+          echo "MODULAR_GC_DIR=$HOME/ruby_gc" >> $GITHUB_ENV
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+        run: |
+          ${SETARCH} ../src/configure -C --disable-install-doc --with-modular-gc="${MODULAR_GC_DIR}" \
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - uses: actions-rust-lang/setup-rust-toolchain@46268bd060767258de96ed93c1251119784f2ab6 # v1.16.1
+        with:
+          cache-bin: false
+      - name: Set MMTk environment variables
+        run: |
+          echo 'EXCLUDES=../src/test/.excludes-mmtk' >> $GITHUB_ENV
+          echo 'MSPECOPT=-B../src/spec/mmtk.mspec' >> $GITHUB_ENV
+        if: ${{ matrix.gc.name == 'mmtk' }}
+
+      - run: ${SETARCH} make
+
+      - name: Build Modular  GC
+        run: |
+          echo "RUBY_GC_LIBRARY=${{ matrix.gc.name }}" >> $GITHUB_ENV
+          make install-modular-gc MODULAR_GC=${{ matrix.gc.name }} MMTK_BUILD=${{ matrix.gc.mmtk_build }}
+          make distclean-modular-gc MODULAR_GC=${{ matrix.gc.name }}
+
+      - run: ${SETARCH} make hello
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          ${SETARCH} make -s ${{ matrix.test_task }} \
+            ${TESTS:+TESTS="$TESTS"} \
+            ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.gc.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          ${SETARCH} make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/parse_y.yml b/.github/workflows/parse_y.yml
new file mode 100644
index 0000000000..a0082f71de
--- /dev/null
+++ b/.github/workflows/parse_y.yml
@@ -0,0 +1,101 @@
+name: parse.y
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+          - test_task: test-bundler-parallel
+          - test_task: test-bundled-gems
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG --with-parser=parse.y
+
+      - run: make
+
+      - run: make TESTRUN_SCRIPT='-renvutil -v -e "exit EnvUtil.current_parser == %[parse.y]"' run
+        env:
+          RUNOPT0: -I$(tooldir)/lib
+
+      - name: make ${{ matrix.test_task }}
+        run: make -s ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" SPECOPTS="$SPECOPTS"
+        env:
+          RUBY_TESTOPTS: ${{ matrix.testopts }}
+          EXCLUDES: '../src/test/.excludes-parsey'
+          RUN_OPTS: ${{ matrix.run_opts || '--parser=parse.y' }}
+          SPECOPTS: ${{ matrix.specopts || '-T --parser=parse.y' }}
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.run_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/post_push.yml b/.github/workflows/post_push.yml
new file mode 100644
index 0000000000..237679ebb1
--- /dev/null
+++ b/.github/workflows/post_push.yml
@@ -0,0 +1,97 @@
+name: Post-push
+on:
+  push:
+    branches:
+      - master
+      - 'ruby_*_*'
+
+permissions:
+  contents: read
+
+jobs:
+  hooks:
+    name: Post-push hooks
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' }}
+    steps:
+      - name: Sync git.ruby-lang.org
+        id: sync-git
+        continue-on-error: true
+        run: |
+          mkdir -p ~/.ssh
+          (umask 066; printenv RUBY_GIT_SYNC_PRIVATE_KEY > ~/.ssh/id_ed25519)
+          ssh-keyscan -t ed25519 git.ruby-lang.org >> ~/.ssh/known_hosts
+          ssh -i ~/.ssh/id_ed25519 git-sync@git.ruby-lang.org "sudo -u git /home/git/git.ruby-lang.org/bin/update-ruby.sh $GITHUB_REF"
+        env:
+          GITHUB_REF: ${{ github.ref }}
+          RUBY_GIT_SYNC_PRIVATE_KEY: ${{ secrets.RUBY_GIT_SYNC_PRIVATE_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Fetch changesets on bugs.ruby-lang.org
+        run: |
+          curl "https://bugs.ruby-lang.org/sys/fetch_changesets?key=${REDMINE_SYS_API_KEY}" -s --fail-with-body -w '* status: %{http_code}\n'
+        env:
+          REDMINE_SYS_API_KEY: ${{ secrets.REDMINE_SYS_API_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        with:
+          fetch-depth: 500 # for notify-slack-commits
+          token: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Notify commit to Slack
+        run: ruby tool/notify-slack-commits.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          SLACK_WEBHOOK_URL_ALERTS: ${{ secrets.SLACK_WEBHOOK_URL_ALERTS }}
+          SLACK_WEBHOOK_URL_COMMITS: ${{ secrets.SLACK_WEBHOOK_URL_COMMITS }}
+          SLACK_WEBHOOK_URL_RUBY_JP: ${{ secrets.SLACK_WEBHOOK_URL_RUBY_JP }}
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Notify commit to ruby-cvs
+        run: |
+          SENDMAIL="ssh -i ${HOME}/.ssh/id_ed25519 git-sync@git.ruby-lang.org /usr/sbin/sendmail" \
+            ruby tool/commit-email.rb . ruby-cvs@g.ruby-lang.org \
+            "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" "$GITHUB_REF" \
+            --viewer-uri "https://github.com/ruby/ruby/commit/" \
+            --error-to cvs-admin@ruby-lang.org
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_REF: ${{ github.ref }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Auto-correct code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Push PR notes to GitHub
+        id: pr-notes
+        continue-on-error: true
+        run: ruby tool/notes-github-pr.rb "$(pwd)/.git" "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Check for failures
+        run: exit 1
+        if: ${{ steps.sync-git.outcome == 'failure' || steps.pr-notes.outcome == 'failure' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/pr-playground.yml b/.github/workflows/pr-playground.yml
new file mode 100644
index 0000000000..dc4f075a38
--- /dev/null
+++ b/.github/workflows/pr-playground.yml
@@ -0,0 +1,131 @@
+name: Post Playground link to PR
+on:
+  pull_request_target:
+    types: [labeled]
+  workflow_run:
+    workflows: ["WebAssembly"]
+    types: [completed]
+
+permissions:
+  contents: read
+  actions: read
+
+jobs:
+  post-summary:
+    name: Post Playground link
+    runs-on: ubuntu-latest
+    permissions:
+      pull-requests: write
+    # Post a comment only if the PR status check is passed and the PR is labeled with `Playground`.
+    # Triggered twice: when the PR is labeled and when PR build is passed.
+    if: >-
+      ${{ false
+      || (true
+        && github.event_name == 'pull_request_target'
+        && contains(github.event.pull_request.labels.*.name, 'Playground'))
+      || (true
+        && github.event_name == 'workflow_run'
+        && github.event.workflow_run.conclusion == 'success'
+        && github.event.workflow_run.event == 'pull_request')
+      }}
+    steps:
+      - uses: actions/github-script@3a2844b7e9c422d3c10d287c895573f7108da1b3 # v9.0.0
+        with:
+          github-token: ${{ secrets.GITHUB_TOKEN }}
+          script: |
+            const fs = require('fs/promises');
+
+            const buildWorkflowPath = '.github/workflows/wasm.yml';
+            const findSuccessfuBuildRun = async (pr) => {
+              const opts = github.rest.actions.listWorkflowRunsForRepo.endpoint.merge({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                status: 'success',
+                branch: pr.head.ref,
+              });
+              const runs = await github.paginate(opts);
+              const buildRun = runs.find(run => run.path == buildWorkflowPath);
+              return buildRun;
+            }
+
+            const postComment = async (body, pr) => {
+              const { data: comments } = await github.rest.issues.listComments({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                issue_number: pr.number,
+              });
+
+              const commentOpts = { owner: context.repo.owner, repo: context.repo.repo, body: comment };
+
+              const existingComment = comments.find(comment => comment.body.startsWith(magicComment));
+              if (existingComment) {
+                core.info(`Updating existing comment: ${existingComment.html_url}`);
+                await github.rest.issues.updateComment({
+                  ...commentOpts, comment_id: existingComment.id
+                });
+              } else {
+                await github.rest.issues.createComment({
+                  ...commentOpts, issue_number: pr.number
+                });
+              }
+            }
+
+            const derivePRNumber = async () => {
+              if (context.payload.pull_request) {
+                return context.payload.pull_request.number;
+              }
+              // Workaround for https://github.com/orgs/community/discussions/25220
+
+              const { data: { artifacts } } = await github.rest.actions.listWorkflowRunArtifacts({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                run_id: context.payload.workflow_run.id,
+              });
+              const artifact = artifacts.find(artifact => artifact.name == 'github-pr-info');
+              if (!artifact) {
+                throw new Error('Cannot find github-pr-info.txt artifact');
+              }
+
+              const { data } = await github.rest.actions.downloadArtifact({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                artifact_id: artifact.id,
+                archive_format: 'zip',
+              });
+
+              await fs.writeFile('pr-info.zip', Buffer.from(data));
+              await exec.exec('unzip', ['pr-info.zip']);
+              return await fs.readFile('github-pr-info.txt', 'utf8');
+            }
+
+            const prNumber = await derivePRNumber();
+
+            const { data: pr } = await github.rest.pulls.get({
+              owner: context.repo.owner,
+              repo: context.repo.repo,
+              pull_number: prNumber,
+            });
+
+            core.info(`Checking if the PR ${prNumber} is labeled with Playground...`);
+            if (!pr.labels.some(label => label.name == 'Playground')) {
+              core.info(`The PR is not labeled with Playground.`);
+              return;
+            }
+
+            core.info(`Checking if the build is successful for ${pr.head.ref} in ${pr.head.repo.owner.login}/${pr.head.repo.name}...`);
+            const buildRun = await findSuccessfuBuildRun(pr);
+            if (!buildRun) {
+              core.info(`No successful build run found for ${buildWorkflowPath} on ${pr.head.ref} yet.`);
+              return;
+            }
+            core.info(`Found a successful build run: ${buildRun.html_url}`);
+
+            const runLink = `${process.env.GITHUB_SERVER_URL}/${process.env.GITHUB_REPOSITORY}/actions/runs/${process.env.GITHUB_RUN_ID}`;
+            const magicComment = `<!-- AUTO-GENERATED-COMMENT-PR-PLAYGROUND -->`;
+            const comment = `${magicComment}
+            **Try on Playground**: https://ruby.github.io/play-ruby?run=${buildRun.id}
+            This is an automated comment by [\`pr-playground.yml\`](${runLink}) workflow.
+            `;
+            core.info(`Comment: ${comment}`);
+            await postComment(comment, pr);
+
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
new file mode 100644
index 0000000000..5d16915e10
--- /dev/null
+++ b/.github/workflows/publish.yml
@@ -0,0 +1,114 @@
+name: Publish Ruby packages
+
+on:
+  repository_dispatch:
+    types:
+      - release
+  workflow_dispatch:
+    inputs:
+      version:
+        description: 'Version of the Ruby package to release'
+        required: true
+        default: '4.0.0'
+
+permissions:
+  contents: read
+
+jobs:
+  release:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: 3.3.4
+
+      - name: Store Ruby version
+        env:
+          RUBY_VERSION: ${{ github.event.client_payload.version || github.event.inputs.version }}
+        run: |
+          echo "RUBY_VERSION=${RUBY_VERSION}" >> $GITHUB_ENV
+
+      - name: Store ABI version
+        run: echo "ABI_VERSION=$(echo ${RUBY_VERSION} | cut -d '.' -f 1-2)" >> $GITHUB_ENV
+
+      - name: Copy draft package `/tmp` to `/pub` directory
+        run: tool/release.sh ${RUBY_VERSION}
+        env:
+          AWS_ACCESS_KEY_ID: ${{ secrets.FTP_R_L_O_AWS_ACCESS_KEY_ID }}
+          AWS_SECRET_ACCESS_KEY: ${{ secrets.FTP_R_L_O_AWS_SECRET_ACCESS_KEY }}
+          AWS_DEFAULT_REGION: us-west-2
+
+      - name: Purge URLs of release package
+        run: |
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${ABI_VERSION}/ruby-${RUBY_VERSION}.tar.gz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${ABI_VERSION}/ruby-${RUBY_VERSION}.tar.xz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${ABI_VERSION}/ruby-${RUBY_VERSION}.zip
+
+      - name: Create a release on GitHub
+        run: |
+          RELEASE_TAG=$(ruby tool/ruby-version.rb tag "${RUBY_VERSION}")
+          echo $RELEASE_TAG
+          PREVIOUS_RELEASE_TAG=$(ruby tool/ruby-version.rb previous-tag "${RUBY_VERSION}")
+          echo $PREVIOUS_RELEASE_TAG
+          tool/gen-github-release.rb $PREVIOUS_RELEASE_TAG $RELEASE_TAG --no-dry-run
+        env:
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Update versions index
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "update_index"}'
+
+      - name: Build and push Docker images
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/docker-images/dispatches \
+            -d "{\"event_type\": \"build\", \"client_payload\": {\"ruby_version\": \"${RUBY_VERSION}\"}}"
+
+      - name: Build snapcraft packages
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/snap.ruby/dispatches \
+            -d "{\"event_type\": \"build\", \"client_payload\": {\"ruby_version\": \"${RUBY_VERSION}\"}}"
+
+      - name: Store the latest LTS version of OpenSSL
+        run: |
+          echo "OPENSSL_VERSION=`curl -s https://api.github.com/repos/openssl/openssl/releases | jq -r '.[].tag_name | select(startswith("openssl-3.0"))' | sort -Vr | head -n1 | cut -d'-' -f2`" >> $GITHUB_ENV
+
+      - name: Update ruby-build definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.RUBY_BUILD_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/rbenv/ruby-build/dispatches \
+            -d "{\"event_type\": \"update-ruby\", \"client_payload\": {\"ruby_version\": \"${RUBY_VERSION}\", \"openssl_version\": \"${OPENSSL_VERSION}\"}}"
+
+      - name: Update all-ruby definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/all-ruby/dispatches \
+            -d '{"event_type": "update"}'
diff --git a/.github/workflows/release.yml b/.github/workflows/release.yml
new file mode 100644
index 0000000000..a35bcff99a
--- /dev/null
+++ b/.github/workflows/release.yml
@@ -0,0 +1,21 @@
+name: Start release workflow
+on:
+  push:
+    tags:
+      - '*'
+
+permissions:
+  contents: read
+
+jobs:
+  notify:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Build release package
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d "{\"event_type\": \"$GITHUB_REF\"}"
diff --git a/.github/workflows/rust-warnings.yml b/.github/workflows/rust-warnings.yml
new file mode 100644
index 0000000000..23ed164405
--- /dev/null
+++ b/.github/workflows/rust-warnings.yml
@@ -0,0 +1,62 @@
+# Surface Rust warnings on PRs that touch any Rust code.
+# Not a required check so we never block people over new warnings
+# that might come from a new Rust version being released.
+name: Rust warnings
+on:
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    paths:
+      - '**.rs'
+      - '!**.inc.rs'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rust-warnings:
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Install Rust
+        run: rustup default beta
+
+      - name: Rust warnings
+        shell: bash
+        run: |
+          set -eu
+          cargo check --quiet --all-features --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
+
+      - name: "📜 `rustdoc` warnings"
+        shell: bash
+        run: |
+          set -eu
+          cargo doc --document-private-items --all --no-deps --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..74c13f98fa
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,78 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecard supply-chain security
+on:
+  # For Branch-Protection check. Only the default branch is supported. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+  branch_protection_rule:
+  # To guarantee Maintained check is occasionally updated. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+  schedule:
+    - cron: '39 3 * * 5'
+  # push:
+  #   branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+  analysis:
+    name: Scorecard analysis
+    runs-on: ubuntu-latest
+    # `publish_results: true` only works when run from the default branch. conditional can be removed if disabled.
+    if: github.event.repository.default_branch == github.ref_name || github.event_name == 'pull_request'
+    permissions:
+      # Needed to upload the results to code-scanning dashboard.
+      security-events: write
+      # Needed to publish results and get a badge (see publish_results below).
+      id-token: write
+      # Uncomment the permissions below if installing in a private repository.
+      # contents: read
+      # actions: read
+
+    steps:
+      - name: "Checkout code"
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: "Run analysis"
+        uses: ossf/scorecard-action@4eaacf0543bb3f2c246792bd56e8cdeffafb205a # v2.4.3
+        with:
+          results_file: results.sarif
+          results_format: sarif
+          # (Optional) "write" PAT token. Uncomment the `repo_token` line below if:
+          # - you want to enable the Branch-Protection check on a *public* repository, or
+          # - you are installing Scorecard on a *private* repository
+          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action?tab=readme-ov-file#authentication-with-fine-grained-pat-optional.
+          # repo_token: ${{ secrets.SCORECARD_TOKEN }}
+
+          # Public repositories:
+          #   - Publish results to OpenSSF REST API for easy access by consumers
+          #   - Allows the repository to include the Scorecard badge.
+          #   - See https://github.com/ossf/scorecard-action#publishing-results.
+          # For private repositories:
+          #   - `publish_results` will always be set to `false`, regardless
+          #     of the value entered here.
+          publish_results: true
+
+          # (Optional) Uncomment file_mode if you have a .gitattributes with files marked export-ignore
+          # file_mode: git
+
+      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+      # format to the repository Actions tab.
+      - name: "Upload artifact"
+        uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        with:
+          name: SARIF file
+          path: results.sarif
+          retention-days: 5
+
+      # Upload the results to GitHub's code scanning dashboard (optional).
+      # Commenting out will disable upload of results to your repo's Code Scanning dashboard
+      - name: "Upload to code-scanning"
+        uses: github/codeql-action/upload-sarif@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..856b6e434e
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,68 @@
+name: Rubyspec Version Guards Check
+
+on:
+  push:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  pull_request:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rubyspec:
+    name: Rubyspec
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        # Specs from ruby/spec should still run on all supported Ruby versions.
+        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+        ruby:
+          - ruby-3.3
+          - ruby-3.4
+          - ruby-4.0
+      fail-fast: false
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - run: gem install webrick
+
+      - run: ruby ../mspec/bin/mspec
+        working-directory: spec/ruby
+        env:
+          CHECK_LEAKS: true
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/sync_default_gems.yml b/.github/workflows/sync_default_gems.yml
new file mode 100644
index 0000000000..9fd1945449
--- /dev/null
+++ b/.github/workflows/sync_default_gems.yml
@@ -0,0 +1,80 @@
+name: Sync default gems
+
+env:
+  DEFAULT_GEM_SYNC_ENABLED: true
+
+on:
+  workflow_dispatch:
+    inputs:
+      gem:
+        required: true
+        description: 'Name of the gem to be synchronized'
+        type: string
+      before:
+        required: true
+        description: 'Gem commit SHA before sync'
+        type: string
+      after:
+        required: true
+        description: 'Gem commit SHA after sync'
+        type: string
+
+permissions:
+  contents: read
+
+jobs:
+  sync_default_gems:
+    name: Sync default gem ${{ github.event.inputs.gem }}
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        name: Check out ruby/ruby
+        with:
+          token: ${{ github.repository == 'ruby/ruby' && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Run tool/sync_default_gems.rb
+        id: sync
+        run: |
+          ruby_before=$(git rev-parse HEAD)
+          set -x
+          ruby tool/sync_default_gems.rb "${gem_name}" "${gem_before}..${gem_after}"
+          if [[ "$(git rev-parse HEAD)" != "$ruby_before" ]]; then
+            echo update=true >> $GITHUB_OUTPUT
+          fi
+        env:
+          gem_name: ${{ github.event.inputs.gem }}
+          gem_before: ${{ github.event.inputs.before }}
+          gem_after: ${{ github.event.inputs.after }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - name: Push
+        run: |
+          git pull --rebase origin ${GITHUB_REF#refs/heads/}
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: ${{ steps.sync.outputs.update && env.DEFAULT_GEM_SYNC_ENABLED == 'true' }}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+          label: "${{ github.event.inputs.gem }} (<https://github.com/${{ github.event.inputs.gem == 'rubygems' && 'rubygems' || 'ruby' }}/${{ github.event.inputs.gem }}/compare/${{ github.event.inputs.before }}...${{ github.event.inputs.after }}|diff>)"
+          event_name: workflow_dispatch
+          extra_channel_id: C05FPKAU743 # alerts-sync
+        if: ${{ failure() }}
diff --git a/.github/workflows/tarball-macos.yml b/.github/workflows/tarball-macos.yml
new file mode 100644
index 0000000000..9bec94d528
--- /dev/null
+++ b/.github/workflows/tarball-macos.yml
@@ -0,0 +1,101 @@
+name: tarball-macos (reusable)
+
+on:
+  workflow_call:
+    inputs:
+      archname:
+        description: 'archname (e.g. snapshot-master, snapshot-ruby_3_3)'
+        required: true
+        type: string
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (schedule/release builds).'
+        required: false
+        type: boolean
+        default: false
+    secrets:
+      SIMPLER_ALERTS_URL:
+        required: false
+      SNAPSHOT_SLACK_WEBHOOK_URL:
+        required: false
+
+permissions:
+  contents: read
+
+jobs:
+  macos:
+    strategy:
+      matrix:
+        test_task: [check, test-bundled-gems, test-bundler-parallel]
+        os: [macos-26, macos-15, macos-14]
+        include:
+          - os: macos-15-intel
+            test_task: check
+      fail-fast: false
+    runs-on: ${{ matrix.os }}
+    env:
+      ARCHNAME: ${{ inputs.archname }}
+    steps:
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: tar xf pkg/*.tar.xz
+      - name: Install libraries
+        run: |
+          with_retry () {
+            "$@" || { sleep 5 && "$@"; } || { sleep 60 && "$@"; }
+          }
+          set -x
+          with_retry brew install gmp libffi openssl zlib autoconf automake libtool libyaml
+      - name: Set ENV
+        run: |
+          echo "JOBS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+      - name: configure
+        run: cd "$ARCHNAME/" && ./configure --with-openssl-dir=$(brew --prefix openssl) --with-libyaml-dir=$(brew --prefix libyaml)
+      - name: make
+        run: cd "$ARCHNAME/" && make $JOBS
+      - name: Tests
+        run: cd "$ARCHNAME/" && make $JOBS -s ${{ matrix.test_task }}
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+          RUBY_DEBUG_TEST_NO_REMOTE: "1"
+      # leaked-globals since 2.7
+      - name: Leaked Globals
+        run: cd "$ARCHNAME/" && make -s leaked-globals
+        if: matrix.test_task == 'check'
+      - name: make install without root privilege
+        run: cd "$ARCHNAME/" && make $JOBS install DESTDIR="/tmp/destdir"
+        if: matrix.test_task == 'check'
+      - name: make install
+        run: cd "$ARCHNAME/" && sudo make $JOBS install
+        if: matrix.test_task == 'check'
+      - name: Verify installed binaries
+        run: |
+          /usr/local/bin/ruby -v
+          /usr/local/bin/gem -v
+          /usr/local/bin/bundle -v
+        if: matrix.test_task == 'check'
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout: .github/actions/slack
+          sparse-checkout-cone-mode: false
+          persist-credentials: false
+        if: ${{ failure() }}
+      - uses: ./.github/actions/slack
+        with:
+          label: "${{ matrix.os }} / ${{ matrix.test_task }}"
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+      - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+        with:
+          payload: |
+            {
+              "attachments": [{
+                "text": "${{ job.status }}: ${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}|${{ inputs.archname }}>",
+                "color": "danger"
+              }]
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+        if: failure() && inputs.notify-release-channel
diff --git a/.github/workflows/tarball-non-development.yml b/.github/workflows/tarball-non-development.yml
new file mode 100644
index 0000000000..db6230b301
--- /dev/null
+++ b/.github/workflows/tarball-non-development.yml
@@ -0,0 +1,87 @@
+name: tarball-non-development (reusable)
+
+on:
+  workflow_call: {}
+
+permissions:
+  contents: read
+
+jobs:
+  non_development:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - { variant: default,     remove_ruby: false, configure_extra: '' }
+          - { variant: no-ruby,     remove_ruby: true,  configure_extra: '' }
+          - { variant: baseruby-no, remove_ruby: false, configure_extra: '--with-baseruby=no' }
+    runs-on: ubuntu-24.04
+    env:
+      ruby_prefix: /tmp/ruby-snapshot
+    steps:
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: tar xf pkg/*.tar.xz
+      - name: Substitute patchlevel
+        run: |
+          set -x
+          cd snapshot-*/
+          sed -i.orig 's/^\( *# *define  *RUBY_PATCHLEVEL\)  *-.*/\1 0/' version.h
+          diff -u version.h.orig version.h || :
+          rm -f version.h.orig
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev zlib1g-dev libffi-dev libgmp-dev bison- autoconf-
+      - name: Remove host ruby
+        if: matrix.remove_ruby
+        run: |
+          set -x
+          sudo apt-get purge -y -q 'ruby*' || :
+          sudo rm -rf /opt/hostedtoolcache/Ruby
+          ! command -v ruby
+      - name: Set ENV
+        run: |
+          echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - name: configure
+        run: cd snapshot-*/ && ./configure --prefix="${ruby_prefix}" ${{ matrix.configure_extra }}
+      - name: make
+        run: cd snapshot-*/ && make $JOBS
+      - name: Leaked Globals
+        run: cd snapshot-*/ && make -s leaked-globals
+      - name: make install
+        run: cd snapshot-*/ && make $JOBS install
+      - name: Set PATH
+        run: echo "PATH=${ruby_prefix}/bin:$PATH" >> $GITHUB_ENV
+      - name: Check patchlevel
+        id: check-patchlevel
+        run: |
+          exec "${ruby_prefix}/bin/ruby" -vx "$0"
+          #!ruby
+          puts "RUBY_PATCHLEVEL=#{RUBY_PATCHLEVEL.inspect}"
+          abort unless RUBY_PATCHLEVEL >= 0
+        working-directory: ${{ env.ruby_prefix }}
+        continue-on-error: true
+      - name: Check LOADPATH
+        id: check-loadpath
+        run: |
+          exec ${ruby_prefix}/bin/ruby -vx "$0"
+          #!ruby
+          paths = $:.grep(/\+/)
+          pp paths
+          abort unless paths.empty?
+        working-directory: ${{ env.ruby_prefix }}
+        continue-on-error: true
+      - name: Check pathnames
+        id: check-pathnames
+        run: |
+          ! find -name '*+*' | grep +
+        working-directory: ${{ env.ruby_prefix }}
+        continue-on-error: true
+      - name: result
+        run: false
+        if: ${{ contains(steps.*.outcome, 'failure') }}
diff --git a/.github/workflows/tarball-test-schedule.yml b/.github/workflows/tarball-test-schedule.yml
new file mode 100644
index 0000000000..6684b09edb
--- /dev/null
+++ b/.github/workflows/tarball-test-schedule.yml
@@ -0,0 +1,26 @@
+name: tarball-test-schedule
+on:
+  schedule:
+    - cron: '30 18 * * *' # Daily at 18:30 UTC
+  workflow_dispatch:
+
+permissions: {}
+
+jobs:
+  dispatch:
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+    runs-on: ubuntu-latest
+    strategy:
+      fail-fast: false
+      matrix:
+        branch:
+          - master
+          - ruby_4_0
+          - ruby_3_4
+          - ruby_3_3
+    steps:
+      - name: Trigger tarball-test on ${{ matrix.branch }}
+        run: gh workflow run tarball-test.yml --ref "$BRANCH" --repo "$GITHUB_REPOSITORY" -f notify-release-channel=true
+        env:
+          BRANCH: ${{ matrix.branch }}
+          GH_TOKEN: ${{ secrets.MATZBOT_GITHUB_ACTION_TOKEN }}
diff --git a/.github/workflows/tarball-test.yml b/.github/workflows/tarball-test.yml
new file mode 100644
index 0000000000..c862ab76cc
--- /dev/null
+++ b/.github/workflows/tarball-test.yml
@@ -0,0 +1,104 @@
+name: tarball-test
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+  workflow_dispatch:
+    inputs:
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (set by tarball-test-schedule).'
+        type: boolean
+        default: false
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  tarball:
+    runs-on: ubuntu-latest
+    # Cherry-pick to maintenance branches by changing only env.BRANCH below;
+    # archname / branch-label / Materialize all derive from it.
+    env:
+      BRANCH: master
+    outputs:
+      branch: ${{ env.BRANCH }}
+      skip: ${{ steps.skipping.outputs.skip }}
+    steps:
+      - id: skipping
+        run: echo 'skip=true' >> $GITHUB_OUTPUT
+        if: >-
+          ${{(false
+          || contains(github.event.head_commit.message, '[DOC]')
+          || contains(github.event.pull_request.title, '[DOC]')
+          || contains(github.event.pull_request.labels.*.name, 'Documentation')
+          || (github.event.pull_request.user.login == 'dependabot[bot]')
+          )}}
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          fetch-depth: 1 # actions/checkout fetches all heads/tags unless > 0
+          persist-credentials: false
+      # tool/make-snapshot derives the branch name from HEAD and looks up
+      # the upstream during ChangeLog generation. Detached checkouts
+      # (pull_request, merge_group) lack a local branch with tracking, so
+      # pin one to HEAD and connect it to the matching origin ref.
+      - name: Materialize local branch
+        run: |
+          git fetch --no-tags --depth=1 origin "+refs/heads/$BASE:refs/remotes/origin/$BASE"
+          git checkout -B "$BRANCH" HEAD
+          git branch --set-upstream-to="origin/$BASE" "$BRANCH"
+        env:
+          BASE: ${{ github.base_ref || env.BRANCH }}
+      - uses: ./.github/actions/make-snapshot
+        with:
+          archname: snapshot-${{ env.BRANCH }}
+          srcdir: '.'
+
+  ubuntu:
+    needs: tarball
+    if: ${{ ! needs.tarball.outputs.skip }}
+    uses: ./.github/workflows/tarball-ubuntu.yml
+    with:
+      archname: snapshot-${{ needs.tarball.outputs.branch }}
+      notify-release-channel: ${{ github.event_name == 'workflow_dispatch' && inputs.notify-release-channel || false }}
+    secrets:
+      SIMPLER_ALERTS_URL: ${{ secrets.SIMPLER_ALERTS_URL }}
+      SNAPSHOT_SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+
+  macos:
+    needs: tarball
+    if: ${{ ! needs.tarball.outputs.skip }}
+    uses: ./.github/workflows/tarball-macos.yml
+    with:
+      archname: snapshot-${{ needs.tarball.outputs.branch }}
+      notify-release-channel: ${{ github.event_name == 'workflow_dispatch' && inputs.notify-release-channel || false }}
+    secrets:
+      SIMPLER_ALERTS_URL: ${{ secrets.SIMPLER_ALERTS_URL }}
+      SNAPSHOT_SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+
+  windows:
+    needs: tarball
+    if: ${{ ! needs.tarball.outputs.skip }}
+    uses: ./.github/workflows/tarball-windows.yml
+    with:
+      archname: snapshot-${{ needs.tarball.outputs.branch }}
+      notify-release-channel: ${{ github.event_name == 'workflow_dispatch' && inputs.notify-release-channel || false }}
+    secrets:
+      SIMPLER_ALERTS_URL: ${{ secrets.SIMPLER_ALERTS_URL }}
+      SNAPSHOT_SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+
+  non_development:
+    needs: tarball
+    uses: ./.github/workflows/tarball-non-development.yml
diff --git a/.github/workflows/tarball-ubuntu.yml b/.github/workflows/tarball-ubuntu.yml
new file mode 100644
index 0000000000..e227dc29aa
--- /dev/null
+++ b/.github/workflows/tarball-ubuntu.yml
@@ -0,0 +1,151 @@
+name: tarball-ubuntu (reusable)
+
+on:
+  workflow_call:
+    inputs:
+      archname:
+        description: 'archname (e.g. snapshot-master, snapshot-ruby_3_3)'
+        required: true
+        type: string
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (schedule/release builds).'
+        required: false
+        type: boolean
+        default: false
+    secrets:
+      SIMPLER_ALERTS_URL:
+        required: false
+      SNAPSHOT_SLACK_WEBHOOK_URL:
+        required: false
+
+permissions:
+  contents: read
+
+jobs:
+  ubuntu:
+    strategy:
+      matrix:
+        test_task: [check, test-bundler-parallel, test-bundled-gems]
+        os: [ubuntu-24.04, ubuntu-22.04]
+      fail-fast: false
+    runs-on: ${{ matrix.os }}
+    env:
+      ARCHNAME: ${{ inputs.archname }}
+    steps:
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: tar xf pkg/*.tar.xz
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev zlib1g-dev libffi-dev libgmp-dev bison- autoconf-
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.2'
+        # test-bundled-gems requires executable host ruby
+        if: matrix.test_task == 'test-bundled-gems'
+      - name: Fixed world writable dirs
+        run: |
+          mkdir -p $HOME/.local/share
+          mkdir -p $HOME/.cache/gem/specs
+          mkdir -p $HOME/.bundle/cache
+          mkdir -p $HOME/.ssh
+          chmod a-w $HOME/.bundle
+          # chmod a-w $HOME
+          # allow to write $HOME and check stats of HOME around tests (see below)
+          chmod -v a-w $HOME/.config
+          sudo chmod -R a-w /usr/share
+          sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v a-w $d; done' || :
+      - name: Set ENV
+        run: |
+          echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - name: configure
+        run: cd "$ARCHNAME/" && ./configure
+      - name: make
+        run: cd "$ARCHNAME/" && make $JOBS
+      - name: Save stats of HOME
+        run: |
+          set -euxo pipefail
+          cat >"$ARCHNAME/save-stats.rb" <<'EOF'
+          require 'pathname'
+          require 'digest'
+          out = []
+          [
+            Dir.home,
+          ].each do |dir|
+            Dir.each_child(dir) do |name|
+              pn = File.join(dir, name)
+              st = File.stat(pn)
+              if st.file?
+                content = Digest::SHA1.file(pn).hexdigest
+              elsif st.directory? && st.nlink <= 10
+                content = Dir.children(pn).sort
+              end
+              out << [pn, "%o"%st.mode, st.nlink, st.uid, st.gid, st.size, content].to_s
+            rescue
+              out << [pn, $!.inspect].to_s
+            end
+          end
+          File.open(ARGV.shift, "w") do |io|
+            io.puts out.sort
+          end
+          EOF
+          make -C "$ARCHNAME" TESTRUN_SCRIPT=save-stats.rb RUNOPT=/tmp/stat-before-tests.txt runruby
+      - name: Tests
+        run: cd "$ARCHNAME/" && make $JOBS -s ${{ matrix.test_task }}
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+      # test_sync_default_gems triggers gpg, whose agent processes leave
+      # $HOME/.gnupg around even when GNUPGHOME points elsewhere.
+      - name: Forcibly remove ~/.gnupg
+        run: rm -rf $HOME/.gnupg
+      - name: Diff stats of HOME
+        run: |
+          make -C "$ARCHNAME" TESTRUN_SCRIPT=save-stats.rb RUNOPT=/tmp/stat-after-tests.txt runruby
+          rm -f "$ARCHNAME/save-stats.rb"
+          diff -u /tmp/stat-before-tests.txt /tmp/stat-after-tests.txt
+      # leaked-globals since 2.7
+      - name: Leaked Globals
+        run: cd "$ARCHNAME/" && make -s leaked-globals
+        if: matrix.test_task == 'check'
+      - name: make install without root privilege
+        run: cd "$ARCHNAME/" && make $JOBS install DESTDIR="/tmp/destdir"
+        if: matrix.test_task == 'check'
+      - name: make install
+        run: cd "$ARCHNAME/" && sudo make $JOBS install
+        if: matrix.test_task == 'check'
+      - name: Verify installed binaries
+        run: |
+          /usr/local/bin/ruby -v
+          /usr/local/bin/gem -v
+          /usr/local/bin/bundle -v
+        if: matrix.test_task == 'check'
+      - name: Show .local
+        run: find $HOME/.local -ls
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout: .github/actions/slack
+          sparse-checkout-cone-mode: false
+          persist-credentials: false
+        if: ${{ failure() }}
+      - uses: ./.github/actions/slack
+        with:
+          label: "${{ matrix.os }} / ${{ matrix.test_task }}"
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+      - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+        with:
+          payload: |
+            {
+              "attachments": [{
+                "text": "${{ job.status }}: ${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}|${{ inputs.archname }}>",
+                "color": "danger"
+              }]
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+        if: failure() && inputs.notify-release-channel
diff --git a/.github/workflows/tarball-windows.yml b/.github/workflows/tarball-windows.yml
new file mode 100644
index 0000000000..1ce95de6fc
--- /dev/null
+++ b/.github/workflows/tarball-windows.yml
@@ -0,0 +1,163 @@
+name: tarball-windows (reusable)
+
+on:
+  workflow_call:
+    inputs:
+      archname:
+        description: 'archname (e.g. snapshot-master)'
+        required: true
+        type: string
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (schedule/release builds).'
+        required: false
+        type: boolean
+        default: false
+    secrets:
+      SIMPLER_ALERTS_URL:
+        required: false
+      SNAPSHOT_SLACK_WEBHOOK_URL:
+        required: false
+
+permissions:
+  contents: read
+
+jobs:
+  windows:
+    strategy:
+      matrix:
+        include:
+          - os: '2022'
+            test_task: check
+          - os: '2025-vs2026'
+            test_task: check
+      fail-fast: false
+    runs-on: windows-${{ matrix.os }}
+    defaults:
+      run:
+        shell: cmd
+        working-directory: build
+    name: Windows ${{ matrix.os }} (${{ matrix.test_task }})
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+      PATCH: C:\msys64\usr\bin\patch.exe
+      OS_VER: windows-${{ matrix.os }}
+      # see https://github.com/ruby/ruby/commit/9ff4399decef0036897d3cfb9ac2c710dea913ca
+      OPENSSL_MODULES: C:\vcpkg\installed\x64-windows\bin
+    steps:
+      - run: md build
+        working-directory:
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.2'
+          bundler: none
+          windows-toolchain: none
+
+      - uses: msys2/setup-msys2@e9898307ac31d1a803454791be09ab9973336e1c # v2.31.1
+        id: setup-msys2
+        with:
+          update: true
+          install: >-
+            patch
+      - name: patch path
+        shell: msys2 {0}
+        run: echo PATCH=$(cygpath -wa $(command -v patch)) >> $GITHUB_ENV
+        if: ${{ steps.setup-msys2.outcome == 'success' }}
+      - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: C:\vcpkg\installed
+          key: ${{ runner.os }}-vcpkg-installed-${{ env.OS_VER }}-${{ github.sha }}
+          restore-keys: |
+            ${{ runner.os }}-vcpkg-installed-${{ env.OS_VER }}-
+            ${{ runner.os }}-vcpkg-installed-
+      - name: Install libraries with vcpkg
+        run: |
+          vcpkg --triplet x64-windows install gmp libffi libyaml openssl zlib
+
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: 7z x pkg/*.zip
+        working-directory:
+
+      - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: snapshot-*/.downloaded-cache
+          key: downloaded-cache
+
+      - name: setup env
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        env:
+          ARCHNAME: ${{ inputs.archname }}
+        run: |
+          set > old.env
+          call ..\%ARCHNAME%\win32\vssetup.cmd
+          set TMP=%USERPROFILE%\AppData\Local\Temp
+          set TEMP=%USERPROFILE%\AppData\Local\Temp
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set > new.env
+
+      - name: update env
+        shell: pwsh
+        run: |
+          $old = (Get-Content old.env); $new = (Get-Content new.env)
+          del *.env
+          Compare-Object $old $new |
+            Where-Object { $_.SideIndicator -eq '=>' } |
+            Select-Object -ExpandProperty InputObject |
+            Add-Content -Path $env:GITHUB_ENV
+      - name: link libraries
+        run: |
+          for %%I in (C:\vcpkg\installed\x64-windows\bin\*.dll) do (
+            mklink %%~nxI %%I
+          )
+      - name: Configure
+        env:
+          ARCHNAME: ${{ inputs.archname }}
+        run: >-
+          ../%ARCHNAME%/win32/configure.bat --disable-install-doc
+          --with-opt-dir=C:/vcpkg/installed/x64-windows
+      - run: nmake incs
+      - run: nmake extract-extlibs
+      - run: nmake
+        env:
+          YACC: win_bison
+
+      - name: ruby -v
+        run: .\ruby -v
+
+      - run: nmake test
+        timeout-minutes: 5
+
+      - run: nmake ${{ matrix.test_task }}
+        env:
+          RUBY_TESTOPTS: -j${{env.TEST_JOBS}}
+        timeout-minutes: 70
+        continue-on-error: ${{ matrix.continue-on-error || false }}
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout: .github/actions/slack
+          sparse-checkout-cone-mode: false
+          persist-credentials: false
+        if: ${{ failure() }}
+      - uses: ./.github/actions/slack
+        with:
+          label: "${{ env.OS_VER }} / ${{ matrix.test_task }}"
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+      - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+        with:
+          payload: |
+            {
+              "attachments": [{
+                "text": "${{ job.status }}: ${{ env.OS_VER }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}|${{ inputs.archname }}>",
+                "color": "danger"
+              }]
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+        if: failure() && inputs.notify-release-channel
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..09e96f764c
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,275 @@
+name: Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        # We enumerate every job in matrix.include to save build time
+        include:
+          - test_task: check
+            configure: 'cppflags=-DVM_CHECK_MODE'
+          - test_task: check
+            arch: i686
+          - test_task: check
+            configure: '--disable-yjit'
+          - test_task: check
+            configure: '--enable-shared --enable-load-relative'
+          - test_task: test-bundler-parallel
+            timeout: 50
+          - test_task: test-bundled-gems
+          - test_task: check
+            os: ubuntu-24.04
+            extra_checks: [capi]
+          # ubuntu-24.04-arm jobs don't start on ruby/ruby as of 2025-10-29
+          #- test_task: check
+          #  os: ubuntu-24.04-arm
+      fail-fast: false
+
+    env: &make-env
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: &make-steps
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+        with:
+          arch: ${{ matrix.arch }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: >-
+          ${{ !endsWith(matrix.os, 'arm')
+          && !endsWith(matrix.os, 'ppc64le') && !endsWith(matrix.os, 's390x') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+          configure: ${{ matrix.configure }}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc ${configure:- --enable-debug-env cppflags=-DRUBY_DEBUG}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - run: $SETARCH make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: $SETARCH make
+
+      - run: $SETARCH make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | $SETARCH make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      # Avoid possible test failures with the zlib applying the following patch
+      # on s390x CPU architecture.
+      # https://github.com/madler/zlib/pull/410
+      - name: Disable DFLTCC
+        run: echo "DFLTCC=0" >> $GITHUB_ENV
+        if: ${{ endsWith(matrix.os, 's390x') }}
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          $SETARCH make -s ${{ matrix.test_task }} \
+          ${TESTS:+TESTS="$TESTS"} \
+          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: test-pc
+        run: |
+          DESTDIR=${RUNNER_TEMP-${TMPDIR-/tmp}}/installed
+          $SETARCH make test-pc "DESTDIR=$DESTDIR"
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+          make: '$SETARCH make'
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}${{ matrix.os }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  make-ibm:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: ubuntu-24.04-ppc64le
+          - test_task: check
+            os: ubuntu-24.04-s390x
+      fail-fast: false
+
+    env: *make-env
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{github.repository == 'ruby/ruby'
+      && !(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: *make-steps
+
+  # Separated from `make` job to avoid making it a required status check
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Using the same setup as ZJIT jobs
+          - bench_opts: '--warmup=1 --bench=1 --excludes=shipit'
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install"
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          repository: ruby/ruby-bench
+          persist-credentials: false
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "ruby::../build/install/bin/ruby" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+        env:
+          BUNDLER_VERSION: 0
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..edb2c76c48
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,195 @@
+name: WebAssembly
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        entry:
+#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+#         - { name: O0-debuginfo, optflags: '-O0', debugflags: '-g', wasmoptflags: '-O1' }
+#         - { name: O1,           optflags: '-O1', debugflags: ''  , wasmoptflags: '-O1' }
+          - { name: O2, optflags: '-O2', debugflags: '', wasmoptflags: '-O2' }
+#         - { name: O3,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O3' }
+#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+#         - { name: O4,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O4' }
+#         - { name: Oz,           optflags: '-Oz', debugflags: ''  , wasmoptflags: '-Oz' }
+      fail-fast: false
+
+    env:
+      RUBY_TESTOPTS: '-q --tty=no'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      WASI_SDK_VERSION_MAJOR: 25
+      WASI_SDK_VERSION_MINOR: 0
+      BINARYEN_VERSION: 113
+      WASMTIME_VERSION: v15.0.0
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Install libraries
+        run: |
+          set -ex
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y ruby make autoconf git wget
+
+          wasi_sdk_deb="wasi-sdk-${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}-x86_64-linux.deb"
+          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+          sudo dpkg -i "$wasi_sdk_deb"
+          rm -f "$wasi_sdk_deb"
+
+          mkdir build-sdk
+          pushd build-sdk
+
+          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+          wget -O - "$wasmtime_url" | tar xJf -
+          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+          wget -O - "$binaryen_url" | tar xfz -
+          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+        working-directory: src
+
+      - name: Set ENV
+        run: |
+          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+
+      - uses: ./.github/actions/setup/baseruby
+        id: baseruby
+        with:
+          srcdir: src
+
+      - name: Download config.guess with wasi version
+        run: |
+          rm tool/config.guess tool/config.sub
+          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
+        working-directory: src
+
+      - name: Run configure
+        run: >-
+          ../src/configure
+          --host wasm32-unknown-wasi
+          --with-baseruby="${{ steps.baseruby.outputs.ruby }}"
+          --with-dump-ast="${{ steps.baseruby.outputs.dump_ast }}"
+          --with-static-linked-ext
+          --with-ext=${EXTS// /,}
+          LDFLAGS="
+          -Xlinker --stack-first
+          -Xlinker -z -Xlinker stack-size=16777216
+          "
+          optflags="${{ matrix.entry.optflags }}"
+          debugflags="${{ matrix.entry.debugflags }}"
+          wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+        env:
+          EXTS:
+            cgi/escape
+            continuation
+            coverage
+            date
+            digest
+            digest/*
+            erb/escape
+            etc
+            fcntl
+            json
+            json/*
+            objspace
+            rbconfig/sizeof
+            ripper
+            stringio
+            strscan
+
+      # miniruby may not be built when cross-compling
+      - run: make mini ruby
+
+      - run: make install DESTDIR=$PWD/../install
+      - run: tar cfz ../install.tar.gz -C ../install .
+
+      - name: Upload artifacts
+        uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        with:
+          name: ruby-wasm-install
+          path: ${{ github.workspace }}/install.tar.gz
+      - name: Show Playground URL to try the build
+        run: |
+          echo "Try on Playground: https://ruby.github.io/play-ruby?run=$GITHUB_RUN_ID" >> $GITHUB_STEP_SUMMARY
+
+      - name: Run basictest
+        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+        working-directory: src
+
+      - name: Run bootstraptest (no thread)
+        run: |
+          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+        working-directory: src
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.entry.name }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+      # Workaround for https://github.com/orgs/community/discussions/25220
+      - name: Save Pull Request number
+        if: ${{ github.event_name == 'pull_request' }}
+        run: echo "${{ github.event.pull_request.number }}" >> ${{ github.workspace }}/github-pr-info.txt
+      - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        if: ${{ github.event_name == 'pull_request' }}
+        with:
+          name: github-pr-info
+          path: ${{ github.workspace }}/github-pr-info.txt
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..13551427bb
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,209 @@
+name: Windows
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - os: 2022
+            test_task: check
+          - os: 2022
+            test_task: test-bundled-gems
+          - os: 2025-vs2026
+            test_task: check
+          - os: 2025-vs2026
+            test_task: test-bundled-gems
+          - os: 11-arm
+            test_task: 'btest test-basic test-tool' # check and test-spec are broken yet.
+            target: arm64
+      fail-fast: false
+
+    runs-on: windows-${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/vcpkg'))
+      )}}
+
+    name: Windows ${{ matrix.os }} (${{ matrix.test_task }})
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      VCPKG_DEFAULT_TRIPLET: ${{ matrix.target || 'x64' }}-windows
+
+    steps:
+      - run: md build
+        working-directory:
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          # windows-11-arm has only 3.4.1, 3.4.2, 3.4.3, head
+          ruby-version: ${{ !endsWith(matrix.os, 'arm') && '3.1' || '3.4' }}
+          bundler: none
+          windows-toolchain: none
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          make-command: nmake
+          clean: true
+
+      - name: Install tools with scoop
+        run: |
+          if ((vcpkg.exe help install) -match "manifest") { exit }
+          Set-ExecutionPolicy -ExecutionPolicy RemoteSigned -Scope CurrentUser
+          iwr -useb get.scoop.sh | iex
+          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
+          scoop install vcpkg
+        shell: pwsh
+
+      - name: Restore vcpkg artifact
+        id: restore-vcpkg
+        uses: actions/cache/restore@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+
+      - name: Install libraries with vcpkg
+        run: |
+          vcpkg install
+        working-directory: src
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit }}
+
+      - name: Save vcpkg artifact
+        uses: actions/cache/save@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit && (github.ref_name == 'master' || startsWith(github.ref_name, 'ruby_')) }}
+
+      - name: setup env
+        # Available Ruby versions: https://github.com/actions/runner-images/blob/main/images/windows/Windows2019-Readme.md#ruby
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        run: |
+          set > old.env
+          call ..\src\win32\vssetup.cmd ^
+            -arch=${{ matrix.target || 'amd64' }} ^
+            ${{ matrix.vcvars && '-vcvars_ver=' || '' }}${{ matrix.vcvars }}
+          nmake -f nul
+          set TMP=%RUNNER_TEMP%
+          set TEMP=%RUNNER_TEMP%
+          set MAKEFLAGS=l
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set RUBY_OPT_DIR=%GITHUB_WORKSPACE:\=/%/src/vcpkg_installed/%VCPKG_DEFAULT_TRIPLET%
+          set > new.env
+
+      - name: update env
+        shell: pwsh
+        run: |
+          $old = (Get-Content old.env); $new = (Get-Content new.env)
+          del *.env
+          Compare-Object $old $new |
+            Where-Object { $_.SideIndicator -eq '=>' } |
+            Select-Object -ExpandProperty InputObject |
+            Add-Content -Path $env:GITHUB_ENV
+
+      - name: baseruby version
+        run: ruby -v
+
+      - name: compiler version
+        run: cl
+
+      - name: volume info
+        run: Get-Volume
+        shell: pwsh
+
+      # TODO: We should use `../src` instead of `D:/a/ruby/ruby/src`
+      - name: Configure
+        run: >-
+          ../src/win32/configure.bat --disable-install-doc
+          --with-opt-dir=%RUBY_OPT_DIR%
+          --with-gmp
+
+      - run: nmake prepare-vcpkg
+
+      - run: nmake incs
+
+      - run: nmake extract-extlibs
+
+      # On all other platforms, test-spec depending on extract-gems (in common.mk) is enough.
+      # But not for this Visual Studio workflow. So here we extract gems before building.
+      - run: nmake extract-gems
+
+      # windows-11-arm runner cannot run `ruby tool/file2lastrev.rb --revision.h --output=revision.h`
+      - name: make revision.h
+        run: |
+          win32\lastrev.bat | win32\ifchange.bat --timestamp=.revision.time revision.h -
+          type revision.h
+        working-directory: src
+
+      - run: nmake
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-${{ matrix.os }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-task: ${{ matrix.test_task || 'check' }}
+        continue-on-error: true
+        if: ${{ matrix.test_task != 'test-bundled-gems' }}
+        timeout-minutes: 3
+
+      - run: nmake ${{ matrix.test_task || 'check' }}
+        env:
+          RUBY_TESTOPTS: -j${{ env.TEST_JOBS || 4 }}
+        timeout-minutes: 70
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Windows ${{ matrix.os }} / ${{ matrix.test_task || 'check' }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: windows-2025-vs2026
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/wsl.yml b/.github/workflows/wsl.yml
new file mode 100644
index 0000000000..470b68fe66
--- /dev/null
+++ b/.github/workflows/wsl.yml
@@ -0,0 +1,73 @@
+name: Ubuntu on WSL
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+permissions:
+  contents: read
+
+jobs:
+  wsl:
+    runs-on: windows-2025-vs2026
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - name: Install or update WSL
+        uses: Ubuntu/WSL/.github/actions/wsl-install@main
+        with:
+          distro: Ubuntu-24.04
+
+      - name: Install dependencies
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            DEBIAN_FRONTEND=noninteractive sudo apt update
+            DEBIAN_FRONTEND=noninteractive sudo apt install -y ruby build-essential autoconf libssl-dev libyaml-dev zlib1g-dev libgmp-dev libffi-dev
+
+      - name: Check out the repository
+        uses: Ubuntu/WSL/.github/actions/wsl-checkout@main
+        with:
+          distro: Ubuntu-24.04
+          working-dir: /tmp/github/
+          submodules: true
+
+      - name: Build
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./autogen.sh
+            ./configure --disable-install-doc
+            make ruby -j4
+            make extract-gems
+            make -j4
+
+      - name: Test
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./ruby -v
+            # make check TESTS="-j4" MSPECOPT="-j"
diff --git a/.github/workflows/yjit-macos.yml b/.github/workflows/yjit-macos.yml
new file mode 100644
index 0000000000..b52c6355ad
--- /dev/null
+++ b/.github/workflows/yjit-macos.yml
@@ -0,0 +1,201 @@
+name: YJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: 'check'
+            configure: '--enable-yjit'
+            yjit_opts: '--yjit'
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: macos-26
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }} ${{ matrix.yjit_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..934c3f56d4
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,245 @@
+name: YJIT Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      # For now we can't run cargo test --offline because it complains about the
+      # capstone dependency, even though the dependency is optional
+      #- run: cargo test --offline
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  lint:
+    name: cargo clippy
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      # Check that we don't have linting errors in release mode, too
+      - run: cargo clippy --all-targets --all-features
+        working-directory: yjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'yjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--with-gcc=clang-14 --enable-yjit=dev --enable-zjit'
+            libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
+
+          - test_task: 'check'
+            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+            configure: "RUSTC='rustc +1.58.0'"
+            rust_version: '1.58.0'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-yjit=dev'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      RUBY_DEBUG: ci
+      RUST_BACKTRACE: 1
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: rustup install ${{ matrix.rust_version }} --profile minimal
+
+      - name: Remove cargo
+        # Since this tests a `rustc` build for release, remove `cargo` to ensure
+        # that only `rustc` is used.
+        if: ${{ contains(matrix.configure, 'rustc') }}
+        run: sudo rm $(which -a cargo | uniq)
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      # Check that the binary was built with YJIT
+      - name: Check YJIT enabled
+        run: ./miniruby --yjit -v | grep "+YJIT"
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ubuntu-22.04
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS" YJIT_BINDGEN_DIFF_OPTS="$YJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          YJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          LIBCLANG_PATH: ${{ matrix.libclang_path }}
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-macos.yml b/.github/workflows/zjit-macos.yml
new file mode 100644
index 0000000000..e68bd897fd
--- /dev/null
+++ b/.github/workflows/zjit-macos.yml
@@ -0,0 +1,239 @@
+name: ZJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit=dev --enable-zjit'
+            rust_version: "1.85.0"
+
+          - test_task: 'ruby'
+            hint: 'combo build test'
+            configure: '--enable-yjit --enable-zjit'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      RUST_BACKTRACE: 1
+      ZJIT_RB_BUG: 1
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - uses: taiki-e/install-action@e49978b799e49ff429d162b7a30601a569ab6538 # v2.81.1
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: macos-26
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-zjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '30'
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=shipit'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      # setup/directories set MAKEFLAGS=-j4 for macOS, which randomly fails sqlite3.gem builds
+      - name: Unset MAKEFLAGS
+        run: echo "MAKEFLAGS=" >> "$GITHUB_ENV"
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+        env:
+          BUNDLER_VERSION: 0
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-ubuntu.yml b/.github/workflows/zjit-ubuntu.yml
new file mode 100644
index 0000000000..8d146b7bdc
--- /dev/null
+++ b/.github/workflows/zjit-ubuntu.yml
@@ -0,0 +1,293 @@
+name: ZJIT Ubuntu
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  lint:
+    name: cargo clippy
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - run: cargo clippy --all-targets --all-features
+        working-directory: zjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+            # The optimizer benefits from at least 1 iteration of profiling. Also, many
+            # regression tests in bootstraptest/test_yjit.rb assume call-threshold=2.
+          - test_task: 'btest'
+            run_opts: '--zjit-call-threshold=2'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit --enable-zjit=dev'
+            rust_version: '1.85.0'
+
+          - test_task: 'zjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--enable-zjit=dev --enable-yjit --with-gcc=clang-16'
+            clang_path: '/usr/bin/clang-16'
+            runs-on: 'ubuntu-24.04' # for clang-16
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-zjit=dev'
+            run_opts: '--zjit-call-threshold=1'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      RUBY_DEBUG: ci
+      BUNDLE_JOBS: 8 # for yjit-bench
+      RUST_BACKTRACE: 1
+      ZJIT_RB_BUG: 1
+
+    runs-on: ${{ matrix.runs-on || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: taiki-e/install-action@e49978b799e49ff429d162b7a30601a569ab6538 # v2.81.1
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - name: Install rustfmt
+        if: ${{ matrix.test_task == 'zjit-bindgen' }}
+        run: rustup component add rustfmt
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      # Check that the binary was built with ZJIT
+      - name: Check ZJIT enabled
+        run: ./miniruby --zjit -v | grep "+ZJIT"
+        if: ${{ matrix.configure != '--disable-zjit' }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.runs-on || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-zjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS" \
+            ZJIT_BINDGEN_DIFF_OPTS="$ZJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '30'
+          ZJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          CLANG_PATH: ${{ matrix.clang_path }}
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-22.04
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=shipit'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          repository: ruby/ruby-bench
+          persist-credentials: false
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+        env:
+          BUNDLER_VERSION: 0
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/zizmor.yml b/.github/zizmor.yml
new file mode 100644
index 0000000000..65b67fb6c8
--- /dev/null
+++ b/.github/zizmor.yml
@@ -0,0 +1,26 @@
+# Ignore existing findings (baseline)
+# Composite action findings are suppressed inline with # zizmor: ignore
+rules:
+  dangerous-triggers:
+    ignore:
+      - auto_request_review.yml
+      - auto_review_pr.yml
+      - labeler.yml
+      - pr-playground.yml
+  dependabot-cooldown:
+    ignore:
+      - dependabot.yml
+  misfeature:
+    ignore:
+      - mingw.yml
+      - tarball-windows.yml
+      - windows.yml
+  unpinned-images:
+    ignore:
+      - compilers.yml
+  secrets-outside-env:
+    # All committers with write access are trusted; no need for environment-scoped secrets.
+    disable: true
+  unpinned-uses:
+    ignore:
+      - wsl.yml
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..7ead3a81f5
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,291 @@
+*-*-*.def
+*-*-*.exp
+*-*-*.lib
+*.a
+*.bak
+*.bc
+*.bundle
+*.dSYM
+*.dmyh
+*.dylib
+*.elc
+*.i
+*.ii
+*.inc
+*.log
+*.o
+*.o.tmp
+*.obj
+*.old
+*.orig
+*.pch
+*.pdb
+*.rbinc
+*.rbbin
+*.rej
+*.s
+*.sav
+*.sl
+*.so
+*.so.*
+*.swp
+*.yarb
+*~
+.*.list
+.*.time
+.DS_Store
+.bundle
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+.time
+.ruby-version
+Makefile
+cygruby*.def
+extconf.h
+y.output
+y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+!misc/.vscode
+lcov*.info
+
+# /
+/*-fake.rb
+/*.dll
+/*.exe
+/*.res
+/*.pc
+/*.rc
+/*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
+/COPYING.LIB
+/ChangeLog
+/Doxyfile
+/GNUmakefile
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/benchmark/benchmark-driver
+/beos
+/bmlog-*
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
+/doc/capi
+/enc.mk
+/encdb.h
+/exts.mk
+/gc/*/exts.mk
+/goruby
+/id.[ch]
+/largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/probes.dmyh
+/probes.h
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/revision.tmp
+/ripper.tmp.y
+/riscos
+/rubicon
+/ruby
+/ruby-runner
+/ruby-runner.h
+/ruby-man.rd.gz
+/rubyspec_temp
+/run.gdb
+/sizes.c
+/static-ruby
+/test.rb
+/test-coverage.dat
+/tmp
+/vcpkg_installed
+/transdb.h
+/uncommon.mk
+/verconf.h
+/verconf.mk
+/web
+
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
+
+# /benchmark/
+/benchmark/bm_require.data
+/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/jis/props.h
+/enc/unicode/data
+
+# /coroutine/
+!/coroutine/**/*.s
+!/coroutine/**/*.S
+
+# /enc/trans/
+/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+
+# /exe/
+/exe/goruby
+/exe/ruby
+
+# /ext/
+/ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
+
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
+
+# /ext/-test-/gems
+/ext/-test-/gems
+
+# /ext/etc/
+/ext/etc/constdefs.h
+
+# /ext/fiddle/
+/ext/fiddle/libffi-*
+
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids1.h
+/ext/ripper/.eventids2-check
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper_init.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /gems
+/gems/*.gem
+/gems/src
+/gems/*-*
+
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /misc/
+/misc/**/__pycache__
+
+# for `make test-bundler`
+/.rspec_status
+
+# /tool/
+/tool/config.guess
+/tool/config.sub
+
+# /win32/
+/win32/*.ico
+
+
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
+
+# Rust
+/target
+
+# /wasm/
+/wasm/tests/*.wasm
+
+# prism
+/lib/prism/compiler.rb
+/lib/prism/dispatcher.rb
+/lib/prism/dot_visitor.rb
+/lib/prism/dsl.rb
+/lib/prism/inspect_visitor.rb
+/lib/prism/mutation_compiler.rb
+/lib/prism/node.rb
+/lib/prism/reflection.rb
+/lib/prism/serialize.rb
+/lib/prism/visitor.rb
+/prism/internal/diagnostic.h
+/prism/api_node.c
+/prism/ast.h
+/prism/diagnostic.c
+/prism/json.c
+/prism/node.c
+/prism/prettyprint.c
+/prism/serialize.c
+/prism/tokens.c
+/prism/srcs.mk
+/dump_ast
+
+# prism (old file)
+/prism/token_type.c
+
+# tool/update-NEWS-gemlist.rb
+/bundled_gems.json
+/default_gems.json
+/gems/default_gems
+
+# AI agents
+/.claude
+/AGENTS.md
+/CLAUDE.md
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..1d61cbcad1
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,32 @@
+-bap
+-nbbb
+-nbc
+-br
+-brs
+-nbs
+-ncdb
+-nce
+-cdw
+-cli2
+-cbi2
+-ndj
+-ncs
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+-sbi4
+-nut
+-par
+
+-TID
+-TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.mailmap b/.mailmap
new file mode 100644
index 0000000000..213a0f4916
--- /dev/null
+++ b/.mailmap
@@ -0,0 +1,431 @@
+git[bot]                                <svn-admin@ruby-lang.org>
+git[bot]                                <svn-admin@ruby-lang.org> git <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+svn[bot]                                <svn-admin@ruby-lang.org> svn <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# a_matsuda
+Akira Matsuda                           <ronnie@dio.jp>
+Akira Matsuda                           <ronnie@dio.jp> <a_matsuda@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aamine
+Minero Aoki                             <aamine@loveruby.net>
+Minero Aoki                             <aamine@loveruby.net> <aamine@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akira
+akira yamada                            <akira@ruby-lang.org>
+## akira yamada                         <akira@ruby-lang.org> <akira@rice.p.arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akiyoshi
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com>
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com> <akiyoshi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akr
+Tanaka Akira                            <akr@fsij.org>
+Tanaka Akira                            <akr@fsij.org> <akr@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arai
+Koji Arai                               <jca02266@nifty.ne.jp>
+Koji Arai                               <jca02266@nifty.ne.jp> <arai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arton
+Akio Tajima                             <artonx@yahoo.co.jp>
+Akio Tajima                             <artonx@yahoo.co.jp> <arton@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aycabta
+aycabta                                 <aycabta@gmail.com>
+aycabta                                 <aycabta@gmail.com> <aycabta@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ayumin
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com>
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com> <ayumin@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# azav
+Alexander Zavorine                      <alexandre.zavorine@nokia.com>
+Alexander Zavorine                      <alexandre.zavorine@nokia.com> <azav@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# charliesome
+Charlie Somerville                      <charliesome@ruby-lang.org>
+Charlie Somerville                      <charliesome@ruby-lang.org> <charliesome@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dave
+Dave Thomas                             <dave@pragprog.com>
+Dave Thomas                             <dave@pragprog.com> <dave@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# davidflanagan
+David Flanagan                          <davidflanagan@ruby-lang.org>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@think32>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@davidflanagan.com>
+David Flanagan                          <davidflanagan@ruby-lang.org> <davidflanagan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dblack
+David A. Black                          <dblack@rubypal.com>
+David A. Black                          <dblack@rubypal.com> <dblack@wobblini.net>
+David A. Black                          <dblack@rubypal.com> <dblack@superlink.net>
+David A. Black                          <dblack@rubypal.com> <dblack@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# drbrain
+Eric Hodel                              <drbrain@segment7.net>
+Eric Hodel                              <drbrain@segment7.net> <drbrain@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# duerst
+Martin Dürst                            <duerst@it.aoyama.ac.jp>
+Martin Dürst                            <duerst@it.aoyama.ac.jp> <duerst@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eban
+WATANABE Hirofumi                       <eban@ruby-lang.org>
+WATANABE Hirofumi                       <eban@ruby-lang.org> <eban@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# emboss
+Martin Bosslet                          <Martin.Bosslet@gmail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <Martin.Bosslet@googlemail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <emboss@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eregon
+Benoit Daloze                           <eregontp@gmail.com>
+Benoit Daloze                           <eregontp@gmail.com> <eregon@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# evan
+Evan Phoenix                            <evan@ruby-lang.org>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@fallingsnow.net>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# glass
+Masaki Matsushita                       <glass.saga@gmail.com>
+Masaki Matsushita                       <glass.saga@gmail.com> <glass@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gogotanaka
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org>
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org> <gogotanaka@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoken
+Kentaro Goto                            <gotoken@gmail.com>
+Kentaro Goto                            <gotoken@gmail.com> <gotoken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoyuzo
+GOTOU Yuuzou                            <gotoyuzo@notwork.org>
+GOTOU Yuuzou                            <gotoyuzo@notwork.org> <gotoyuzo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gsinclair
+Gavin Sinclair                          <gsinclair@soyabean.com.au>
+Gavin Sinclair                          <gsinclair@soyabean.com.au> <gsinclair@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# H_Konishi
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp>
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp> <H_Konishi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# headius
+Charles Oliver Nutter                   <headius@headius.com>
+Charles Oliver Nutter                   <headius@headius.com> <headius@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hone
+Terence Lee                             <hone@heroku.com>
+Terence Lee                             <hone@heroku.com> <hone@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hsbt
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org>
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org> <hsbt@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# iwamatsu
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org>
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org> <iwamatsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jeg2
+James Edward Gray II                    <james@graysoftinc.com>
+James Edward Gray II                    <james@graysoftinc.com> <jeg2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jim
+Jim Weirich                             <jim@tardis.local>
+Jim Weirich                             <jim@tardis.local> <jim@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# k0kubun
+Takashi Kokubun                         <takashikkbn@gmail.com>
+Takashi Kokubun                         <takashikkbn@gmail.com> <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kanemoto
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org>
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org> <kanemoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# katsu
+UENO Katsuhiro                          <katsu@blue.sky.or.jp>
+UENO Katsuhiro                          <katsu@blue.sky.or.jp> <katsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kazu
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com>
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com> <kazu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# keiju
+Keiju Ishitsuka                         <keiju@ishitsuka.com>
+Keiju Ishitsuka                         <keiju@ishitsuka.com> <keiju@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# knu
+Akinori MUSHA                           <knu@iDaemons.org>
+Akinori MUSHA                           <knu@iDaemons.org> <knu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ko1
+Koichi Sasada                           <ko1@atdot.net>
+Koichi Sasada                           <ko1@atdot.net> <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosaki
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com>
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com> <kosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosako
+K.Kosako                                <sndgk393@ybb.ne.jp>
+K.Kosako                                <sndgk393@ybb.ne.jp> <kosako@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kou
+Sutou Kouhei                            <kou@clear-code.com>
+Sutou Kouhei                            <kou@clear-code.com> <kou@cozmixng.org>
+Sutou Kouhei                            <kou@clear-code.com> <kou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kouji
+Kouji Takao                             <kouji.takao@gmail.com>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@takao7.net>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ksaito
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp>
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp> <ksaito@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ktsj
+Kazuki Tsujimoto                        <kazuki@callcc.net>
+Kazuki Tsujimoto                        <kazuki@callcc.net> <ktsj@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# luislavena
+Luis Lavena                             <luislavena@gmail.com>
+Luis Lavena                             <luislavena@gmail.com> <luislavena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mame
+Yusuke Endoh                            <mame@ruby-lang.org>
+## Yusuke Endoh                         <mame@ruby-lang.org> <mame@tsg.ne.jp>
+Yusuke Endoh                            <mame@ruby-lang.org> <mame@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# marcandre
+Marc-Andre Lafortune                    <github@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca> <marcandre@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# matz
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@ruby-lang.org>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# michal
+Michal Rokos                            <michal@ruby-lang.org>
+Michal Rokos                            <michal@ruby-lang.org> <michal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mneumann
+Michael Neumann                         <mneumann@ruby-lang.org>
+Michael Neumann                         <mneumann@ruby-lang.org> <mneumann@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mrkn
+Kenta Murata                            <mrkn@mrkn.jp>
+Kenta Murata                            <mrkn@mrkn.jp> <muraken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+Kenta Murata                            <mrkn@mrkn.jp> <3959+mrkn@users.noreply.github.com>
+Kenta Murata                            <mrkn@mrkn.jp> <mrkn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagachika
+nagachika                               <nagachika@ruby-lang.org>
+nagachika                               <nagachika@ruby-lang.org> <nagachika@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagai
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp>
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp> <nagai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nahi
+Hiroshi Nakamura                        <nahi@ruby-lang.org>
+Hiroshi Nakamura                        <nahi@ruby-lang.org> <nahi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nari
+Narihiro Nakamura                       <authornari@gmail.com>
+Narihiro Nakamura                       <authornari@gmail.com> <nari@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# naruse
+NARUSE, Yui                             <naruse@airemix.jp>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@ruby-lang.org>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ngoto
+Naohisa Goto                            <ngotogenome@gmail.com>
+Naohisa Goto                            <ngotogenome@gmail.com> <ngoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nobu
+Nobuyoshi Nakada                        <nobu@ruby-lang.org>
+Nobuyoshi Nakada                        <nobu@ruby-lang.org> <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# normal
+Eric Wong                               <normal@ruby-lang.org>
+Eric Wong                               <normal@ruby-lang.org> <e@80x24.org>
+Eric Wong                               <normal@ruby-lang.org> <normal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ntalbott
+Nathaniel Talbott                       <ntalbott@ruby-lang.org>
+Nathaniel Talbott                       <ntalbott@ruby-lang.org> <ntalbott@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ocean
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp>
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp> <ocean@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# odaira
+Rei Odaira                              <rodaira@us.ibm.com>
+Rei Odaira                              <rodaira@us.ibm.com> <Rei.Odaira@gmail.com>
+Rei Odaira                              <rodaira@us.ibm.com> <odaira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# okkez
+okkez                                   <okkez000@gmail.com>
+okkez                                   <okkez000@gmail.com> <okkez@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# rhe
+Kazuki Yamaguchi                        <k@rhe.jp>
+Kazuki Yamaguchi                        <k@rhe.jp> <rhe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ryan
+Ryan Davis                              <ryand-github@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryand-ruby@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# samuel
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz>
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz> <samuel@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# seki
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp>
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp> <seki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ser
+Sean Russell                            <ser@germane-software.com>
+Sean Russell                            <ser@germane-software.com> <ser@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shigek
+Shigeo Kobayashi                        <shigek@ruby-lang.org>
+Shigeo Kobayashi                        <shigek@ruby-lang.org> <shigek@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shirosaki
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com>
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com> <shirosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sho-h
+Sho Hashimoto                           <sho-h@ruby-lang.org>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@netlab.jp>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho.hsmt@gmail.com>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shugo
+Shugo Maeda                             <shugo@ruby-lang.org>
+Shugo Maeda                             <shugo@ruby-lang.org> <shugo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shyouhei
+�部昌平                                    <shyouhei@ruby-lang.org>
+�部昌平                                    <shyouhei@ruby-lang.org> <shyouhei@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# siena
+Siena.                                  <siena@faculty.chiba-u.jp>
+Siena.                                  <siena@faculty.chiba-u.jp> <siena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sonots
+sonots                                  <sonots@gmail.com>
+sonots                                  <sonots@gmail.com> <sonots@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sorah
+Sorah Fukumori                          <her@sorah.jp>
+Sorah Fukumori                          <her@sorah.jp> <sorah@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# stomar
+Marcus Stollsteimer                     <sto.mar@web.de>
+Marcus Stollsteimer                     <sto.mar@web.de> <stomar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# suke
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp>
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp> <suke@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadd
+Tadashi Saito                           <tad.a.digger@gmail.com>
+Tadashi Saito                           <tad.a.digger@gmail.com> <tadd@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadf
+Tadayoshi Funaba                        <tadf@dotrb.org>
+Tadayoshi Funaba                        <tadf@dotrb.org> <tadf@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# takano32
+TAKANO Mitsuhiro                        <takano32@gmail.com>
+TAKANO Mitsuhiro                        <takano32@gmail.com> <takano32@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tarui
+Masaya Tarui                            <tarui@ruby-lang.org>
+Masaya Tarui                            <tarui@ruby-lang.org> <tarui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# technorama
+Technorama Ltd.                         <oss-ruby@technorama.net>
+Technorama Ltd.                         <oss-ruby@technorama.net> <technorama@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tenderlove
+Aaron Patterson                         <tenderlove@ruby-lang.org>
+Aaron Patterson                         <tenderlove@ruby-lang.org> <tenderlove@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tmm1
+Aman Gupta                              <ruby@tmm1.net>
+Aman Gupta                              <ruby@tmm1.net> <tmm1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ts
+Guy Decoux                              <ts@moulon.inra.fr>
+Guy Decoux                              <ts@moulon.inra.fr> <ts@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ttate
+Takaaki Tateishi                        <ttate@ttsky.net>
+## Takaaki Tateishi                     <ttate@ttsky.net> <ttate@kt.jaist.ac.jp>
+Takaaki Tateishi                        <ttate@ttsky.net> <ttate@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# uema2
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp>
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp> <uema2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# usa
+U.Nakamura                              <usa@ruby-lang.org>
+U.Nakamura                              <usa@ruby-lang.org> <usa@garbagecollect.jp>
+U.Nakamura                              <usa@ruby-lang.org> <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wakou
+Wakou Aoyama                            <wakou@ruby-lang.org>
+Wakou Aoyama                            <wakou@ruby-lang.org> <wakou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wanabe
+wanabe                                  <s.wanabe@gmail.com>
+wanabe                                  <s.wanabe@gmail.com> <wanabe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# watson1978
+Watson                                  <watson1978@gmail.com>
+Watson                                  <watson1978@gmail.com> <watson1978@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wew
+William Webber                          <william@williamwebber.com>
+William Webber                          <william@williamwebber.com> <wew@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# why
+why the lucky stiff                     <why@ruby-lang.org>
+why the lucky stiff                     <why@ruby-lang.org> <why@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# xibbar
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org>
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org> <xibbar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yugui
+Yuki Yugui Sonoda                       <yugui@yugui.jp>
+Yuki Yugui Sonoda                       <yugui@yugui.jp> <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yui-knk
+yui-knk                                 <spiketeika@gmail.com>
+yui-knk                                 <spiketeika@gmail.com> <yui-knk@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yuki
+Yuki Nishijima                          <yuki24@hey.com>
+Yuki Nishijima                          <yuki24@hey.com> <mail@yukinishijima.net>
+Yuki Nishijima                          <yuki24@hey.com> <yuki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zsombor
+Dee Zsombor                             <zsombor@ruby-lang.org>
+Dee Zsombor                             <zsombor@ruby-lang.org> <zsombor@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zzak
+zzak                                    <zzakscott@gmail.com>
+zzak                                    <zzakscott@gmail.com> <zzak@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..5172911e16
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,37 @@
+---
+page_dir: doc
+main_page: index.md
+title: Documentation for Ruby development version
+visibility: :private
+rdoc_include:
+- doc
+
+exclude:
+- \.gemspec\z
+- lib/set/subclass_compatible.rb
+
+autolink_excluded_words:
+- Box
+- Class
+- Method
+- Module
+- Process
+- RDoc
+- Ruby
+- Set
+- ZJIT
+- YJIT
+
+canonical_root: https://docs.ruby-lang.org/en/master
+
+footer_content:
+  Ruby:
+    Documentation: index.html
+    Official Website: https://www.ruby-lang.org/
+    Playground: https://ruby.github.io/play-ruby/
+  Resources:
+    GitHub: https://github.com/ruby/ruby
+    Issue Tracker: https://bugs.ruby-lang.org/projects/ruby-master/issues
+    RubyGems: https://rubygems.org/
+  Community:
+    X: https://x.com/rubylangorg
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..66d93598aa
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+   notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+   notice, this list of conditions and the following disclaimer in the
+   documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..35e79dd3b9
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1 @@
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
index 870a5f22d6..428ce03ed7 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,58 @@
+{日本語}[rdoc-ref:COPYING.ja]
+
 Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-(see the file GPL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+   software without restriction, provided that you duplicate all of the
+   original copyright notices and associated disclaimers.
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+   you do at least ONE of the following:
 
-       a) place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-	  modifications to Usenet or an equivalent medium, or by allowing
-	  the author to include your modifications in the software.
+   a. place your modifications in the Public Domain or otherwise
+      make them Freely Available, such as by posting said
+      modifications to Usenet or an equivalent medium, or by allowing
+      the author to include your modifications in the software.
 
-       b) use the modified software only within your corporation or
-          organization.
+   b. use the modified software only within your corporation or
+      organization.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  3. You may distribute the software in object code or binary form,
-     provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+   provided that you do at least ONE of the following:
 
-       a) distribute the binaries and library files of the software,
-	  together with instructions (in the manual page or equivalent)
-	  on where to get the original distribution.
+   a. distribute the binaries and library files of the software,
+      together with instructions (in the manual page or equivalent)
+      on where to get the original distribution.
 
-       b) accompany the distribution with the machine-readable source of
-	  the software.
+   b. accompany the distribution with the machine-readable source of
+      the software.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).  But some files in the distribution
-     are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+   software (possibly commercial).  But some files in the distribution
+   are not written by the author, so that they are not under these terms.
 
-     For the list of those files and their copying conditions, see the
-     file LEGAL.
+   For the list of those files and their copying conditions, see the
+   file LEGAL.
 
-  5. The scripts and library files supplied as input to or produced as 
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them, 
-     and may be sold commercially, and may be aggregated with this
-     software.
+5. The scripts and library files supplied as input to or produced as
+   output from the software do not automatically fall under the
+   copyright of the software, but belong to whomever generated them,
+   and may be sold commercially, and may be aggregated with this
+   software.
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+   PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index 933cc7cb9a..5de2dbcc8f 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,53 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
-Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
-$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+{English}[rdoc-ref:COPYING]
 
-  1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
+本プログラム�フリーソフトウェア��．2-clause BSDL
+���以下�示��件�本プログラムを��布����
+2-clause BSDL�����BSDLファイルを�照��下��．
 
-  2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
-     $B<+M3$KJQ99$G$-$^$9!%(B
+1. 複製�制���自由��．
 
-     (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
-         $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
+2. 以下��件���れ�を満��時�本プログラム�ソースを
+   自由�変更����．
 
-     (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
-         $B;H$&!%(B
+   a.  �ットニューズ��スト��り，作者�変更を�付�る
+       ���方法�，変更を公開�る．
 
-     (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
-         $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
-         $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
-         $B%9$NF~<jK!$rL@<($9$k!%(B
+   b.  変更��本プログラムを自分�所属�る組織内部���
+       使�．
 
-     (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
+   c.  変更点を明示����，ソフトウェア���を変更�る．
+       ��ソフトウェアを�布�る時��変更��本プログラ
+       ムも�時��布�る．���変更��本プログラム�ソー
+       ス�入手法を明示�る．
 
-  3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
-     $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
+   d.  ��他�変更�件を作者����る．
 
-     (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
-         $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
+3. 以下��件���れ�を満��時�本プログラムをコンパイ
+   ル��オブジェクトコードや実行形��も�布����．
 
-     (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
+   a.  �イナリを�����人�ソースを入手��るよ��，
+       ソース�入手法を明示�る．
 
-     (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
-         $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
+   b.  機械�読�ソースコードを添付�る．
 
-     (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
+   c.  変更を行���イナリ���を変更����，オリジナ
+       ル�ソースコード�入手法を明示�る．
 
-  4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
-     $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
-     $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
+   d.  ��他��布�件を作者����る．
 
-     $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
-     LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
+4. 他�プログラム��引用����る目的��れ自由��．�
+   ��，本プログラム���れる他�作者�よるコード�，�
+   れ�れ�作者����よる制��加�られる場���り��．
 
-  5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
-     $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
-     $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
-     $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
+   �れらファイル�一覧��れ�れ��布�件���付���
+   LEGALファイルを�照������．
 
-  6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
-     $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
-     $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
-     $BG$$r;}$A$^$;$s!%(B
+5. 本プログラム��入力��るスクリプト�よ�，本プログラ
+   ム�ら�出力�権利�本プログラム�作者����，�れ�
+   れ�入出力を生���人�属���．��，本プログラム�
+   組�込�れる���拡張ライブラリ����も�様��．
+
+6. 本プログラム�無�証��．作者�本プログラムをサ�ート
+   �る�志��り���，プログラム自身��グ�る��本プ
+   ログラム�実行���ら発生�る���る�害�対��も責
+   任を����ん．
diff --git a/Cargo.lock b/Cargo.lock
new file mode 100644
index 0000000000..2108276e72
--- /dev/null
+++ b/Cargo.lock
@@ -0,0 +1,766 @@
+# This file is automatically @generated by Cargo.
+# It is not intended for manual editing.
+version = 3
+
+[[package]]
+name = "anyhow"
+version = "1.0.100"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a23eb6b1614318a8071c9b2521f36b424b2c83db5eb3a0fead4a6c0809af6e61"
+
+[[package]]
+name = "autocfg"
+version = "1.5.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "c08606f8c3cbf4ce6ec8e28fb0014a2c086708fe954eaa885384a6165172e7e8"
+
+[[package]]
+name = "bitflags"
+version = "1.3.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "bef38d45163c2f1dde094a7dfd33ccf595c92905c8f8f4fdc18d06fb1037718a"
+
+[[package]]
+name = "bitflags"
+version = "2.11.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "843867be96c8daad0d758b57df9392b6d8d271134fce549de6ce169ff98a92af"
+
+[[package]]
+name = "capstone"
+version = "0.14.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f442ae0f2f3f1b923334b4a5386c95c69c1cfa072bafa23d6fae6d9682eb1dd4"
+dependencies = [
+ "capstone-sys",
+ "static_assertions",
+]
+
+[[package]]
+name = "capstone-sys"
+version = "0.18.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a4e8087cab6731295f5a2a2bd82989ba4f41d3a428aab2e7c98d8f4db38aac05"
+dependencies = [
+ "cc",
+]
+
+[[package]]
+name = "cc"
+version = "1.0.94"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "17f6e324229dc011159fcc089755d1e2e216a90d43a7dea6853ca740b84f35e7"
+
+[[package]]
+name = "cfg-if"
+version = "1.0.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9330f8b2ff13f34540b44e946ef35111825727b38d33286ef986142615121801"
+
+[[package]]
+name = "chacha20"
+version = "0.10.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "6f8d983286843e49675a4b7a2d174efe136dc93a18d69130dd18198a6c167601"
+dependencies = [
+ "cfg-if",
+ "cpufeatures",
+ "rand_core",
+]
+
+[[package]]
+name = "console"
+version = "0.16.3"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d64e8af5551369d19cf50138de61f1c42074ab970f74e99be916646777f8fc87"
+dependencies = [
+ "encode_unicode",
+ "libc",
+ "windows-sys 0.61.2",
+]
+
+[[package]]
+name = "cpufeatures"
+version = "0.3.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8b2a41393f66f16b0823bb79094d54ac5fbd34ab292ddafb9a0456ac9f87d201"
+dependencies = [
+ "libc",
+]
+
+[[package]]
+name = "encode_unicode"
+version = "1.0.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "34aa73646ffb006b8f5147f3dc182bd4bcb190227ce861fc4a4844bf8e3cb2c0"
+
+[[package]]
+name = "equivalent"
+version = "1.0.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "877a4ace8713b0bcf2a4e7eec82529c029f1d0619886d18145fea96c3ffe5c0f"
+
+[[package]]
+name = "errno"
+version = "0.3.14"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "39cab71617ae0d63f51a36d69f866391735b51691dbda63cf6f96d042b63efeb"
+dependencies = [
+ "libc",
+ "windows-sys 0.52.0",
+]
+
+[[package]]
+name = "fastrand"
+version = "1.9.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "e51093e27b0797c359783294ca4f0a911c270184cb10f85783b118614a1501be"
+dependencies = [
+ "instant",
+]
+
+[[package]]
+name = "foldhash"
+version = "0.1.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a0d2fde1f7b3d48b8395d5f2de76c18a528bd6a9cdde438df747bfcba3e05d6f"
+
+[[package]]
+name = "getrandom"
+version = "0.4.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0de51e6874e94e7bf76d726fc5d13ba782deca734ff60d5bb2fb2607c7406555"
+dependencies = [
+ "cfg-if",
+ "libc",
+ "r-efi",
+ "rand_core",
+ "wasip2",
+ "wasip3",
+]
+
+[[package]]
+name = "hashbrown"
+version = "0.15.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9229cfe53dfd69f0609a49f65461bd93001ea1ef889cd5529dd176593f5338a1"
+dependencies = [
+ "foldhash",
+]
+
+[[package]]
+name = "hashbrown"
+version = "0.16.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "841d1cc9bed7f9236f321df977030373f4a4163ae1a7dbfe1a51a2c1a51d9100"
+
+[[package]]
+name = "heck"
+version = "0.5.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "2304e00983f87ffb38b55b444b5e3b60a884b5d30c0fca7d82fe33449bbe55ea"
+
+[[package]]
+name = "hermit-abi"
+version = "0.3.9"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d231dfb89cfffdbc30e7fc41579ed6066ad03abda9e567ccafae602b97ec5024"
+
+[[package]]
+name = "id-arena"
+version = "2.3.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "3d3067d79b975e8844ca9eb072e16b31c3c1c36928edf9c6789548c524d0d954"
+
+[[package]]
+name = "indexmap"
+version = "2.13.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "7714e70437a7dc3ac8eb7e6f8df75fd8eb422675fc7678aff7364301092b1017"
+dependencies = [
+ "equivalent",
+ "hashbrown 0.16.1",
+ "serde",
+ "serde_core",
+]
+
+[[package]]
+name = "insta"
+version = "1.47.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "7b4a6248eb93a4401ed2f37dfe8ea592d3cf05b7cf4f8efa867b6895af7e094e"
+dependencies = [
+ "console",
+ "once_cell",
+ "similar",
+ "tempfile",
+]
+
+[[package]]
+name = "instant"
+version = "0.1.13"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "e0242819d153cba4b4b05a5a8f2a7e9bbf97b6055b2a002b395c96b5ff3c0222"
+dependencies = [
+ "cfg-if",
+]
+
+[[package]]
+name = "io-lifetimes"
+version = "1.0.11"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "eae7b9aee968036d54dce06cebaefd919e4472e753296daccd6d344e3e2df0c2"
+dependencies = [
+ "hermit-abi",
+ "libc",
+ "windows-sys 0.48.0",
+]
+
+[[package]]
+name = "itoa"
+version = "1.0.15"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "4a5f13b858c8d314ee3e8f639011f7ccefe71f97f96e50151fb991f267928e2c"
+
+[[package]]
+name = "jit"
+version = "0.1.0"
+
+[[package]]
+name = "leb128fmt"
+version = "0.1.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "09edd9e8b54e49e587e4f6295a7d29c3ea94d469cb40ab8ca70b288248a81db2"
+
+[[package]]
+name = "libc"
+version = "0.2.163"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "1fdaeca4cf44ed4ac623e86ef41f056e848dbeab7ec043ecb7326ba300b36fd0"
+
+[[package]]
+name = "linux-raw-sys"
+version = "0.3.8"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ef53942eb7bf7ff43a617b3e2c1c4a5ecf5944a7c1bc12d7ee39bbb15e5c1519"
+
+[[package]]
+name = "log"
+version = "0.4.18"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "518ef76f2f87365916b142844c16d8fefd85039bc5699050210a7778ee1cd1de"
+
+[[package]]
+name = "memchr"
+version = "2.6.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "76fc44e2588d5b436dbc3c6cf62aef290f90dab6235744a93dfe1cc18f451e2c"
+
+[[package]]
+name = "once_cell"
+version = "1.21.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9f7c3e4beb33f85d45ae3e3a1792185706c8e16d043238c593331cc7cd313b50"
+
+[[package]]
+name = "prettyplease"
+version = "0.2.37"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "479ca8adacdd7ce8f1fb39ce9ecccbfe93a3f1344b3d0d97f20bc0196208f62b"
+dependencies = [
+ "proc-macro2",
+ "syn",
+]
+
+[[package]]
+name = "proc-macro2"
+version = "1.0.101"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "89ae43fd86e4158d6db51ad8e2b80f313af9cc74f5c0e03ccb87de09998732de"
+dependencies = [
+ "unicode-ident",
+]
+
+[[package]]
+name = "quote"
+version = "1.0.40"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "1885c039570dc00dcb4ff087a89e185fd56bae234ddc7f056a945bf36467248d"
+dependencies = [
+ "proc-macro2",
+]
+
+[[package]]
+name = "r-efi"
+version = "6.0.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f8dcc9c7d52a811697d2151c701e0d08956f92b0e24136cf4cf27b57a6a0d9bf"
+
+[[package]]
+name = "rand"
+version = "0.10.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d2e8e8bcc7961af1fdac401278c6a831614941f6164ee3bf4ce61b7edb162207"
+dependencies = [
+ "chacha20",
+ "getrandom",
+ "rand_core",
+]
+
+[[package]]
+name = "rand_core"
+version = "0.10.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0c8d0fd677905edcbeedbf2edb6494d676f0e98d54d5cf9bda0b061cb8fb8aba"
+
+[[package]]
+name = "redox_syscall"
+version = "0.3.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "567664f262709473930a4bf9e51bf2ebf3348f2e748ccc50dea20646858f8f29"
+dependencies = [
+ "bitflags 1.3.2",
+]
+
+[[package]]
+name = "ruby"
+version = "0.0.0"
+dependencies = [
+ "yjit",
+ "zjit",
+]
+
+[[package]]
+name = "rustix"
+version = "0.37.28"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "519165d378b97752ca44bbe15047d5d3409e875f39327546b42ac81d7e18c1b6"
+dependencies = [
+ "bitflags 1.3.2",
+ "errno",
+ "io-lifetimes",
+ "libc",
+ "linux-raw-sys",
+ "windows-sys 0.48.0",
+]
+
+[[package]]
+name = "ryu"
+version = "1.0.20"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "28d3b2b1366ec20994f1fd18c3c594f05c5dd4bc44d8bb0c1c632c8d6829481f"
+
+[[package]]
+name = "semver"
+version = "1.0.26"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "56e6fa9c48d24d85fb3de5ad847117517440f6beceb7798af16b4a87d616b8d0"
+
+[[package]]
+name = "serde"
+version = "1.0.228"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9a8e94ea7f378bd32cbbd37198a4a91436180c5bb472411e48b5ec2e2124ae9e"
+dependencies = [
+ "serde_core",
+]
+
+[[package]]
+name = "serde_core"
+version = "1.0.228"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "41d385c7d4ca58e59fc732af25c3983b67ac852c1a25000afe1175de458b67ad"
+dependencies = [
+ "serde_derive",
+]
+
+[[package]]
+name = "serde_derive"
+version = "1.0.228"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d540f220d3187173da220f885ab66608367b6574e925011a9353e4badda91d79"
+dependencies = [
+ "proc-macro2",
+ "quote",
+ "syn",
+]
+
+[[package]]
+name = "serde_json"
+version = "1.0.143"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d401abef1d108fbd9cbaebc3e46611f4b1021f714a0597a71f41ee463f5f4a5a"
+dependencies = [
+ "itoa",
+ "memchr",
+ "ryu",
+ "serde",
+]
+
+[[package]]
+name = "similar"
+version = "2.4.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32fea41aca09ee824cc9724996433064c89f7777e60762749a4170a14abbfa21"
+
+[[package]]
+name = "static_assertions"
+version = "1.1.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a2eb9349b6444b326872e140eb1cf5e7c522154d69e7a0ffb0fb81c06b37543f"
+
+[[package]]
+name = "syn"
+version = "2.0.117"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "e665b8803e7b1d2a727f4023456bbbbe74da67099c585258af0ad9c5013b9b99"
+dependencies = [
+ "proc-macro2",
+ "quote",
+ "unicode-ident",
+]
+
+[[package]]
+name = "tempfile"
+version = "3.6.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "31c0432476357e58790aaa47a8efb0c5138f137343f3b5f23bd36a27e3b0a6d6"
+dependencies = [
+ "autocfg",
+ "cfg-if",
+ "fastrand",
+ "redox_syscall",
+ "rustix",
+ "windows-sys 0.48.0",
+]
+
+[[package]]
+name = "unicode-ident"
+version = "1.0.22"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9312f7c4f6ff9069b165498234ce8be658059c6728633667c526e27dc2cf1df5"
+
+[[package]]
+name = "unicode-xid"
+version = "0.2.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ebc1c04c71510c7f702b52b7c350734c9ff1295c464a03335b00bb84fc54f853"
+
+[[package]]
+name = "wasip2"
+version = "1.0.1+wasi-0.2.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0562428422c63773dad2c345a1882263bbf4d65cf3f42e90921f787ef5ad58e7"
+dependencies = [
+ "wit-bindgen 0.46.0",
+]
+
+[[package]]
+name = "wasip3"
+version = "0.4.0+wasi-0.3.0-rc-2026-01-06"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "5428f8bf88ea5ddc08faddef2ac4a67e390b88186c703ce6dbd955e1c145aca5"
+dependencies = [
+ "wit-bindgen 0.51.0",
+]
+
+[[package]]
+name = "wasm-encoder"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "990065f2fe63003fe337b932cfb5e3b80e0b4d0f5ff650e6985b1048f62c8319"
+dependencies = [
+ "leb128fmt",
+ "wasmparser",
+]
+
+[[package]]
+name = "wasm-metadata"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "bb0e353e6a2fbdc176932bbaab493762eb1255a7900fe0fea1a2f96c296cc909"
+dependencies = [
+ "anyhow",
+ "indexmap",
+ "wasm-encoder",
+ "wasmparser",
+]
+
+[[package]]
+name = "wasmparser"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "47b807c72e1bac69382b3a6fb3dbe8ea4c0ed87ff5629b8685ae6b9a611028fe"
+dependencies = [
+ "bitflags 2.11.0",
+ "hashbrown 0.15.5",
+ "indexmap",
+ "semver",
+]
+
+[[package]]
+name = "windows-link"
+version = "0.2.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f0805222e57f7521d6a62e36fa9163bc891acd422f971defe97d64e70d0a4fe5"
+
+[[package]]
+name = "windows-sys"
+version = "0.48.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "677d2418bec65e3338edb076e806bc1ec15693c5d0104683f2efe857f61056a9"
+dependencies = [
+ "windows-targets 0.48.5",
+]
+
+[[package]]
+name = "windows-sys"
+version = "0.52.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "282be5f36a8ce781fad8c8ae18fa3f9beff57ec1b52cb3de0789201425d9a33d"
+dependencies = [
+ "windows-targets 0.52.6",
+]
+
+[[package]]
+name = "windows-sys"
+version = "0.61.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ae137229bcbd6cdf0f7b80a31df61766145077ddf49416a728b02cb3921ff3fc"
+dependencies = [
+ "windows-link",
+]
+
+[[package]]
+name = "windows-targets"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9a2fa6e2155d7247be68c096456083145c183cbbbc2764150dda45a87197940c"
+dependencies = [
+ "windows_aarch64_gnullvm 0.48.5",
+ "windows_aarch64_msvc 0.48.5",
+ "windows_i686_gnu 0.48.5",
+ "windows_i686_msvc 0.48.5",
+ "windows_x86_64_gnu 0.48.5",
+ "windows_x86_64_gnullvm 0.48.5",
+ "windows_x86_64_msvc 0.48.5",
+]
+
+[[package]]
+name = "windows-targets"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9b724f72796e036ab90c1021d4780d4d3d648aca59e491e6b98e725b84e99973"
+dependencies = [
+ "windows_aarch64_gnullvm 0.52.6",
+ "windows_aarch64_msvc 0.52.6",
+ "windows_i686_gnu 0.52.6",
+ "windows_i686_gnullvm",
+ "windows_i686_msvc 0.52.6",
+ "windows_x86_64_gnu 0.52.6",
+ "windows_x86_64_gnullvm 0.52.6",
+ "windows_x86_64_msvc 0.52.6",
+]
+
+[[package]]
+name = "windows_aarch64_gnullvm"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "2b38e32f0abccf9987a4e3079dfb67dcd799fb61361e53e2882c3cbaf0d905d8"
+
+[[package]]
+name = "windows_aarch64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32a4622180e7a0ec044bb555404c800bc9fd9ec262ec147edd5989ccd0c02cd3"
+
+[[package]]
+name = "windows_aarch64_msvc"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "dc35310971f3b2dbbf3f0690a219f40e2d9afcf64f9ab7cc1be722937c26b4bc"
+
+[[package]]
+name = "windows_aarch64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "09ec2a7bb152e2252b53fa7803150007879548bc709c039df7627cabbd05d469"
+
+[[package]]
+name = "windows_i686_gnu"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a75915e7def60c94dcef72200b9a8e58e5091744960da64ec734a6c6e9b3743e"
+
+[[package]]
+name = "windows_i686_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8e9b5ad5ab802e97eb8e295ac6720e509ee4c243f69d781394014ebfe8bbfa0b"
+
+[[package]]
+name = "windows_i686_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0eee52d38c090b3caa76c563b86c3a4bd71ef1a819287c19d586d7334ae8ed66"
+
+[[package]]
+name = "windows_i686_msvc"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8f55c233f70c4b27f66c523580f78f1004e8b5a8b659e05a4eb49d4166cca406"
+
+[[package]]
+name = "windows_i686_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "240948bc05c5e7c6dabba28bf89d89ffce3e303022809e73deaefe4f6ec56c66"
+
+[[package]]
+name = "windows_x86_64_gnu"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "53d40abd2583d23e4718fddf1ebec84dbff8381c07cae67ff7768bbf19c6718e"
+
+[[package]]
+name = "windows_x86_64_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "147a5c80aabfbf0c7d901cb5895d1de30ef2907eb21fbbab29ca94c5b08b1a78"
+
+[[package]]
+name = "windows_x86_64_gnullvm"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0b7b52767868a23d5bab768e390dc5f5c55825b6d30b86c844ff2dc7414044cc"
+
+[[package]]
+name = "windows_x86_64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "24d5b23dc417412679681396f2b49f3de8c1473deb516bd34410872eff51ed0d"
+
+[[package]]
+name = "windows_x86_64_msvc"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ed94fce61571a4006852b7389a063ab983c02eb1bb37b47f8272ce92d06d9538"
+
+[[package]]
+name = "windows_x86_64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "589f6da84c646204747d1270a2a5661ea66ed1cced2631d546fdfb155959f9ec"
+
+[[package]]
+name = "wit-bindgen"
+version = "0.46.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f17a85883d4e6d00e8a97c586de764dabcc06133f7f1d55dce5cdc070ad7fe59"
+
+[[package]]
+name = "wit-bindgen"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d7249219f66ced02969388cf2bb044a09756a083d0fab1e566056b04d9fbcaa5"
+dependencies = [
+ "wit-bindgen-rust-macro",
+]
+
+[[package]]
+name = "wit-bindgen-core"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ea61de684c3ea68cb082b7a88508a8b27fcc8b797d738bfc99a82facf1d752dc"
+dependencies = [
+ "anyhow",
+ "heck",
+ "wit-parser",
+]
+
+[[package]]
+name = "wit-bindgen-rust"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "b7c566e0f4b284dd6561c786d9cb0142da491f46a9fbed79ea69cdad5db17f21"
+dependencies = [
+ "anyhow",
+ "heck",
+ "indexmap",
+ "prettyplease",
+ "syn",
+ "wasm-metadata",
+ "wit-bindgen-core",
+ "wit-component",
+]
+
+[[package]]
+name = "wit-bindgen-rust-macro"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0c0f9bfd77e6a48eccf51359e3ae77140a7f50b1e2ebfe62422d8afdaffab17a"
+dependencies = [
+ "anyhow",
+ "prettyplease",
+ "proc-macro2",
+ "quote",
+ "syn",
+ "wit-bindgen-core",
+ "wit-bindgen-rust",
+]
+
+[[package]]
+name = "wit-component"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9d66ea20e9553b30172b5e831994e35fbde2d165325bec84fc43dbf6f4eb9cb2"
+dependencies = [
+ "anyhow",
+ "bitflags 2.11.0",
+ "indexmap",
+ "log",
+ "serde",
+ "serde_derive",
+ "serde_json",
+ "wasm-encoder",
+ "wasm-metadata",
+ "wasmparser",
+ "wit-parser",
+]
+
+[[package]]
+name = "wit-parser"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ecc8ac4bc1dc3381b7f59c34f00b67e18f910c2c0f50015669dde7def656a736"
+dependencies = [
+ "anyhow",
+ "id-arena",
+ "indexmap",
+ "log",
+ "semver",
+ "serde",
+ "serde_derive",
+ "serde_json",
+ "unicode-xid",
+ "wasmparser",
+]
+
+[[package]]
+name = "yjit"
+version = "0.1.0"
+dependencies = [
+ "capstone",
+ "jit",
+]
+
+[[package]]
+name = "zjit"
+version = "0.0.1"
+dependencies = [
+ "capstone",
+ "insta",
+ "jit",
+ "rand",
+ "yjit",
+]
diff --git a/Cargo.toml b/Cargo.toml
new file mode 100644
index 0000000000..33010e65fb
--- /dev/null
+++ b/Cargo.toml
@@ -0,0 +1,64 @@
+# This is the root Cargo [workspace](https://doc.rust-lang.org/cargo/reference/workspaces.html)
+# and the root package for all the rust code that are statically linked into ruby. Rust tooling
+# limitations means all Rust code need to share a single archive library (staticlib) at the
+# integration point with non-rust code. (See rustlang/rust#44322 and #104707 for a taste of
+# the linking challenges.)
+#
+# Do not add required dependencies. This is a policy that helps downstream consumers and give
+# us tight control over what we ship. All of the optional dependencies are used exclusively
+# during development.
+#
+# Release builds avoid Cargo entirely because offline builds can fail even when none of the
+# optional dependencies are built (rust-lang/cargo#10352).
+
+[workspace]
+members = ["zjit", "yjit", "jit"]
+
+[package]
+name = "ruby"
+version = "0.0.0"
+edition = "2024"
+rust-version = "1.85.0"
+publish = false # Don't publish to crates.io
+
+[dependencies]
+yjit = { path = "yjit", optional = true }
+zjit = { path = "zjit", optional = true }
+
+[lib]
+crate-type = ["staticlib"]
+path = "ruby.rs"
+
+[features]
+disasm = ["yjit?/disasm", "zjit?/disasm"]
+runtime_checks = ["yjit?/runtime_checks", "zjit?/runtime_checks"]
+yjit = [ "dep:yjit" ]
+zjit = [ "dep:zjit" ]
+
+[profile.dev]
+opt-level = 1 # On 0, functions use so much stack space that we get stray `SystemStackError`s
+debug = true
+debug-assertions = true
+overflow-checks = true
+
+[profile.test]
+inherits = "dev"
+opt-level = 0
+
+[profile.dev_nodebug]
+inherits = "dev"
+
+[profile.stats]
+inherits = "release"
+
+[profile.release]
+# NOTE: --enable-yjit and zjit builds use `rustc` without going through Cargo. You
+# might want to update the `rustc` invocation if you change this profile.
+opt-level = 3
+# The extra robustness that comes from checking for arithmetic overflow is
+# worth the performance cost for the compiler.
+overflow-checks = true
+# Generate debug info
+debug = true
+# Use ThinLTO. Much smaller output for a small amount of build time increase.
+lto = "thin"
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index 0917fda36e..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,12739 +0,0 @@
-Sun Dec 19 17:24:59 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (enable_rpath): use rpath flag to embed the library
-	  path into extensions on ELF environment.  [ruby-dev:25035]
-
-Sun Dec 19 11:01:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit.rb: use standalone runner for -e.
-
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
-	  multiple -p and -x options.
-
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
-	  ditto.
-
-Sat Dec 18 16:36:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
-	  disallow interrupt by type conversion.  fixed: [ruby-dev:25226]
-
-Sat Dec 18 15:09:02 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/webrick/httpauth.rb,
-	  lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
-	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
-	  encoding/decoding.
-
-Fri Dec 17 16:44:26 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in (ac_cv_sizeof_rlim_t): set 8 for BSD/OS.
-	  Reported by OHARA Shigeki.  [ruby-dev:25236]
-
-Fri Dec 17 16:28:12 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: fix bug on setting up system encoding
-
-	* ext/tk/lib/tk/event.rb: fix error on require process
-
-	* ext/tk/lib/font.rb: fix abnormal termination error on Windows
-
-	* ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
-	  accepts event-sequence arguments
-
-	* ext/tk/lib/text.rb: fail to dump embedded images
-
-	* ext/tk/lib/text.rb: tag_nextrange and tag_prevrange returns wrong
-	  types of values
-
-	* ext/tk/lib/texttag.rb: nextrange and prevrange returns wrong
-	  types of values
-
-	* ext/tk/lib/text.rb: add TkText::IndexModMethods module and
-	  TkText::IndexString class to treat text index modifiers
-
-	* ext/tk/lib/texttag.rb: use TkText::IndexModMethods module
-
-	* ext/tk/lib/textmark.rb: ditto
-
-	* ext/tk/lib/textimage.rb: ditto
-
-	* ext/tk/lib/textwindow.rb: ditto
-
-	* ext/tk/lib/textimage.rb: wrong gravity of text mark for embedded
-	  image
-
-	* ext/tk/lib/textwindow.rb: wrong gravity of text mark for
-	  embedded window
-
-Fri Dec 17 13:33:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session#initialize): control adding
-	  session_id hidden fields.  fixed: [ruby-talk:123850]
-
-Sun Dec 17 00:01:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_proc_arity, rb_node_arity, rb_mod_method_arity,
-	  rb_obj_method_arity): new functions to obtain method arity.
-	  [ruby-dev:25143]
-
-Thu Dec 16 23:31:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): create RUBYARCHDIR also when no extension
-	  is installed.  fixed: [ruby-dev:25215]
-
-Thu Dec 16 22:36:57 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/test_drb.rb: adjust and reduce sleep.
-
-Thu Dec 16 18:37:08 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (ossl_raise): refine message format.
-
-Thu Dec 16 16:29:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/demos-en/widget: modify version check for
-	  supporting features
-
-Thu Dec 16 16:03:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
-
-	* ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
-
-	* ext/tk/lib/tk.rb: add TkComm._callback_entry?()
-
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
-
-	* ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
-
-	* ext/tk/lib/tk/canvastag.rb: ditto
-
-	* ext/tk/lib/tk/dialog.rb: ditto
-
-	* ext/tk/lib/tk/optiondb.rb: ditto
-
-	* ext/tk/lib/tk/text.rb: ditto
-
-	* ext/tk/lib/tk/texttag.rb: ditto
-
-	* ext/tk/lib/tk/textwindow.rb: ditto
-
-	* ext/tk/lib/tk/timer.rb: ditto
-
-	* ext/tk/lib/tk/validation.rb: ditto
-
-	* ext/tk/lib/tkextlib/*: ditto
-
-Thu Dec 16 04:02:28 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/extconf.rb: bison is not needed if ripper.c exists.
-	  [ruby-dev:25191]
-
-Thu Dec 16 03:27:10 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: remove junk.
-
-Thu Dec 16 00:57:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
-
-Thu Dec 16 00:43:29 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: changed default binded address family to use an
-	  available address family of host name. [druby-ja:101]
-
-	* lib/drb/ssl.rb: ditto
-
-Wed Dec 15 17:47:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
-	  should log about all accepted socket. [ruby-core:03962]
-
-	* lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
-	  "%%" and "%u" are supported. [webricken:135]
-
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#check_filename):
-	  :NondisclosureName is acceptable if it is Enumerable.
-
-	* lib/webrick/config.rb (WEBrick::Config::FileHandler):
-	  default value of :NondisclosureName is [".ht*", "*~"].
-
-Wed Dec 15 16:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_obj_id_obsolete): warn always.
-
-Wed Dec 15 15:31:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/set.rb (Set#==): [ruby-dev:25206]
-
-Wed Dec 15 14:32:18 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
-
-Wed Dec 15 10:30:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
-
-Tue Dec 14 19:17:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* utf8.c (utf8_is_mbc_ambiguous): [ruby-talk:123561]
-
-	* utf8.c (utf8_mbc_to_normalize): ditto.
-
-Tue Dec 14 17:08:15 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_close): need to reset osfhnd().
-
-Tue Dec 14 14:03:57 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
-	  [ruby-dev:25187]
-
-Tue Dec 14 12:36:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::initialize): generate new
-	  session if given session_id does not exist.  [ruby-list:40368]
-
-Tue Dec 14 08:47:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (Init_eval): should mark ruby_eval_tree.  [ruby-dev:25189]
-
-Mon Dec 13 18:13:52 2004  Tanaka Akira  <akr@m17n.org>
-
-	* gc.c (set_stack_end): new function to obtain stack end address.
-	  set_stack_end obtains a stack end address by an address of local
-	  variable in the function.
-	  (SET_STACK_END, STACK_END): use set_stack_end.  don't use alloca.
-	  This makes the conservative garbage collector to scan a stack frame
-	  of the garbage_collect function itself.  This is required because
-	  callee-save registers may be stored in the frame.
-	  [ruby-dev:25158]
-
-Mon Dec 13 02:45:51 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/curses/curses.c (window_subwin): call NUM2INT() before
-	GetWINDOW(). fixed: [ruby-dev:25161]
-
-Mon Dec 13 00:58:02 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (cleanpath_aggressive): make it private.
-	  (cleanpath_conservative): ditto.
-	  Suggested by Daniel Berger.  [ruby-core:3914]
-
-Sun Dec 12 21:32:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_super.rb (TestSuper#test_define_method): now methods
-	  from procs can call super.
-
-Sun Dec 12 10:35:10 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
-	  show an accessor's r/w flag if none was specified
-
-Sun Dec 12 10:14:03 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
-	  explicitly given on the command line.
-
-Sat Dec 11 21:10:16 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
-	  [ruby-list:40390]
-
-	* test/drb/drbtest.rb: ditto.
-
-	* test/drb/ut_drb.rb: ditto.
-
-Sat Dec 11 13:08:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sample/optparse/subcommand.rb: a sample for sub commands like
-	  cvs.  contributed by Minero Aoki.
-
-Fri Dec 10 08:39:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/socket.c (sock_listen): get OpenFile just before calling
-	  listen(2).
-
-Thu Dec  9 16:28:35 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/sdbm/init.c (GetDBM): typo.
-
-Thu Dec  9 16:21:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI#setup_header): avoid
-	  SecurityError. [ruby-dev:24970]
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
-	  for reading request till data arrive. [ruby-talk:121068]
-
-Thu Dec  9 14:38:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_inspect): escape # which starts an expression
-	  substitution.  fixed: [ruby-core:03922]
-
-	* string.c (rb_str_dump): not escape # which isn't a substitution.
-
-Thu Dec  9 12:31:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (pipe_open): should set prog if argc != 0.
-
-Thu Dec  9 10:54:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
-
-	* ext/sdbm/init.c: ditto.
-
-	* ext/gdbm/gdbm.c: ditto.
-
-Thu Dec  9 10:19:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/socket/test_socket.rb (test_setsockopt): use SO_LINGER instead
-	  of SO_BINDTODEVICE.  fixed: [ruby-dev:25133]
-
-Thu Dec  9 03:08:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
-	  the running script is '-e one-liner' or '-' (stdin).
-
-	* ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
-	  stub libs
-
-	* ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
-	  have a wrong parent class.
-
-	* ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
-	  TkWarning2 --> TkWarningObj (old names are changed to alias names)
-
-	* ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
-	  option and hashes for configuration
-
-	* ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
-	  button name
-
-	* ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
-	  get_value() and value=(val) ==> set_value(val).
-
-	* ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
-
-	* ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
-	  TkOptionMenuButton = TkOptionMenubutton)
-
-	* ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
-	  event_generate) for Event object
-
-	* ext/tk/lib/tk/font.rb: configinfo returns proper types of values
-
-	* ext/tk/lib/tk.rb: bind methods accept subst_args + block
-
-	* ext/tk/lib/tk/canvas.rb: ditto
-
-	* ext/tk/lib/tk/canvastag.rb: ditto
-
-	* ext/tk/lib/tk/frame.rb: ditto
-
-	* ext/tk/lib/tk/text.rb: ditto
-
-	* ext/tk/lib/tk/texttag.rb: ditto
-
-	* ext/tk/lib/tk/toplevel.rb: ditto
-
-	* ext/tk/lib/tkextlib/*: ditto and bug fix
-
-Wed Dec  8 23:54:29 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
-	  meant that h2 tag was invisible.
-
-Wed Dec  8 22:10:02 2004  Tanaka Akira  <akr@m17n.org>
-
-	* rubyio.h, io.c, ext/dl/dl.c, ext/pty/pty.c, ext/socket/socket.c:
-	  create FILE object only when required: popen(3) and DL's IO#to_ptr.
-	  [ruby-dev:25122]
-
-	* io.c (rb_io_binmode): use setmode for Human68k.  [ruby-dev:25121]
-
-Wed Dec  8 20:13:06 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* process.c (rb_spawn): support for DJGPP.
-
-	* lib/mkmf.rb (VPATH): specify the implicit path separator for DJGPP.
-
-Wed Dec  8 17:48:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): merge Guy Decoux's argument preserve
-	  patch in [ruby-core:03874].
-
-Wed Dec  8 17:37:33 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_pipe_exec): need to close original socket
-	  handle.
-
-Wed Dec  8 14:31:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): [ruby-dev:25104]
-
-Wed Dec  8 13:49:46 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_pipe_exec): must close original handle
-	  before exec. fixed: [ruby-dev:25112]
-
-Wed Dec  8 11:46:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (string_content): get rid of segfault at empty evstr.
-	  fixed: [ruby-dev:25113]
-
-Wed Dec  8 03:26:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_bio.c (ossl_obj2bio): should not use fptr->f.
-	  [ruby-dev:25101]
-
-Wed Dec  8 03:26:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* runruby.rb: prepend LIBRUBY_SO to LD_PRELOAD as well as rubytest.rb.
-
-Wed Dec 08 01:35:44 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (is_socket): reorder of function definitions.
-
-Wed Dec 08 00:44:31 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (pipe_open): win32 bidirectional pipe support.
-
-	* win32/win32.[ch] (rb_w32_pipe_exec): ditto.
-
-	* win32/win32.[ch] (socketpair): new function. POSIX socketpair
-	  emulation.
-
-	* win32/win32.c (socketpair_internal): ditto.
-
-Wed Dec  8 00:25:07 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* test/rss/test_version.rb: added version check test.
-	  [ruby-dev:25053]
-
-Tue Dec  7 15:40:38 2004  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (io_fwrite): avoid context switch before writing to stderr.
-	  [ruby-dev:25080]
-
-	* rubyio.h: refine deprecated declaration.
-
-	* configure.in, file.c, io.c: remove useless check: fseeko, etc.
-
-Tue Dec  7 13:42:07 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (dir_s_mkdir): win32 special processing doesn't need any
-	  longer.
-
-	* win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
-	  interface.
-
-	* win32/win32.[ch] (rb_w32_rmdir): new function.
-
-Tue Dec  7 00:27:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (proc_setgroups): [ruby-dev:25081]
-
-Mon Dec  6 23:07:57 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: check -lsocket for socketpair and shutdown.
-	  reported by Ville Mattila.  [ruby-core:03903]
-
-Mon Dec  6 23:00:45 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (ac_cv_sizeof_rlim_t): setup for DJGPP.
-
-	* io.c (is_socket, shutdown): define dummy macros for DJGPP.
-
-	* process.c: use SIZEOF_RLIM_T instead of HAVE_RLIM_T for DJGPP.
-
-Mon Dec  6 21:19:40 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (is_socket): fix typos. [ruby-core:03900]
-
-Mon Dec  6 20:13:28 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (is_socket): new function.
-
-	* io.c (rb_io_close_read, rb_io_close_write): use is_socket().
-
-	* io.c (rb_io_fptr_finalize): need to check fptr->f before calling
-	  rb_io_fptr_cleanup().
-
-	* io.c (pipe_open): win32 pipe support (experimental).
-
-	* win32/win32.[ch] (rb_w32_pipe_exec): return file descriptors
-	  instead of FILE structure objects.
-
-	* win32/win32.[ch] (rb_w32_is_socket): new function.
-
-Mon Dec  6 19:40:40 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* Makefile.in (.y.c): simplify the rule.
-
-Mon Dec  6 18:08:10 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (rb_reg_eqq): document fix.  [ruby-talk:122541]
-
-Mon Dec  6 17:49:30 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval.c (run_trap_eval): add prototype for Microsoft compiler.
-
-Mon Dec  6 17:32:38 2004  Tanaka Akira  <akr@m17n.org>
-
-	* rubyio.h, intern.h, io.c, file.c, process.c, ext/socket/socket.c,
-	  ext/pty/pty.c, ext/io/wait/wait.c, ext/openssl/ossl_ssl.c:
-	  Use own buffering mechanism instead of stdio.  [ruby-dev:25056]
-
-	* io.c, ext/stringio/stringio.c, test/ruby/ut_eof.rb:
-	  EOF flag removed.
-
-Mon Dec  6 17:15:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/socket/test_socket.rb (TestBasicSocket#test_setsockopt):
-	  BasicSocket#setsockopt dumps core.  [ruby-dev:25039]
-
-	* test/socket/test_tcp.rb (TestTCPSocket#test_recvfrom):
-	  TCPSocket#recvfrom dumps core.  [ruby-dev:24705]
-
-	* test/socket/test_udp.rb (TestUDPSocket#test_connect):
-	  UDPSocket#connect dumps core.  [ruby-dev:25045]
-
-	* test/socket/test_udp.rb (TestUDPSocket#test_bind):
-	  UDPSocket#bind dumps core.  [ruby-dev:25057]
-
-Mon Dec  6 09:59:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_fread): take VALUE argument.
-
-	* ext/socket/socket.c (sock_connect): use rb_str_new4().
-	  [ruby-dev:25052]
-
-	* eval.c (rb_yield_0): [ruby-dev:25051]
-
-Mon Dec  6 01:32:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
-	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
-	  ossl_rsa_private_decrypt): should take an optional argument
-	  to specify padding mode. [ruby-talk:122539]
-
-	* ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
-	  PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
-	  under OpenSSL::PKey::RSA.
-
-	* test/openssl/test_pkey_rsa.rb: new file.
-
-Sun Dec  5 19:39:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Completion#complete): new parameter
-	  to direct case insensitiveness.
-
-	* lib/optparse.rb (OptionParser#order!): ignore case only for long
-	  option.  [ruby-dev:25048]
-
-Sun Dec  5 00:54:32 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* mkconfig.rb: setup library paths before requiring library.
-	  [ruby-core:03892]
-
-Sat Dec  4 22:54:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_write): remove rb_str_locktmp().  [ruby-dev:25050]
-
-	* io.c (io_fwrite): takes VALUE string as an argument.
-	  [ruby-dev:25050]
-
-	* ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
-	  [ruby-dev:25050]
-
-	* ext/socket/socket.c (udp_connect): [ruby-dev:25045]
-
-	* ext/socket/socket.c (udp_bind): ditto.
-
-	* ext/socket/socket.c (udp_send): ditto.
-
-	* ext/socket/socket.c (bsock_send): ditto.
-
-	* ext/socket/socket.c (s_recvfrom): ditto.
-
-	* hash.c (rb_hash_hash): should provide "hash" method where "eql?"
-	  is redefined.  [ruby-talk:122482]
-
-Sat Dec  4 21:29:05 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: (In previous commit) new method chown.
-
-	* lib/fileutils.rb: (In previous commit) new method chown_R.
-
-	* lib/fileutils.rb: (In previous commit) new method chmod_R
-	  wrongly added.  Removed now.
-
-Sat Dec  4 20:45:52 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mkdir, mkdir_p): should chmod explicitly.
-	  [ruby-core:03881]
-
-Sat Dec  4 18:54:09 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb: removed empty lines from output.
-
-Sat Dec  4 18:49:09 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.1 -> 0.1.2
-
-	* lib/rss/rss.rb: #item=/#set_item and so on are obsolete.
-
-Sat Dec  4 14:28:56 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
-	  Section comments may now be bracketed by lines which are
-	  ignored. You can now write
-	      # -----------
-	      # :section: Dave's Section
-	      # comment material
-	      # -----------
-	   The lines before :section: are removed, and identical lines at the end are
-	   also removed if present.
-
-Sat Dec  4 00:35:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
-
-Fri Dec  3 12:25:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* st.h: fix prototype for C++.
-
-Fri Dec  3 01:55:24 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
-	  returns proper object. "widget.option = val" returns val, and
-	  "widget.option(val)" returns self.
-
-	* ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
-
-	* ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
-	  TkRadiobutton#value=(val).
-
-	* ext/tk/lib/tk/spinbox.rb: callback substitution support on
-	  command option.
-
-	* ext/tk/sample/demos-en/widget: bug fix (wrong image height)
-
-	* ext/tk/sample/demos-jp/widget: ditto.
-
-Fri Dec  3 00:21:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): prepare to pass a block from "call" method
-	  to a Proc generated by Method#to_proc.  [ruby-dev:25031]
-
-	* eval.c (rb_yield_0): actually passes a block given to "call".
-
-	* object.c (convert_type): use rb_respond_to() again.  this fix is
-	  based on [ruby-dev:25021]
-
-	* eval.c (rb_respond_to): funcall respond_to? if it's redefined.
-	  [ruby-dev:25021]
-
-Thu Dec  2 15:13:53 2004  Michael Neumann  <mneumann@ruby-lang.org>
-
-	* test/xmlrpc/test_parser.rb, test/xmlrpc/data/*.expected: Expected
-	  values are now stored in YAML instead of using #inspect. This fixes
-	  false hash order.
-
-Fri Dec  3 00:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_file_initialize): [ruby-dev:25032]
-
-Thu Dec  2 16:41:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_protect): prevent continuations created inside from being
-	  called from the outside.  [ruby-dev:25003]
-
-	* eval.c (rb_callcc, rb_cont_call): prohibit calling from different
-	  signal contexts.  [ruby-dev:25022]
-
-Thu Dec  2 10:45:02 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/readline/test_readline.rb: fix for NetBSD.
-
-Thu Dec  2 09:57:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
-	  marshaled again.  [ruby-core:03862]
-
-Thu Dec  2 09:30:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (thread_mark): mark thread group.  [ruby-dev:25020]
-
-	* eval.c (thgroup_add): check whether the argument is really a Thread.
-
-Thu Dec  2 07:57:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_ctl): [ruby-dev:25019]
-
-Wed Dec  1 06:13:00 2004  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf/nkf.c: add constant NKF::VERSION
-
-	* ext/nkf/nkf.c(guess): this becomes an alias of guess2
-
-	* ext/nkf/test.rb: add --no-cp932
-
-	* ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
-
-Wed Dec  1 02:21:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* signal.c (sighandler): call handler immediately only for default
-	  handlers.  [ruby-dev:25003]
-
-Tue Nov 30 23:49:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (pipe_open): errno should be preserved for rb_sys_fail() when
-	  fork failed.
-
-Tue Nov 30 16:18:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
-
-	* eval.c (rb_eval): should check previous frame for ZSUPER.
-
-	* io.c (read_all): remove unnecessary rb_str_resize().
-	  [ruby-dev:24996]
-
-	* io.c (io_readpartial): ditto.
-
-	* io.c (io_read): ditto.
-
-Tue Nov 30 14:58:33 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* instruby.rb (install): add arguments explicitly to "super".
-
-Tue Nov 30 00:49:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (PUSH_FRAME): flags should have been initialized.
-
-	* eval.c (rb_eval): [ruby-core:03856]
-
-	* io.c (rb_io_sysread): use temporary lock.  [ruby-dev:24992]
-
-Tue Nov 30 00:12:57 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regparse.c: now handles many alternatives (over 500000)
-	in regexp. [ruby-dev:24773]
-
-Mon Nov 29 16:06:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_write): insufficiently filled string
-	  being extended when overwriting.  [ruby-core:03836]
-
-Mon Nov 29 15:59:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/ostruct.rb (OpenStruct::method_missing): check method
-	  duplication for -d.
-
-	* lib/ostruct.rb (OpenStruct::initialize): ditto.
-
-Mon Nov 29 15:22:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
-	  not supported.
-
-Mon Nov 29 13:37:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (fptr_finalize): must not use FILE after fclose().
-	  [ruby-dev:24985]
-
-Mon Nov 29 13:13:13 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (CreateChild): push back the last space before next
-	  loop because CharNext() eats it.
-
-Mon Nov 29 03:08:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (convert_type): [ruby-core:03845]
-
-	* eval.c (rb_funcall_rescue): new function.
-
-	* object.c (rb_Array): avoid using rb_respond_to().
-
-	* object.c (rb_Integer): ditto.
-
-	* eval.c (get_backtrace): no conversion for nil.
-
-	* parse.y (reduce_nodes): empty body should return nil.
-
-Mon Nov 29 01:18:18 2004  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (rb_io_check_writable): call io_seek regardless of
-	  NEED_IO_SEEK_BETWEEN_RW.  [ruby-dev:24986]
-
-Sun Nov 28 15:57:58 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (RSS::Element#tag): not use block_given? for
-	  working with ruby 1.6 again.
-
-	* lib/rss/{0.9,2.0,trackback}.rb, lib/rss/maker/base.rb:
-	  undef -> remove_method for working with ruby 1.6 again.
-
-Sun Nov 28 15:51:40 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (RSS::NotSetError): added.
-
-	* lib/rss/maker/{1.0,0.9,2.0}.rb: changed RSS Maker to raise
-	  RSS::NotSetError if required values of maker.channel are not
-	  set. [ruby-talk:120061]
-
-	* test/rss/test_maker_{1.0,0.9,2.0}.rb: changed tests to check RSS
-	  Maker raises or not.
-
-Sun Nov 28 12:14:47 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regparse.c (fetch_token): fixed test failure on HP-UX ia64
-	([ruby-dev:24859]).
-
-Sun Nov 28 12:08:15 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regparse.c, test/ruby/test_regexp.rb: fixed problem with UTF-8
-	characters that have U+00FE or invalid characters.
-
-Sun Nov 28 12:07:04 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regexec.c, test/ruby/test_regexp.rb: fixed segmentation falut
-	([ruby-dev:24887]).
-
-Sun Nov 28 12:05:48 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regcomp.c, regint.h: fixed PLATFORM_UNALIGNED_WORD_ACCESS
-	problem ([ruby-dev:24802] and [ruby-core:3733])
-
-Sat Nov 27 23:43:39 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_initialize): [ruby-dev:24972]
-
-Sat Nov 27 21:43:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* io.c: avoid data lost with nonblocking fd and
-	  stdio buffering in sync mode.  [ruby-dev:24966]
-	  based on matz's patch [ruby-dev:24967]
-	  (io_fwrite): new primitive writing function which writes
-	  directly if sync mode.
-	  (rb_io_fwrite): wrapper for io_fwrite now.
-	  (io_write): call io_fwrite instead of rb_io_fwrite.
-
-Sat Nov 27 17:43:21 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{0.9,1.0,2.0,trackback,xml-stylesheet}.rb: added
-	  #setup_maker.
-
-	* test/rss/test_setup_maker_*.rb: added tests for #setup_maker.
-
-	* lib/rss/maker/base.rb(RSS::Maker::Items#max_size=): supported
-	  output item size limitation.
-
-	* sample/rss/blend.rb: added sample for RSS Maker.
-
-Sat Nov 27 17:41:35 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker/0.9.rb: supported RSS::Maker.make("0.91"). Now,
-	  "0.9" is just alias of "0.91."
-
-	* test/rss/test_maker_0.9.rb: make("0.9") -> maker("0.91").
-
-	* test/rss/test_to_s.rb: ditto.
-
-Sat Nov 27 17:21:30 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* sample/rss/list_description.rb: untabified.
-
-	* sample/rss/rss_recent.rb: ditto.
-
-Sat Nov 27 14:44:15 2004  Kent Sibilev  <ksibilev@bellsouth.net>
-
-	* lib/cgi/session.rb (CGI::Session::initialize): [ruby-core:03832]
-
-Sat Nov 27 09:41:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_fread): old rb_io_fread with file closing checking.
-	  (rb_io_fread): wrapper for io_fread now.
-	  [ruby-dev:24964]
-
-Fri Nov 26 18:02:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
-
-	* ext/tk/lib/tk/image.rb: bug fix
-
-	* ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
-
-	* ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
-
-Fri Nov 26 14:29:39 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_initialize): uninitialized fd was checked to see open
-	  mode.  [ruby-dev:24963]
-
-	* io.c (rb_io_initialize): uninitialized fd was used.  [ruby-dev:24962]
-
-Fri Nov 26 13:49:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_initialize): should retrieve flags from copying file
-	  descriptor. [ruby-dev:24961]
-
-	* eval.c (method_missing): raise TypeError for classes do not
-	  have allocators.  [ruby-core:03752]
-
-	* lib/erb.rb: add RDoc by James Edward Gray II.  [ruby-core:03786]
-
-Fri Nov 26 13:29:02 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
-	  out of preprocessing when we find a :section: directive (previously cleared out the
-	  comment, but this apparently now generates an error in gsub!)
-
-Fri Nov 26 00:17:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_read): move StringValue() check before GetOpenFile().
-	  [ruby-dev:24959]
-
-Thu Nov 25 20:14:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
-	  threads should be also processed.  [ruby-talk:121320]
-
-Thu Nov 25 18:06:37 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: AC_CHECK_SIZEOF(rlim_t) to include stdio.h to fix
-	  problem with autoconf 2.52 or earlier.
-	  revert AC_PREREQ to 2.50.
-	  [ruby-core:3809]
-
-Thu Nov 25 07:59:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* configure.in: AC_PREREQ(2.53) [ruby-core:03800]
-
-	* io.c (read_all): stringify non-nil buffer argument, and always
-	  taint the result.  [ruby-dev:24955]
-
-Wed Nov 24 01:01:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_read): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24952]
-
-	* configure.in, io.c: cancel [ ruby-Patches-1074 ].
-
-Tue Nov 23 08:09:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
-
-Tue Nov 23 02:00:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (rb_file_chown): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24949]
-
-Tue Nov 23 00:10:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (rb_file_chown): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24947]
-
-	* file.c (rb_file_truncate): ditto.
-
-	* file.c (rb_file_s_truncate): ditto.
-
-	* dir.c (dir_seek): use NUM2OFFT().
-
-	* misc/ruby-mode.el (ruby-non-block-do-re): [ruby-core:03719]
-
-Mon Nov 22 22:33:02 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
-	  of variables or constants when parsing 'require'
-
-Mon Nov 22 00:13:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (dir_seek): should retrieve dir_data after NUM2INT().
-	  [ruby-dev:24941]
-
-Sat Nov 20 23:57:33 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/README (et al): Add a new directive, :section:, and
-	  change the output format to accomodate. :section: allows to to
-	  group together methods, attributes, constants, etc under
-	  headings in the output. If used, a table of contents is
-	  generated.
-
-Sat Nov 20 23:56:54 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/options.rb (Options::parse): Force --inline-source if
-	  --one-file option given
-
-Sat Nov 20 23:55:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_splice): should place index wrapping after
-	  possible modification.  [ruby-dev:24940]
-
-Sat Nov 20 23:25:12 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* io.c (rb_io_getline): f.gets("") did not work. [ruby-core:03771]
-
-	* test/ruby/test_io.rb (test_gets_rs): test it.
-
-Sat Nov 20 22:55:09 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/runner.rb (CROSS_COMPILING): need to require rbconfig.rb before
-	  using CROSS_COMPILNG.
-
-Sat Nov 20 20:42:42 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/depend: fix ripper.o dependency.
-
-Sat Nov 20 17:48:29 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (io_reopen): work around problem with Cygwin fseeko
-	  returning ESPIPE.
-
-Tue Nov 20 05:34:24 2004  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
-
-	* ext/nkf/test.rb: add test for mime encode/decode
-
-Sat Nov 20 01:45:04 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/xmlrpc/test_webrick_server.rb : move `requrie "webrick/https"'
-	  into #setup_http_server mohtod to avoid soap test errors.
-
-Sat Nov 20 01:37:34 2004  Johan Holmberg  <holmberg@iar.se>
-
-	* eval.c (error_print): nicer traceback at interrupt.
-	  [ruby-core:03774]
-
-Sat Nov 20 00:07:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_gsub): internal buffer should not be listed by
-	  ObjectSpace.each_object() by String#gsub.  [ruby-dev:24931]
-
-Fri Nov 19 22:44:43 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/test/unit/collector/dir.rb: better support for -p/-x option.
-
-Fri Nov 19 17:46:56 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker/0.9.rb (RSS::Maker::RSS09::Image#have_required_values):
-	  changed /rss/channel/image to be optional. [ruby-Bugs:1047]
-
-	* test/rss/test_maker_0.9.rb: added tests for the above.
-
-Fri Nov 19 17:18:17 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.0 -> 0.1.1.
-
-	* lib/rss: #to_s used #tag.
-
-	* test/rss/test_to_s.rb: added.
-
-	* lib/rss/maker.rb (RSS::Maker.make): changed API. It's not
-	  received modules which is used as the second argument.
-
-	* lib/rss/xml-stylesheet.rb (RSS::XMLStyleSheet#alternate):
-	  changed return value type which is not String but Boolean.
-
-	* lib/rss/2.0.rb (RSS::Rss::Channel#ttl): changed return value
-	  type which is not String but Integer.
-
-	* lib/rss/0.9.rb (RSS::Rss::Channel): <skipDays> has <day>s and
-	  <skipHours> has <hour>s.
-
-	* lib/rss/maker/0.9.rb (RSS::Maker::RSS09::Channel): ditto.
-
-	* lib/rss/0.9.rb (RSS::Rss::Channel::Item): <item> has <category>s.
-
-	* lib/rss/maker/2.0.rb (RSS::Maker::Rss20::Channel::Item): ditto.
-
-	* lib/rss/2.0.rb (RSS::Rss::Channel): <channel> has <category>s.
-
-	* lib/rss/maker/2.0.rb (RSS::Maker::RSS20::Channel): ditto.
-
-	* lib/rss/trackback.rb: parent element has <trackback:about>s.
-
-	* lib/rss/maker/trackback.rb: ditto.
-
-Fri Nov 19 11:10:16 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/test/unit/collector/dir.rb: add support for directory name
-	  with -p/-x options.
-
-	* test/testunit/collector/test_dir.rb: ditto.
-
-	* lib/xmlrpc/datetime.rb (XMLRPC::DateTime#==): should use Array()
-	  instead of to_a.
-
-Fri Nov 19 10:32:36 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/readline/readline.c (readline_s_set_completion_append_character):
-	  accept nil.  [ruby-core:03765]
-
-Fri Nov 19 01:20:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
-	  exception if data corresponding to session specified from the
-	  client does not exist.
-
-Fri Nov 19 00:59:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_gsub): internal buffer should not be listed by
-	  ObjectSpace.each_object().  [ruby-dev:24919]
-
-Thu Nov 18 23:42:36 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/depend: Never regenerate lib/ripper/core.rb
-	  automatically. [ruby-dev:24911]
-
-Thu Nov 18 20:47:24 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
-	  isatty because it never sets errno.
-
-Thu Nov 18 18:41:08 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* test/ruby/test_stringchar.rb (test_bang): added.
-
-	* string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
-	(rb_str_swapcase_bang): missing rb_str_modify().
-
-Thu Nov 18 17:05:01 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (f_rest_arg): store rest args into invisible local variabe
-	  in order to get rid of SEGV at ZSUPER.  [ruby-dev:24913]
-
-Thu Nov 18 15:39:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_f_getenv): prohibit for $SAFE=4. [ruby-dev:24908]
-
-Thu Nov 18 14:58:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/readline/readline.c: check $SAFE.
-
-	* test/readline/test_readline.rb: added tests for readline.
-
-Thu Nov 18 00:21:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (proc_getpgrp): prohibit for $SAFE=2.
-	  [ruby-dev:24899]
-
-	* process.c (get_pid): ditto.  [ruby-dev:24904]
-
-	* process.c (get_ppid): ditto.
-
-	* array.c (rb_ary_delete): defer rb_ary_modify() until actual
-	  modification.  [ruby-dev:24901]
-
-Thu Nov 18 10:10:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c, rubyio.h (rb_io_modenum_flags): exported.
-
-	* ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
-	  well as IO.new does.  [ruby-dev:24896]
-
-Wed Nov 17 23:47:30 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/ruby/test_settracefunc.rb: added.  [ruby-dev:24884]
-
-Wed Nov 17 18:59:16 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* process.c (proc_getrlimit, proc_setrlimit): add rb_secure(2) to
-	  methods of Process.{getrlimit,setrlimit}
-
-Wed Nov 17 13:56:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
-
-	* parse.y (string_content): should not use FL_UNSET.
-
-	* node.h (NODE_NEWLINE): remove unused bit to utilize flag field
-	  in nodes.
-
-Wed Nov 17 13:05:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (rb_push_glob): fix overrun.  [ruby-dev:24886]
-
-Wed Nov 17 11:48:17 2004  Michael Neumann  <mneumann@ruby-lang.org>
-
-	* lib/xmlrpc/parser.rb, test/xmlrpc/test_features.rb: fixed "assinging
-	  to constants" warnings
-
-Wed Nov 17 09:38:18 2004  Johan Holmberg  <holmberg@iar.se>
-
-	* re.c (rb_reg_initialize_m): should raise exception instead of
-	  compile error.  [ruby-core:03755]
-
-Wed Nov 17 03:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_splice): move rb_str_modify() after
-	  StringValue(), which may alter the receiver.  [ruby-dev:24878]
-
-	* error.c (rb_error_frozen): now raise RuntimeError instead of
-	  TypeError.
-
-Tue Nov 16 21:22:47 2004  Michael Neumann  <mneumann@ruby-lang.org>
-
-	* lib/xmlrpc/server.rb (CGIServer): fixed bug when client sends
-	  "Content-typ: text/xml; ..."
-
-Tue Nov 16 23:45:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (flo_divmod): protect float values from GC by
-	  assignment to local variables.  [ruby-dev:24873]
-
-Tue Nov 16 14:31:54 2004  Michael Neumann  <mneumann@ruby-lang.org>
-
-	* test/xmlrpc/*: imported and refactored original test cases.
-
-	* test/xmlrpc/test_webrick_server.rb, test/xmlrpc/webrick_testing.rb:
-	  added test case that starts up a WEBrick XML-RPC server and performs
-	  some tests on it (both http and https servers are started).
-
-	* lib/xmlrpc/create.rb (XMLWriter::each_installed_writer),
-	  lib/xmlrpc/parser.rb (XMLParser::each_installed_parser):
-	  added methods to simply original test cases
-
-	* lib/xmlrpc/parser.rb, lib/xmlrpc/datetime.rb: applied patch by
-	  MoonWolf <moonwolf@moonwolf.com> to allow parsing datetime.iso8601
-	  (e.g. 20041105T01:15:23Z).
-
-	* lib/xmlrpc/server.rb: fixed issue #998
-	  (http://rubyforge.org/tracker/?func=detail&atid=1700&aid=998&group_id=426)
-
-	* lib/xmlrpc/create.rb, lib/xmlrpc/utils.rb: when marshalling/loading
-	  user-defined data structures, use Class#allocate instead of defining
-	  an empty #initialize method. module XMLRPC::Marshallable is now only
-	  used for tagging.
-
-	* lib/xmlrpc/.document, lib/xmlrpc/README.rdoc: added howto
-
-Tue Nov 16 16:26:12 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
-	  config.status to force updating them.
-
-Tue Nov 16 16:20:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): position was ignored when a
-	  buffer was passed.  http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
-
-Tue Nov 16 13:35:54 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): add
-	  new option --exclude (-x) to skip some tests. [ruby-core:3363],
-	  [ruby-dev:24865]
-
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir.exclude):
-	  ditto.
-
-Tue Nov 16 11:19:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
-	  Regexp conversion.
-
-Tue Nov 16 01:41:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_mod_check): frozen check should be separated.
-	  [ruby-core:3742]
-
-	* array.c (rb_ary_update): pedantic check to detect
-	  rb_ary_to_ary() to modify the receiver.  [ruby-dev:24861]
-
-Mon Nov 15 18:58:05 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: check rlim_t more portably. [ruby-core:3735]
-
-Mon Nov 15 11:50:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
-	  operator symbols.  [ruby-talk:120177]
-
-Mon Nov 15 08:58:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (Init_Proc): make proc as an alias to Proc.new.
-	  [ruby-dev:24848]
-
-Mon Nov 15 00:46:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_yield_0): lambda{}.call(1) should raise exception.
-	  [ruby-talk:120253]
-
-Mon Nov 15 00:33:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_clear): avoid revealing NULL pointer.
-	  [ruby-dev:24766]
-
-	* string.c (str_gsub): add paranoid check. [ruby-dev:24827]
-
-	* string.c (str_mod_check): check frozen status as well.
-	  [ruby-dev:24801]
-
-Sun Nov 14 18:59:03 2004  Tanaka Akira  <akr@m17n.org>
-
-	* process.c (proc_getrlimit): new function for Process.getrlimit.
-	  (proc_setrlimit): new function for Process.setrlimit.
-	  [ruby-dev:24834]
-
-	* configure.in: check rlim_t and its size.  check setrlimit.
-
-	* ruby.h (NUM2ULL): new macro.
-
-Sun Nov 14 13:27:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/pp.rb (PP#object_address_group): remove odd number of 'f'
-	  prefixed to negative address.
-
-Sun Nov 14 10:48:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/mathn.rb (Integer::gcd2): faster implementation by
-	  <erlercw@siu.edu>. [ruby-talk:120232]
-
-Sun Nov 14 08:46:33 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/logger/test_logger.rb: Logger just expects
-	  Logger#datetime_format to be used for Time#strftime independently of
-	  locale. [ruby-dev:24828]
-
-Fri Nov 12 17:32:07 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* bcc32/README.bcc32, win32/README.win32: need bison instead of
-	  byacc.
-
-Fri Nov 12 15:15:06 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval.c (ruby_options): now we cannot call rb_glob() before
-	  ruby_init(), so call rb_w32_cmdvector() at ruby_options().
-
-	* win32/win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
-	  export it.
-
-Fri Nov 12 14:08:01 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
-
-	* ext/tk/lib/tk.rb: ditto
-
-Fri Nov 12 00:31:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
-	  pointer.  [ruby-dev:24783]
-
-Thu Nov 11 17:58:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (rb_glob): should have called rb_glob_caller().
-	  [ruby-dev:24773]
-
-Thu Nov 11 16:56:10 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file.rb (test_truncate_wbuf): we want to test
-	  only File#truncate, not behavior of seek(2).
-
-Thu Nov 11 01:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (syserr_initialize): use stringified object.
-	  [ruby-dev:24768]
-
-Wed Nov 10 22:49:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb (SimpleDelegator::dup): wrong number of
-	  arguments.
-
-	* lib/delegate.rb (DelegateClass::dup): ditto.
-
-Wed Nov 10 19:47:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): path is a string object now.
-
-Wed Nov 10 12:31:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* README.EXT (Example): extconf.rb is indispensable now.
-
-Wed Nov 10 03:33:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
-	  or older
-
-	* ext/tk/lib/tkextlib/tile/style.rb: bug fix
-
-Tue Nov  9 22:24:07 2004  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf: original nkf.c rev:1.38
-
-	* ext/nkf/nkf.c: fix bug: can't parse long-name options
-
-	* ext/nkf/test.rb: fix bug: mime tests fail
-
-Tue Nov  9 14:27:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
-
-Tue Nov  9 00:50:06 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
-
-Tue Nov  9 01:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (rb_glob2): do not allocate buffer from heap to avoid
-	  memory leaks.  use string object for buffering instead.
-	  [ruby-dev:24738]
-
-	* dir.c (join_path): ditto.
-
-	* io.c (io_read): external input buffer may be modified even after
-	  rb_str_locktmp().  [ruby-dev:24735]
-
-	* dir.c (fnmatch): p or s may be NULL.  [ruby-dev:24749]
-
-Tue Nov  9 00:36:26 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
-	  [ruby-dev:24743]
-
-Mon Nov  8 22:20:19 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Fix bug where parent class wasn't being detected if the
-	  child class was defined using the A::B notation.
-
-Mon Nov  8 00:14:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: add setup for mignw32 cross compiling.
-	  [ruby-talk:119413]
-
-Sun Nov  7 23:49:26 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: bind-event methods accept multi substitution
-	  arguments.
-
-	* ext/tk/lib/tk/canvas.rb: ditto.
-
-	* ext/tk/lib/tk/canvastag.rb: ditto.
-
-	* ext/tk/lib/tk/text.rb: ditto.
-
-	* ext/tk/lib/tk/texttag.rb: ditto.
-
-	* ext/tk/lib/tkextlib: ditto.
-
-Sat Nov  6 20:40:16 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: rename WIN32OLE#ole_obj_help to
-	  WIN32OLE#ole_type. alias ole_obj_help to ole_type.
-
-	* ext/win32ole/tests/testWIN32OLE.rb: ditto.
-
-Sat Nov  6 11:18:59 2004  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date.rb (_parse): checks whether zone was given.
-
-Sat Nov  6 00:46:27 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_locktmp): check STR_TMPLOCK flag before
-	  locking.  [ruby-dev:24727]
-
-Fri Nov  5 19:07:16 2004  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf: follow CVS Head of original nkf.
-
-Fri Nov  5 18:12:42 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
-	  X_Scrollable and Y_Scrollable
-
-	* ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
-
-	* ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
-	  Y_Scrollable
-
-Fri Nov  5 16:05:32 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
-
-Fri Nov  5 13:22:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/text.rb: sorry. bug fix again.
-
-Fri Nov  5 13:17:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/text.rb: bug fix
-
-Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (gc_mark): stricter GC stack check.
-
-Fri Nov  5 08:34:43 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_gsub): should have removed rb_str_unlocktmp(str).
-	  [ruby-dev:24708]
-
-	* ext/socket/socket.c (s_recvfrom): buffer modification check.
-	  [ruby-dev:24708]
-
-Thu Nov  4 23:54:21 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regexec.c, regparse.c, regint.h: fixed conflicts between
-	vendor branch.
-
-Thu Nov  4 23:41:55 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* ascii.c, euc_jp.c, oniggnu.h, oniguruma.h, regcomp.c,
-	regenc.c, regenc.h, regerror.c, regexec.c, reggnu.c,
-	regint.h, regparse.c, regparse.h, sjis.c, utf8.c:
-	imported Oni Guruma 3.4.0.
-
-	* parse.y, re.c: Now mbclen() takes unsigned char as
-	its argument.
-
-Thu Nov  4 21:25:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_gsub): string modify check no longer based on
-	  tmplock.  [ruby-dev:24706]
-
-Thu Nov  4 21:13:48 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c(typelib_file_from_typelib): search "win16"
-	  entry to get library path.
-
-	* ext/win32ole/win32ole.c(oletypelib_path): ditto.
-
-	* ext/win32ole/win32ole.c(ole_typedesc2val): add VT_LPWSTR, VT_LPSTR,
-	  VT_ERROR case.
-
-Thu Nov  4 15:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
-	  of TkVarAccess objects
-
-Thu Nov  4 09:11:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (gc_mark): enable GC stack checking.
-
-Thu Nov  4 03:11:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_gsub): lock strings temporarily.  [ruby-dev:24687]
-
-	* ext/socket/socket.c (s_recvfrom): tmplock input buffer.
-	  [ruby-dev:24705]
-
-Wed Nov  3 22:24:17 2004  Daigo Moriwaki  <techml@sgtpepper.net>
-
-	* lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
-	  avoid warnings.
-
-Wed Nov  3 17:19:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_uniq_bang): do not push frozen string from hash
-	  table.  [ruby-dev:24695]
-
-	* array.c (rb_ary_and): ditto.
-
-	* array.c (rb_ary_or): ditto.
-
-Wed Nov  3 17:02:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: support to use different Tcl commands between
-	  configure and configinfo
-
-	* ext/tk/lib/font.rb: ditto.
-
-	* ext/tk/lib/itemconfig.rb: support to use different Tcl commands
-	  between item_configure and item_configinfo
-
-	* ext/tk/lib/itemfont.rb: ditto.
-
-	* ext/tk/extconf.rb: install SUPPORT_STATUS
-
-	* ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
-
-Wed Nov  3 15:38:28 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* test/rss/*.rb: removed tab width configuration headers.
-
-	* test/rss/test_maker_{0.9,1.0}.rb: sort -> do_sort.
-
-	* lib/rss/maker/*.rb: changed API to RSS version independence.
-
-	* lib/rss/maker/base.rb
-	  (RSS::Maker::XMLStyleSheets::XMLStyleSheet): checked required
-	  (pseudo) attributes.
-
-	* lib/rss/maker/base.rb (RSS::Maker::Items): sort -> do_sort.
-
-	* lib/rss/rss.rb (RSS::BaseModel.install_date_element): avoided
-	  warning.
-
-	* lib/rss/0.9.rb (RSS::Rss#textinput): added convenience method.
-
-Tue Nov  2 16:35:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/enumerator/enumerator.c (each_cons_i): pass copy of an
-	  internal consequent array.  [ruby-talk:118691]
-
-Tue Nov  2 14:54:02 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (pipe_open): need to set cmd if argc == 0 (win32).
-
-Tue Nov  2 01:20:09 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (pipe_open): IO.popen should take array as 1st argument for
-	  a command line.  [ruby-dev:24678]
-
-	* eval.c (proc_invoke): nail down dyna_var node when Proc object
-	  or continuation is created.  [ruby-dev:24671]
-
-	* io.c (rb_io_s_popen): do not expand argv array.  [ruby-dev:24670]
-
-Mon Nov  1 22:25:56 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker/base.rb: changed xml-stylesheet's API of RSS Maker
-	  like to item's one.
-
-	* lib/rss/xml-stylesheet.rb (RSS::XMLStyleSheet#guess_type): fixed
-	  regular expression bug.
-
-	* test/rss/test_maker_xml-stylesheet.rb: updated tests for
-	  xml-stylesheet.
-
-Mon Nov  1 13:59:28 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
-
-	* ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
-	  ext/stringio/extconf.rb: added.
-
-	* MANIFEST, ext/**/MANIFEST: removed.
-
-	* README.EXT, README.EXT.ja: remove MANIFEST stuff.
-
-Mon Nov  1 11:52:18 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (pipe_open): avoid conflict of variable name. [ruby-dev:24662]
-
-Mon Nov  1 11:46:19 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* process.c (rb_f_exec): should check whether prog is NULL.
-
-Mon Nov  1 09:37:19 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker.rb: added entry point of RSS Maker.
-
-Mon Nov  1 03:14:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_get_method_body): store ICLASS in the cache.
-	  [ruby-core:03672]
-
-	* eval.c (rb_provided): should return true for loading library
-	  too for autoloading.  [ruby-core:03655]
-
-Mon Nov  1 01:14:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_open): create copy of popen specifier.  [ruby-dev:24656]
-
-	* string.c (rb_str_locktmp): lock string temporarily.
-
-	* string.c (str_independent): add tmplock check.
-
-	* io.c (io_write): lock output string temporarily.
-	  [ruby-dev:24649]
-
-	* io.c (io_write): use rb_str_locktmp().
-
-	* io.c (read_all): ditto.
-
-Sun Oct 31 23:37:00 2004  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* process.c: on NetBSD don't use setruid() and setrgid().
-
-Sun Oct 31 23:12:10 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker/*.rb: added RSS Maker.
-
-	* test/rss/test_maker_*.rb: added tests for RSS Maker.
-
-Sun Oct 31 16:58:12 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: add WIN32OLE.codepage, WIN32OLE.codepage=.
-
-	* ext/win32ole/tests/testWIN32OLE.rb: ditto.
-
-Sun Oct 31 14:35:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/nkf/nkf-utf8/nkf.c: add "\075?UTF-8?Q?" for Gmail.
-
-Sun Oct 31 14:18:56 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: emit lexer-event values to the parser
-	  (still incomplete).
-
-Sat Oct 30 15:24:41 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: add WIN32OLE_TYPELIB class. add
-	  WIN32OLE#ole_typelib method.
-
-	* ext/win32ole/tests/testOLETYPELIB.rb: add WIN32OLE_TYPELIB class.
-
-Sat Oct 30 06:53:24 2004  Peter Vanbroekhoven  <peter.vanbroekhoven@cs.kuleuven.ac.be>
-
-	* eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
-
-Sat Oct 30 00:19:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_update): a[n,m]=nil no longer works as element
-	  deletion.
-
-	* enum.c (enum_sort_by): protect continuation jump in.
-	  [ruby-dev:24642]
-
-Fri Oct 29 21:27:51 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_check_initialized): new function to check uninitialized
-	  object.  [ruby-talk:118234]
-
-	* file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
-
-Fri Oct 29 19:05:33 2004  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf: follow nkf2.0.
-
-Fri Oct 29 17:18:22 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* parse.y (ripper_s_allocate): add prototype for Microsoft compiler.
-
-	* range.c (range_step, range_each): need cast.
-
-Fri Oct 29 16:34:19 2004  Daiki Ueno  <ueno@unixuser.org>
-
-	* misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
-	line after opening heredoc identifier.  [ruby-dev:24635]
-
-Fri Oct 29 11:35:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (rb_parser_append_print, rb_parser_while_loop): body node
-	  can be empty.  [ruby-dev:24628]
-
-Fri Oct 29 10:00:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_thread_start_0): forget to free some memory chunks.
-	  [ruby-core:03611]
-
-	* eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
-	  should be wrapped by PUSH_TAG/POP_TAG().  [ruby-dev:24627]
-
-Thu Oct 28 08:42:02 2004  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (argf_forward): use ANSI style.
-	  (argf_read): call argf_forward with argv argument.
-	  [ruby-dev:24624]
-
-Wed Oct 27 09:17:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_gsub): use a string object for exception safeness.
-	  [ruby-dev:24601]
-
-Wed Oct 27 07:38:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* node.h (NODE_TYPESHIFT): allow 4 more bits for line numbers.
-	  [ruby-talk:117841]
-
-	* ruby.h (FL_ABLE): nodes are not subject for flag operations.
-
-	* io.c (ARGF_FORWARD): should have specified argv explicitly,
-	  since we no longer have frame->argv saved.  [ruby-dev:24602]
-
-Tue Oct 26 23:30:39 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
-	  Restore correct :nopdoc: behavior with nested classes and modules.
-
-Tue Oct 26 18:21:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (RESIZE_CAPA): check string attribute before modifying
-	  capacity member of string structure.  [ruby-dev:24594]
-
-Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
-
-	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
-	  performance.  [ruby-talk:117701]
-
-Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
-	  arguments, unless (digit)$ style used.
-
-Mon Oct 25 18:35:39 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* win32/win32.c (isUNCRoot): should check NUL after '.'.
-	  [ruby-dev:24590]
-
-	* win32/win32.c (isUNCRoot): fixed buffer overrun.
-
-Mon Oct 25 08:03:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (get_backtrace): ignore illegal backtrace.  [ruby-dev:24587]
-
-Sun Oct 24 00:40:50 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_load, search_required, rb_require_safe, rb_require): use
-	  frozen shared string to avoid outside modification.  [ruby-dev:24580]
-
-Sat Oct 23 23:40:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_fptr_finalize): leave stdin/stdout/stderr open in
-	  interpreter termination.  [ruby-dev:24579]
-
-Sat Oct 23 22:18:32 2004  Guy Decoux  <ts@moulon.inra.fr>
-
-	* eval.c (frame_free): Guy Decoux solved the leak problem.
-	  Thanks.  [ruby-core:03549]
-
-Sat Oct 23 00:20:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
-	  to avoid potential vulnerability.
-
-	* ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
-	  to avoid SEGV.  [ruby-dev:24568]
-
-Fri Oct 22 12:02:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_alias): was warning for wrong condition.
-	  [ruby-dev:24565]
-
-Fri Oct 22 10:36:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
-	  should check if path_info is not nil.
-
-Fri Oct 22 00:22:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/zlib/zlib.c (zstream_shift_buffer): should restore class
-	  field of a buffer.  [ruby-dev:24562]
-
-Fri Oct 22 00:20:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_include): should not treat char as negative value.
-	  [ruby-dev:24558]
-
-Thu Oct 21 19:06:15 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
-	  ensure to close @body. (http://bugs.debian.org/277520)
-
-Thu Oct 21 13:11:31 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (pipe_open): variable name "fpw" is conflicted.
-
-Thu Oct 21 00:36:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_alias): should warn on method discarding.
-	  [ruby-dev:24546]
-
-	* ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
-	  string buffer by clearing klass.  [ruby-dev:24548]
-
-	* parse.y (lex_getline): should not touch ruby_debug_lines if
-	  RIPPER is defined.  [ruby-dev:24547]
-
-Wed Oct 20 19:45:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_gsub): 	reentrant check.  [ruby-dev:24432]
-
-Wed Oct 20 12:42:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_getline): rs modification check should not interfere
-	  in the loop.
-
-Wed Oct 20 10:31:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (lex_getline): should update ruby_debug_lines.
-
-Wed Oct 20 04:17:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
-	  is a string.  [ruby-dev:24490]
-
-	* ext/sdbm/init.c (fsdbm_delete_if): ditto.
-
-Wed Oct 20 01:37:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_times): Array#* should return an instance of
-	  the class of right operand.  [ruby-dev:24526]
-
-	* ext/zlib/zlib.c (zstream_detach_buffer): should not expose
-	  class-less object to Ruby world. [ruby-dev:24530]
-
-	* eval.c (proc_dup): provide Proc#dup as well.  [ruby-talk:116915]
-
-	* eval.c (ruby_exec): stack marking position may be higher than
-	  expected.  thanks to Guy Decoux.  [ruby-core:03527]
-
-Wed Oct 20 00:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (search_required): required name must not be changed before
-	  loading.  [ruby-dev:24492]
-
-Tue Oct 19 23:59:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_require_safe): provide the feature after loaded.
-	  [ruby-list:40085]
-
-Tue Oct 19 22:43:12 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
-	  we come across 'attr' in a context where it isn't
-	  followed by a symbol, just issue a warning.
-
-Tue Oct 19 20:32:50 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole.c(ole_invoke): retrieve the result value when
-	  retrying the IDispatch::invoke.
-
-Tue Oct 19 17:24:11 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (read_all): block string buffer modification during
-	  rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
-
-	* dir.c (rb_push_glob): block call at once the end of method.
-	  [ruby-dev:24487]
-
-	* ext/enumerator/enumerator.c (enum_each_slice): remove
-	  rb_gc_force_recycle() to prevent potential SEGV.
-	  [ruby-dev:24499]
-
-	* ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
-	  buffer by clearing klass.  [ruby-dev:24510]
-
-Tue Oct 19 08:47:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_upto): method result must be checked.  [ruby-dev:24504]
-
-	* eval.c (error_print): ditto.  [ruby-dev:24519]
-
-Mon Oct 18 23:37:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (r_object0): check inheritance by the internal function.
-	  [ruby-dev:24515]
-
-Mon Oct 18 11:29:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_flags_mode, rb_io_mode_flags): distinguish whether file
-	  not existing is created.  [ruby-dev:24505]
-
-Mon Oct 18 07:26:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_truncate): discard read buffer before truncation.
-	  [ruby-dev:24197]
-
-Mon Oct 18 01:56:03 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#initialize):
-	  initial value of accpet-* should be array.
-
-Mon Oct 18 00:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (sock_s_getservbyaname): protocol string
-	  might be altered.  [ruby-dev:24503]
-
-	* string.c (rb_str_upto): check if return value from succ is a
-	  string.  [ruby-dev:24504]
-
-Sun Oct 17 23:03:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
-
-Sun Oct 17 12:53:46 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
-	* ext/win32ole/win32ole.c (fole_get_methods): ditto.
-	* ext/win32ole/win32ole.c (fole_put_methods): ditto.
-	* ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
-	  WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
-
-Sat Oct 16 14:45:28 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
-
-Sat Oct 16 13:42:49 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/: untabified.
-	* test/rss/: untabified.
-	* lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
-
-Sat Oct 16 13:34:56 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss: supported prety print.
-	* test/rss/test_1.0.rb: added test for calculating default indent size.
-
-Sat Oct 16 10:56:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): install-rb is needed for statically
-	  linked extensions.  [ruby-dev:24491]
-
-Fri Oct 15 18:07:08 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509store.c
-	  (ossl_x509stctx_initialize): setup OpenSSL::X509::StoreContext with
-	  ossl_x509stctx_* functions instead of X509_STORE_CTX_*.
-	  (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
-	  (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
-
-	* test/openssl/ossl_x509store.rb: test certificate validity times.
-
-Fri Oct 15 18:04:35 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
-	  acceptable. Add TkTimer.start ( == new + start ).
-
-Fri Oct 15 12:43:09 2004  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (Init_stack): make prototype declaration consistent with
-	  the definition in gc.c.
-
-Thu Oct 14 13:33:59 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb: added link to Tutorial.
-
-Tue Oct 12 21:22:50 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/config.rb:
-	  add WEBrick::Config::FileHandler[:AcceptableLanguages].
-
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#set_filename): search files
-	  having suffix of language-name which Accept-Language header field
-	  includes if :AcceptableLanguages options is present.
-
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
-	  search servlet correspond to the suffix of filename.
-
-	* lib/webrick/httprequest.rb: add attributes access methods: accept,
-	  accept_charset, accept_encoding, accept_language, content_length
-	  and content_type.
-
-	* lib/webrick/httpresponse.rb: add attribute access methods:
-	  content_length, content_length=, content_type and content_type=.
-
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
-	  use the second suffix to detect media type. (the first suffix
-	  may be a language name.)
-
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
-	  add method to parse Accept header field. it returns an Array of
-	  values sorted by the qvalues.
-
-Tue Oct 12 15:05:32 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
-
-Mon Oct 11 17:51:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
-	  avoid mode string modification.  [ruby-dev:24454]
-
-	* io.c (rb_io_getline_fast): should take delim as unsigned char to
-	  distinguish EOF and '\377'.  [ruby-dev:24460]
-
-	* io.c (rb_io_getline): add check for RS modification.
-	  [ruby-dev:24461]
-
-	* enum.c (enum_sort_by): use qsort() directly instead using
-	  rb_iterate().  [ruby-dev:24462]
-
-	* enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
-	  prevent access to recycled object (via continuation for
-	  example).  [ruby-dev:24463]
-
-Mon Oct 11 13:48:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/*: untabify
-
-Sun Oct 10 12:32:08 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
-	  to be used as a variable name
-
-Sun Oct 10 02:49:14 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/lib/ripper/filter.rb: require ripper/tokenizer.
-
-	* ext/ripper/lib/ripper/filter.rb (parse): argument is optional.
-
-Sun Oct 10 02:43:13 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: \n between two comments disappeared.
-
-Sat Oct  9 21:23:37 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/converter.rb: changed to try to use Iconv for default
-	  conversion.
-
-	* lib/rss/rss.rb: 0.0.9 -> 0.1.0.
-
-Sat Oct  9 19:50:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_getline): should not treat char as negative value.
-	  [ruby-dev:24460]
-
-Sat Oct  9 00:25:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (rb_io_fread): rb_thread_wait_fd() was lost.
-	  [ruby-dev:24457]
-
-Fri Oct  8 21:36:56 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_traverse): return value of Dir.entries is
-	  reliable. (pass $SAFE=1)
-
-	* lib/fileutils.rb (remove_dir): return value of Dir.foreach is
-	  reliable. (pass $SAFE=1)
-
-Fri Oct  8 09:49:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): pointer modification check before each
-	  iteration.  [ruby-dev:24445]
-
-Fri Oct  8 01:13:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/optiondb.rb: make it more secure
-
-Thu Oct  7 23:47:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
-	  cannot propagate view port information from the source widget
-	  (that calls 'set') to other assigned widgets.
-
-Thu Oct  7 17:36:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
-	  a Fixnum for 2nd element (it's pid) of the return value.
-
-Thu Oct  7 12:55:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_read): should freeze buffer before thread context
-	  switch. [ruby-dev:24442]
-
-	* pack.c (pack_unpack): string conversion should at the top of the
-	  method.  [ruby-dev:24439]
-
-	* io.c (io_read): buffer should be frozen only after the length
-	  check.  [ruby-dev:24440]
-
-Thu Oct  7 02:56:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c: use FMODE_APPEND.
-
-Thu Oct  7 01:05:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
-
-Thu Oct  7 00:08:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
-	  ALLOCA_N() to prevent modification.  [ruby-dev:24438]
-
-Wed Oct  6 09:21:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_mode_flags): preserve append mode flag.
-	  [ruby-dev:24436]
-
-	* io.c (rb_io_modenum_mode): do not use external output buffer.
-
-	* string.c (rb_str_justify): differ pointer retrieval to prevent
-	  padding string modification.  [ruby-dev:24434]
-
-	* range.c (range_each_func): allow func to terminate loop by
-	  returning RANGE_EACH_BREAK.
-
-	* range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
-
-Tue Oct  5 09:53:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_fopen): mode string copy at the lowest level.
-
-	* io.c (rb_io_flags_mode): requires output buffer no more.  no
-	  allocation needed.
-
-	* array.c (rb_ary_index): takes a block to compare items in an
-	  array.  [ruby-talk:113069] [Ruby2]
-
-	* array.c (rb_ary_rindex): ditto.
-
-Mon Oct  4 14:03:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
-	  while GC.  [ruby-dev:24408]
-
-Mon Oct  4 12:53:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/optiondb.rb: support definition of command
-	  resources on widgets
-
-	* ext/tk/lib/tk/image.rb: bug fix
-
-Sun Oct  3 21:16:05 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
-	version of Microsoft Exchange Server.
-
-	* lib/net/imap.rb (RTEXT_REGEXP): ditto.
-
-	* lib/net/imap.rb (CTEXT_REGEXP): ditto.
-
-Sat Oct  2 20:34:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (local_vars): moved to struct parser_params.
-	  [ruby-dev:24391]
-
-	* parser.y (stmts): remove suspicious NODE_BEGIN.  [ruby-dev:24390]
-
-	* node.h (NEW_DVAR): extra semicolon.
-
-Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (r_byte): retrieve pointer from string value for each
-	  time.  [ruby-dev:24404]
-
-	* marshal.c (r_bytes0): ditto.
-
-	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
-
-	* io.c (io_read): should freeze all reading buffer.
-	  [ruby-dev:24400]
-
-	* string.c (rb_str_sum): should use bignums when bits is greater
-	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
-
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
-
-	* string.c (rb_str_sum): wrong cast caused wrong result.
-	  [ruby-dev:24385]
-
-	* enum.c (enum_sort_by): hide temporary array from
-	  ObjectSpace.each_object.  [ruby-dev:24386]
-
-	* string.c (rb_str_sum): check was done with false pointer.
-	  [ruby-dev:24383]
-
-	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
-
-Fri Oct  1 11:40:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
-	  sourcefile string modification.  [ruby-dev:24373]
-
-	* io.c (io_read): block string buffer modification during
-	  rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
-
-	* io.c (rb_io_s_popen): mode argument may be altered.
-	  [ruby-dev:24375]
-
-	* file.c (rb_file_s_basename): ext argument may be altered.
-	  [ruby-dev:24377]
-
-	* enum.c (enum_sort_by): use NODE instead of 2 element arrays.
-	  [ruby-dev:24378]
-
-	* string.c (rb_str_chomp_bang): StringValue() may change the
-	  receiver.  [ruby-dev:24371]
-
-Fri Oct  1 11:25:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/grid.rb: revive TkGrid.grid
-
-	* ext/tk/lib/tk/pack.rb: revive TkPack.pack
-
-	* ext/tk/lib/tk/place.rb: revive TkPlace.place
-
-Thu Sep 30 00:50:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_init): bug fix
-
-	* ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
-
-	* ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
-
-	* ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
-	  matting pattern argument
-
-Wed Sep 29 10:58:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (sort_by_i): internally used object must not be changed
-	  outside.  [ruby-dev:24368]
-
-Mon Sep 27 21:25:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_call0): invoke finalizers periodically.
-
-	* gc.c (gc_sweep): defer running finalizers.  [ruby-dev:24354]
-
-	* gc.c (rb_gc_finalize_deferred): run deferred finalizers.
-
-Mon Sep 27 15:01:59 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: missing ';'.
-
-Mon Sep 27 13:46:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
-	  accessors.  [ruby-dev:24342]
-
-	* marshal.c (w_object, r_object0): use accessors.
-
-Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_delete): comparison may change the capacity.
-	  [ruby-dev:24348]
-
-	* array.c (rb_ary_fill): fill should honor length argument.
-	  [ruby-dev:24346]
-
-	* array.c (rb_ary_replace): should not use ptr from shared array.
-	  [ruby-dev:24345]
-
-	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
-	  [ruby-talk:113807]
-
-Sun Sep 26 08:05:10 2004  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date.rb: provides {Time,Date,DateTime}#to_{time,date,datetime}.
-
-	* sample/cal.rb: uses getoptlong instead of getopts.
-
-Sat Sep 25 18:39:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (flatten): element size might change during comparison.
-	  [ruby-dev:24343]
-
-Sat Sep 25 01:52:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* struct.c (rb_struct_s_members): wrong call of struct_members.
-	  [ruby-dev:24333]
-
-Fri Sep 24 16:09:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
-	  to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
-
-Fri Sep 24 08:29:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (rb_parser_append_print): should handle prelude.
-	  [llama@u01.gate0]
-
-	* parse.y (rb_parser_while_loop): ditto.
-
-	* array.c (rb_ary_subseq): original object might be modified after
-	  sharing data creation.  [ruby-dev:24327]
-
-	* array.c (rb_ary_replace): ditto.
-
-	* array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
-
-	* struct.c (struct_members): always check struct size and size of
-	  members list in the class.  [ruby-dev:24320]
-
-Thu Sep 23 19:48:14 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/Makefile.dev: removed.
-
-	* ext/ripper/ripper.rb.in: moved to lib/ripper/core.rb.in.
-
-	* ext/ripper/lib/ripper/core.rb: new file.
-
-	* ext/ripper/lib/ripper/core.rb.in: new file.
-
-	* ext/ripper/tools/generate-ripper_rb.rb: change comment.
-
-	* test/ripper/*.rb: on__scan event removed.
-
-	* test/ripper/*.rb: event name is changed: on__XXX -> on_XXX.
-
-Thu Sep 23 09:29:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_sub_bang): check if string is not modified
-	  during iteration.  [ruby-dev:24315]
-
-	* hash.c (rb_hash_rehash): replace st_foreach() by its deep
-	  checking counterpart.  [ruby-dev:24310]
-
-Wed Sep 22 14:21:54 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: on__scan event removed.
-
-	* parse.y [ripper]: event name is changed: on__XXX -> on_XXX.
-
-	* ext/ripper/eventids2.c: ditto.
-
-	* ext/ripper/ripper.rb.in: ditto.
-
-	* ext/ripper/lib/ripper.rb: sync with ripper.rb.in.
-
-	* ext/ripper/lib/ripper/tokenizer: ditto.
-
-	* ext/ripper/lib/ripper/filter: new file.
-
-	* sample/ripper/colorize.rb: new file.
-
-	* sample/ripper/strip-comment.rb: new file.
-
-Wed Sep 22 13:50:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (hash_alloc): was using tbl pointer without
-	  initialization.
-
-Wed Sep 22 13:38:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_hash_rehash): add iteration check.  [ruby-dev:24301]
-
-	* st.c (st_foreach): add deep check.
-
-	* hash.c (rb_hash_fetch): returns KeyError instead of IndexError.
-
-	* hash.c (env_fetch): ditto.
-
-Wed Sep 22 13:02:02 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
-
-Wed Sep 22 09:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y: remove global variables ruby_eval_tree and
-	  ruby_eval_tree_begin.
-
-	* array.c (rb_ary_collect_bang): element size might change during
-	  comparison.  [ruby-dev:24300]
-
-	* array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
-
-	* array.c (rb_ary_eql): ditto. [ruby-dev:24300]
-
-Wed Sep 22 00:11:12 2004  Dave Thomas  <dave@pragprog.com>
-
-	* process.c: Add documentation for fork()
-
-Tue Sep 21 18:29:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_uniq_bang): element size might change during
-	  comparison.  [ruby-dev:24298]
-
-Mon Sep 20 17:46:51 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/lib/ripper/tokenizer.rb: fix typo.
-
-Mon Sep 20 17:38:43 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/ripper/test_scanner_events.rb: tokens must be reordered.
-
-	* ext/ripper/lib/ripper/tokenizer.rb: ditto.
-
-Mon Sep 20 16:58:16 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: do not delay dispatching.
-
-	* ext/ripper/lib/ripper/tokenizer.rb: sort tokens by right order.
-
-Mon Sep 20 15:17:47 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/lib/ripper/tokenizer.rb: new file.
-
-Mon Sep 20 15:13:52 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/ripper/test_scanner_events.rb: test #lineno and #column.
-
-Mon Sep 20 14:50:17 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: delayed heredocument events should be
-	  dispatched after EOF.
-
-Mon Sep 20 14:39:42 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: adjust lineno and columns for multi-line
-	  strings.
-
-	* parse.y [ripper]: delay heredocument events until seeing
-	  end-of-line.
-
-	* parse.y [ripper]: event on__heredoc_contentn ->
-	  on__tstring_content.
-
-	* ext/ripper/eventids2.c: ditto.
-
-	* ext/ripper/lib/ripper.rb: sync with eventids2.c.
-
-	* test/ripper/test_scanner_events.rb: test it.
-
-	* ext/ripper/tools/generate-ripper_rb.rb: show basename of input.
-
-	* ext/ripper/Makefile.dev: support objdir build.
-
-Mon Sep 20 13:22:55 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: remove Ripper#pos.
-
-	* parse.y [ripper]: Ripper#column should return the column of the
-	  current token.
-
-Mon Sep 20 12:02:41 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: unify old_lex_p and token_head.
-
-	* test/ripper/test_scanner_events.rb: now \r\n is saved correctly.
-
-	* parse.y: new macro lex_goto_eol() for next change.
-
-Mon Sep 20 11:01:55 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: adjust line number for heredoc.  [ruby-dev:24272]
-
-Mon Sep 20 04:49:22 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/ripper.rb.in: new const Ripper::PARSER_EVENT_TABLE.
-
-	* ext/ripper/ripper.rb.in: new const Ripper::SCANNER_EVENT_TABLE.
-
-	* ext/ripper/lib/ripper.rb: sync with ripper.rb.in.
-
-Mon Sep 20 04:13:00 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/ripper/test_scanner_events.rb: test spaces before heredoc
-	  mark.
-
-Mon Sep 20 03:46:54 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: spaces before heredoc marker was lost.
-	  [ruby-dev:24272]
-
-	* keywords: rb_reserved_word() should be defined only in ruby
-	  core.  [ruby-dev:24272]
-
-	* lex.c: sync with keywords.
-
-	* ext/ripper/ripper.rb.in (parse): fix typo.
-
-	* ext/ripper/lib/ripper.rb: sync with ripper.rb.in.
-
-Mon Sep 20 03:37:59 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/zlib/zlib.c (gzfile_read_raw): call readpartial at first.
-	  (Zlib::GzipReader#readpartial): new method.
-
-Mon Sep 20 00:24:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* enum.c (enum_sort_by): do not use qsort directly.  use
-	  rb_ary_sort_bang() instead.  [ruby-dev:24291]
-
-	* enum.c (enum_sort_by): pedantic type check added.
-	  [ruby-dev:24291]
-
-	* hash.c (rb_hash_foreach_iter): check iter_lev after each
-	  iteration.  [ruby-dev:24289]
-
-	* array.c (rb_ary_and): element size might change during
-	  comparison.  [ruby-dev:24290]
-
-	* array.c (rb_ary_or): ditto. [ruby-dev:24292]
-
-	* array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
-
-Sat Sep 18 15:02:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_equal): element size might change during
-	  comparison.  [ruby-dev:24254]
-
-	* array.c (rb_ary_diff): ditto. [ruby-dev:24274]
-
-	* array.c (rb_ary_select): ditto. [ruby-dev:24278]
-
-	* array.c (rb_ary_delete): ditto. [ruby-dev:24283]
-
-	* array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
-
-	* array.c (rb_ary_initialize): element size might change during
-	  initializing block.  [ruby-dev:24284]
-
-Sat Sep 18 14:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
-	  the original directory when exception has caused in changing
-	  direcotry or within block.  thanks to Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:03446]
-
-Fri Sep 17 20:29:33 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* parse.y: add prototypes for Microsoft compiler.
-
-	* ext/ripper/depend (parse.obj): lex.c exists at hdrdir.
-
-	* {bcc32,win32,wince}/Makefile.sub (YACC, YFLAGS, parse.c):
-	  use bison.
-
-Fri Sep 17 17:11:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_delete): element comparison might change array
-	  size. [ruby-dev:24273]
-
-	* parse.y: make ruby parser reentrant. merge ripper parser to the
-	  real one.  this change makes ruby require bison.
-
-	* file.c (rb_file_truncate): clear stdio buffer before truncating
-	  the file.  [ruby-dev:24191]
-
-	* ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
-	  which might return singleton class.  [ruby-dev:24202]
-
-Fri Sep 17 16:07:09 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: improve exit operation
-
-Fri Sep 17 15:01:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
-	  (thread_)tkwait
-
-	* ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
-
-	* ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
-	  interpreters (however, the 'real' eventloop must be run on the
-	  Default Master IP)
-
-	* ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
-
-	* ext/tk/sample/remote-ip_sample2.rb: ditto
-
-	* ext/tk/sample/tkoptdb-safeTk.rb: ditto
-
-Thu Sep 16 18:12:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
-	  to request.user attribute.
-
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#initialize): should expand
-	  the pathname of document root directory.
-
-Thu Sep 16 15:49:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_intern): protect string argument from GC.
-	  [ruby-core:03411]
-
-Wed Sep 15 20:22:23 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
-	  of MultiTkIp
-
-Tue Sep 14 23:54:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
-	  the previous changes.
-
-Tue Sep 14 23:45:44 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
-	  Add Eric Hodel's simpleformatter.
-
-Tue Sep 14 22:11:08 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: Add rdoc.
-
-Tue Sep 14 20:24:49 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y [ripper]: space event is on__sp, not on__lwsp.
-	  [ruby-dev:24257]
-
-	* ext/ripper/eventids2.c: ditto.
-
-	* ext/ripper/lib/ripper.rb: ditto.
-
-	* ext/ripper/depend (ripper.o): No action is needed.
-	  [ruby-dev:24260]
-
-	* ext/ripper/depend: Borland make does not accept pipes in
-	  Makefile rules. [ruby-dev:24589]
-
-	* ext/ripper/depend: separate rules for developpers.
-
-	* ext/ripper/Makefile.dev: new file.
-
-	* ext/ripper/MANIFEST: add Makefile.dev.
-
-	* ext/ripper/tools/generate-eventids1.rb: read from file, not
-	  stdin.
-
-	* ext/ripper/extconf.rb: clean ripper.E.
-
-	* ext/ripper/tools/generate-ripper_rb.rb: #include ids1/ids2
-	  function was lost.
-
-	* ext/ripper/tools/generate-ripper_rb.rb: SCANNER_EVENTS wrongly
-	  contained parser events.
-
-	* ext/ripper/lib/ripper.rb: ditto.
-
-Tue Sep 14 16:59:37 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: fix SEGV
-
-	* ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
-
-	* ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
-
-	* ext/tk/sample/safe-tk.rb: new sample script
-
-
-Mon Sep 13 21:33:40 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
-	  second argument to specify the output format (see also
-	   X509_NAME_print_ex).
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
-	  OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
-	  OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
-
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
-	  new module to provide the parse for RFC2253 DN format.
-
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
-	  new method to parse RFC2253 DN format.
-
-Mon Sep 13 19:16:33 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* eval.c (blk_copy_prev): need frame_dup().  [ruby-dev:24103]
-
-Mon Sep 13 16:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
-	  safe-level value argument
-
-Mon Sep 13 10:48:37 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_getpid): don't need to use _getpid() on
-	  mswin32 and mingw32.
-
-Mon Sep 13 10:22:05 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* object.c (nil_inspect): fix typo.
-
-Mon Sep 13 09:29:58 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/depend: (nmake hack) prepend "./" to ripper.c to
-	  avoid {$(srcdir)}.
-
-Mon Sep 13 06:43:42 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper/tools/list-parse-event-ids.rb: does not use getopts.
-
-	* ext/ripper/tools/list-scan-event-ids.rb: ditto.
-
-Mon Sep 13 02:42:28 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/Setup: add ripper.
-
-	* ext/Setup.atheos: ditto.
-
-	* ext/Setup.dj: ditto.
-
-	* ext/Setup.emx: ditto.
-
-	* ext/Setup.nt: ditto.
-
-	* ext/Setup.x68: ditto.
-
-Mon Sep 13 02:26:31 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/ripper: ripper extention added.
-
-	* ext/ripper/MANIFEST: new file.
-
-	* ext/ripper/README: new file.
-
-	* ext/ripper/depend: new file.
-
-	* ext/ripper/extconf.rb: new file.
-
-	* ext/ripper/eventids2.c: new file.
-
-	* ext/ripper/ripper.rb.in: new file.
-
-	* ext/ripper/lib/ripper.rb: new file.
-
-	* ext/ripper/test/check-event-arity.rb: new file.
-
-	* ext/ripper/test/check-event-coverage.sh: new file.
-
-	* ext/ripper/test/check-scanner-event-coverage.rb: new file.
-
-	* ext/ripper/test/list-called-events.rb: new file.
-
-	* ext/ripper/test/src_rb: new file.
-
-	* ext/ripper/test/validate.rb: new file.
-
-	* ext/ripper/tools/generate-eventids1.rb: new file.
-
-	* ext/ripper/tools/generate-param-macros.rb: new file.
-
-	* ext/ripper/tools/generate-ripper_rb.rb: new file.
-
-	* ext/ripper/tools/list-parse-event-ids.rb: new file.
-
-	* ext/ripper/tools/list-scan-event-ids.rb: new file.
-
-	* ext/ripper/tools/preproc.rb: new file.
-
-	* ext/ripper/tools/strip.rb: new file.
-
-	* test/ripper: ripper tests added.
-
-	* test/ripper/dummyparser.rb: new file.
-
-	* test/ripper/test_parser_events.rb: new file.
-
-	* test/ripper/test_scanner_events.rb: new file.
-
-Mon Sep 13 01:03:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
-
-	* ext/tcltklib/tcltklib.c: store original 'exit' command
-
-	* ext/tk/tkutil.c: fix(?) SEGV
-
-Mon Sep 13 00:22:53 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y: fix file header.
-
-Mon Sep 13 00:20:39 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y: ripper merged.
-
-	* lex.c: ditto.
-
-	* keywords: ditto.
-
-Sun Sep 12 23:53:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strdup): remove unnecessary code. (xmalloc never
-	  returns NULL.)
-
-	* util.c (ruby_getcwd): fix memory leak on failure.
-
-Sun Sep 12 02:41:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
-	  allow_ruby_exit=
-
-	* ext/tk/lib/multi-tk.rb: ditto.
-
-	* ext/tk/lib/remote-tk.rb: ditto.
-
-	* ext/tcltklib/MANUAL.euc: ditto.
-
-	* ext/tcltklib/MANUAL.eng: ditto.
-
-	* ext/tcltklib/tcltklib.c: fix some reasons of SEGV
-
-	* ext/tk/tkutil.c: ditto.
-
-	* ext/tk/lib/multi-tk.rb: ditto.
-
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-Sat Sep 11 16:09:46 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
-
-Fri Sep 10 20:18:05 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
-	  pointer conversion.
-
-Fri Sep 10 19:16:24 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: bccwin32 port starts to use RTL dll.
-	  (need to rebuild all) [ruby-dev:24138]
-
-	* win32/win32.{h,c}: ditto.
-
-Fri Sep 10 15:55:59 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mkdir_p): should pass mode argument to
-	  Dir.mkdir. [ruby-dev:24242]
-
-	* test/fileutils/test_fileutils.rb: test it.
-
-Fri Sep 10 02:43:54 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/template/kilmer.rb: James Buck's
-	  patch for call-seq.
-
-Thu Sep  9 13:58:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
-	  'argv' and 'argv0' variable
-
-	* ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
-
-Thu Sep  9 11:46:18 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
-	  spaces aroun parameter to define_method_under (James Buck)
-
-Wed Sep  8 18:44:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
-	  [ruby-dev:24190]
-
-Wed Sep  8 15:19:49 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
-
-	* ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
-	  and error treatment
-
-	* ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
-
-	* ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear,	and
-	  erase
-
-	* ext/tk/lib/tk/text.rb: add TkText#clear and erase
-
-Tue Sep  7 12:48:22 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
-
-	* win32/win32.[ch] (fcntl): ditto.
-
-	* win32/win32.c (rb_w32_connect): support nonblocking mode.
-
-	* ext/socket/socket.c (wait_connectable, ruby_connect): support
-	  nonblocking connect on various platforms.
-
-Mon Sep  6 11:00:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (dir_s_chdir): the patch to shut up false warning when
-	  exception occurred within a block.  a patch was given from Johan
-	  Holmberg <holmberg@iar.se>.  [ruby-core:03292]
-
-Mon Sep  6 10:57:40 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
-
-Mon Sep  6 07:51:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (cvar_cbase): singletons should refer outer cvar scope.
-	  [ruby-dev:24223]
-
-	* eval.c (rb_load): should preserve previous ruby_wrapper value.
-	  [ruby-dev:24226]
-
-Sat Sep  4 01:14:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (cvar_cbase): class variables cause SEGV in
-	  instance_eval() for fixnums and symbols. [ruby-dev:24213]
-
-Fri Sep  3 17:47:58 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* struct.c (make_struct): remove redefining constant when
-	  conflict.  [ruby-dev:24210]
-
-Fri Sep  3 11:31:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
-	  [ruby-dev:24207]
-
-Fri Sep  3 02:12:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
-
-	* ext/tk/lib/tk/text.rb: fix typo
-
-	* ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
-
-Fri Sep  3 01:54:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): extact target prefix from Makefiles.
-
-	* ext/extmk.rb: already built-in libraries satisfy dependencies.
-	  [ruby-dev:24028]
-
-Wed Sep  1 21:16:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tk/lib/tk/spinbox.rb: fix typo
-
-Wed Sep  1 19:28:37 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_proc_exec): label cannot precede variable declarations.
-
-Tue Aug 31 18:20:49 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tk/tkutil.c (cbsubst_init): fix memory leak
-
-	* ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
-
-Tue Aug 31 16:04:22 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
-	  destroy its root widget
-
-Tue Aug 31 12:30:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (del_root): fix SEGV
-
-Mon Aug 30 21:50:14 2004  Dave Thomas  <dave@pragprog.com>
-
-	* object.c: Add RDoc for Module.included.
-
-Mon Aug 30 23:11:06 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
-	  if it finds the same class in multiple places.
-
-Mon Aug 30 22:40:30 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
-
-Mon Aug 30 15:10:46 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
-
-Sun Aug 29 14:08:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
-
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
-
-Sat Aug 28 23:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (rb_big_and): protect parameters from GC.
-	  [ruby-talk:110664]
-
-Fri Aug 27 12:13:50 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/stringio/stringio.c (Init_stringio): add StringIO#readpartial as
-	  an alias for StringIO#sysread.
-
-Fri Aug 27 10:14:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_proc_exec): strip trailing spaces.  [ruby-dev:24143]
-
-	* win32/win32.c (CreateChild): ditto.
-
-Thu Aug 26 04:38:29 2004  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c (return_jump): Minor typo in error message. Now reads
-	  "return can't jump across threads".
-
-Wed Aug 25 15:18:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_longjmp): Exception#to_str is no longer defined.
-
-Wed Aug 25 11:39:10 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* error.c (exc_equal): exceptions are equal if they share same
-	  class, message and backtrace. [ruby-talk:110354]
-
-	* error.c (name_err_mesg_equal): ditto.
-
-Tue Aug 24 16:41:48 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
-	  use a session id as a filename.
-
-	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
-
-	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
-	  Dir::tmpdir.
-
-Tue Aug 24 14:32:17 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
-	  session id after check.
-
-Tue Aug 24 08:57:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
-	  functions may replace the pointer indicated by the first argument.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
-
-Mon Aug 23 12:43:32 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/resolv.rb (Config.default_config_hash): when multiple domains
-	  are set, Win32::Resolv.get_resolv_info returns Array.
-
-Sun Aug 22 16:27:38 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read):
-	  - should return an empty string if specified length to read is 0.
-	  - should check for pending data and wait for fd before reading.
-	  - call underlying IO's sysread if SSL session is not started.
-	  [ruby-dev:24072], [ruby-dev:24075]
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write):
-	  - call underlying IO's syswrite if SSL session is not started.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
-	  OpenSSL::SSL#pending.
-
-	* ext/openssl/lib/openssl/buffering.rb: should not use select.
-
-Sun Aug 22 01:10:36 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
-	  should call :ProxyContentHandler before finishing CONNECT.
-
-Sat Aug 21 06:41:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
-
-	* lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
-	  uniformly.  [ruby-dev:24118]
-
-Fri Aug 20 14:49:42 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* io.c (rb_io_check_writable): no need to check read buffer if
-	  already changed to write mode.
-
-Fri Aug 20 11:46:43 2004  UENO Katsuhiro  <katsu@blue.sky.or.jp>
-
-	* ext/zlib/zlib.c: GzipReader#ungetc caused crc error.
-
-Thu Aug 19 16:29:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
-
-	* ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
-
-	* ext/tk/lib/menu.rb: typo bug.
-
-Thu Aug 19 15:15:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (free_dir): fix memory leak.  reported by yamamoto
-	  madoka.
-
-Thu Aug 19 09:19:27 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* configure.in, win32/Makefile.sub (LIBS): need to link shell32
-	  library for SH* functions on mswin32 and mingw32.
-
-	* wince/Makefile.sub (LIBS): need to link ceshell library for SH*
-	  functions on mswince.
-
-Thu Aug 19 03:07:00 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
-	  fixed problem with extra line feeds at end of folding, whitespace
-	  opening scalar blocks.
-
-	* lib/yaml/rubytypes.rb: subtelties in handling strings with
-	  non-printable characters and odd whitespace patterns.
-
-Wed Aug 18 23:44:20 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/protocol.rb (rbuf_fill): OpenSSL::SSLSocket has its own
-	  buffer, select(2) might not work. [ruby-dev:24072]
-
-Wed Aug 18 17:10:12 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
-	  Tcl_FindExecutable() for Tcl/Tk 8.4.
-
-Wed Aug 18 12:52:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_obj_instance_eval): evaluates under special singleton
-	  classes as for special constants.
-
-Wed Aug 18 11:22:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (init_env): initialize HOME and USER environment
-	  variables unless set.
-
-Wed Aug 18 10:17:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (bind_eval): new method. [RCR 251]
-
-	* string.c (rb_str_clear): new method. [ruby-dev:24104]
-
-Tue Aug 17 17:20:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_reopen): should clear allocated OpenFile.  pointed
-	  out by Guy Decoux. [ruby-core:03288]
-
-Tue Aug 17 01:36:32 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
-	  parsing so RDoc::usage plays better with OptionParser.
-
-Sat Aug 14 02:48:16 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/usage.rb: Added. Allows command line programs
-	  to report usage using their initial RDoc comment.
-
-Sat Aug 14 01:25:48 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/token.c: re2c no longer compiled with bit vectors.  caused
-	  problems for non-ascii characters. [ruby-core:03280]
-	* ext/syck/implicit.c: ditto.
-	* ext/syck/bytecode.c: ditto.
-
-Fri Aug 13 12:55:20 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
-	  fix regex for range-spec.
-
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
-	  multipart/byteranges response was broken.
-
-	* lib/xmlrpc/server.rb: refine example code.
-
-Thu Aug 12 10:54:17 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* rubyio.h (rb_eof_error): should mark as NORETURN.
-
-	* win32/win32.c (make_cmdvector): adjust escaped successive
-	  double-quote handling.
-
-Thu Aug 12 01:53:10 2004  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (read_buffered_data): extracted from rb_io_fread.
-	  (io_readpartial): new method IO#readpartial.
-	  [ruby-dev:24055]
-
-Wed Aug 11 17:17:50 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
-
-Mon Aug  9 15:03:20 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpservlet/erbhandler.rb
-	  (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
-	  by suffix of script filename.
-
-Mon Aug  9 12:51:43 2004  Dave Thomas  <dave@pragprog.com>
-
-	* dir.c (dir_s_glob): Roll in Austin Ziegler's Dir.glob and
-	  fnmatch updates.
-
-Mon Aug  9 06:33:06 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (cp_r): copies symlink to symlink, except
-	  root entries of cp_r.
-
-	* lib/fileutils.rb: new method FileUtils.copy_entry.
-
-	* test/fileutils/test_fileutils.rb: more cp_r tests.
-
-Sun Aug  8 00:43:31 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/implicit.c: added sexagecimal float#base60.
-
-	* ext/syck/rubyext.c (yaml_org_handler): ditto.
-
-	* lib/token.c: indentation absolutely ignored when processing flow
-	  collections.  plain scalars are trimmed if indentation follows in
-	  an ambiguous flow collection.
-
-Sat Aug  7 03:08:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (proc_daemon): new method.  should be modified for
-	  platforms without /dev/null.
-
-Sat Aug  7 00:50:01 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
-
-Wed Aug  4 13:26:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (r_bytes0): optimize out read(0). [ruby-talk:108276]
-
-Tue Aug  3 13:49:12 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/namespace.rb: bug fix
-
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
-
-Mon Aug  2 23:33:48 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/ruby/test_file.rb (test_fnmatch): added more tests.
-
-Mon Aug  2 18:04:21 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
-	  trans_str to the same as src_str when trans_str is not given.)
-
-Mon Aug  2 17:40:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (blk_free): fixed serious memory leak. [ruby-dev:24013]
-
-Mon Aug  2 11:53:06 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
-	  looking up some top level symbols (batsman)
-
-Mon Aug  2 11:48:29 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
-	  variable names to support SWIG generated files (Hans Fugal)
-
-Sat Jul 31 23:08:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (is_defined): stupid mistakes fixed. [ruby-dev:24006]
-
-Sat Jul 31 17:39:47 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
-	  ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
-	  ruby-backward-sexp): keywords must match word-wise.
-
-Sat Jul 31 13:37:51 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (is_defined): avoid unnecessary method invocations.
-
-Sat Jul 31 05:35:37 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: exceptions were using an older
-	  YAML.object_maker. [ruby-core:03080]
-
-	* ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
-	  handline CR-LFs.  "\000" was showing up on folded blocks which
-	  stopped at EOF.
-
-Sat Jul 31 01:25:11 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (is_defined): call is_defined() before invoking
-	  rb_eval().  [ruby-talk:107867]
-
-Fri Jul 30 16:10:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
-	  the unknown encoding name is given.
-
-	* ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
-
-	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
-
-	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
-
-Wed Jul 28 18:59:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
-	  and CGI_COOKIES.  they will no longer be used.
-
-Wed Jul 28 15:44:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): should call rb_call_super() directly for
-	  visibility overriding.  [ruby-dev:23989]
-
-Wed Jul 28 01:04:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* env.h: remove argv from ruby_frame.
-
-	* eval.c (rb_eval): no more copy on write.
-
-	* eval.c (assign): ditto.
-
-	* eval.c (rb_call0): can receive *rest by specifying negative
-	  argc.  (-1 means 0 arg and *rest, -2 means 1 arg and *rest...)
-
-	* eval.c (rb_call0): properly set frame's argc counter.
-
-	* gc.c (rb_gc_mark_frame): need not to mark frame's argv
-
-	* gc.c (run_final): wrong order of data. [ruby-dev:23984]
-
-Tue Jul 27 07:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): copy on write for argument local variable
-	  assignment.
-
-	* eval.c (assign): ditto.
-
-	* eval.c (rb_call0): update ruby_frame->argv with the default
-	  value used for the optional arguments.
-
-	* object.c (Init_Object): "===" calls rb_obj_equal() directly.
-	  [ruby-list:39937]
-
-Mon Jul 26 11:22:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
-	  escape space.
-
-Sun Jul 25 10:56:28 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
-	  {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
-
-	* test/drb/drbtest.rb: fix method duplication.
-
-Sat Jul 24 13:32:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* range.c (rb_range_beg_len): returns Qnil only when "beg" points
-	  outside of a range.  No boundary check for "end".
-
-Fri Jul 23 16:40:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (define_final): should not disclose NODE* to Ruby world.
-	  [ruby-dev:23957]
-
-Fri Jul 23 08:52:22 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (disconnected?): new method.
-
-Thu Jul 22 16:41:54 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
-	  permission of the session data file to 0600.
-
-	* lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
-	  ditto.
-
-Mon Jul 19 00:53:46 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
-	  variable to CGI process on Windows native platforms. [ruby-dev:23936]
-
-Sun Jul 18 16:14:29 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
-	  ( wrong number of argument )
-
-Sun Jul 18 08:13:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): remove extra sign digit.
-
-Sun Jul 18 03:19:14 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* dir.c (bracket): use NULL instead of 0.
-
-Sun Jul 18 02:35:30 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (receive_responses): return if a LOGOUT response
-	received.
-
-Sat Jul 17 23:59:01 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (send_string_data): wait command continuation
-	requests before sending octet data of literals.
-
-Sat Jul 17 23:54:59 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
-
-Sat Jul 17 22:04:44 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
-
-Sat Jul 17 18:29:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt): not to show same error messages twice.
-
-Sat Jul 17 14:18:11 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_match_m): String#match should also take
-	  optional argument.  [ruby-core:03205]
-
-	* re.c (rb_reg_match_m): add optional second argugment "pos" to
-	  specify match start point.  [ruby-core:03203]
-
-Sat Jul 17 13:13:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
-	  process expression interpolation.  [ruby-talk:106691]
-
-Sat Jul 17 05:26:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/diagram.rb: Incorporate Micheal Neumann's
-	  client-side imagemao patch
-
-Sat Jul 17 01:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
-	  [ruby-talk:106657]  The solution was found by Guy Decoux.
-
-Fri Jul 16 22:30:28 2004  Michael Neumann  <mneumann@ntecs.de>
-
-	* file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
-	  #dev_minor. [ruby-core:03195]
-
-Fri Jul 16 11:17:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
-	  [ruby-dev:23913]
-
-	* error.c (exit_success_p): new method SystemExit#success?.
-	  [ruby-dev:23912]
-
-	* error.c (syserr_initialize): initialization for subclasses.
-	  [ruby-dev:23912]
-
-Thu Jul 15 23:53:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
-	  no longer has to_str method.
-
-Thu Jul 15 22:59:48 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/readline/extconf.rb: added dir_config for curses, ncurses,
-	termcap.
-
-Thu Jul 15 20:44:46 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* class.c: rdoc patch
-
-Thu Jul 15 14:12:34 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
-
-	* ext/syck/token.c: re2c compiled with bit vectors now.
-	* ext/syck/implicit.c: ditto.
-	* ext/syck/bytecode.c: ditto.
-
-Thu Jul 15 10:15:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/, ext/tcltklib/: bug fix
-
-	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
-	  callbacks.
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-	* ext/tk/lib/tk/variable.rb: ditto.
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
-	  to define validatecommand methods easier
-
-	* ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
-	  classes
-
-	* ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
-	  check for items (e.g. canvas items; depends on the class) to
-	  avoid some troubles on Tk extension widget class definition.
-
-	* ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
-
-	* ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
-
-
-Wed Jul 14 23:49:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* enum.c (enum_min_by): new method Enum#min_by.  added Enum#max_by
-	  as well.
-
-Wed Jul 14 18:05:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
-	  argument. [ruby-dev:23891]
-
-	* test/openssl/test_x509store.rb: prune tests for CRL checking
-	  unless X509::V_FLAG_CRL_CHECK is defined.
-
-Wed Jul 14 12:20:05 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): should not convert string in the form of
-	  "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
-
-	* test/ruby/test_float.rb (test_strtod): add test for bug fix.
-
-Wed Jul 14 01:20:21 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c: rdoc patch - unified margin.
-
-Wed Jul 14 00:33:48 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c: rdoc patch. merged patch from Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:3170]
-
-Tue Jul 13 19:39:12 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic#merge_path):
-	  "URI('http://www.example.com/foo/..') + './'" should return
-	  "URI('http://www.example.com/')".  [ruby-list:39838]
-	  "URI('http://www.example.com/') + './foo/bar/..'" should return
-	  "URI('http://www.example.com/foo/')".  [ruby-list:39844]
-
-	* test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
-
-Tue Jul 13 15:48:56 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
-	   extmk mode.
-
-	* lib/mkmf.rb (dir_config): Prepend a new library path instead of
-	  appending so it is tried first.
-
-Tue Jul 13 00:50:48 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
-
-Mon Jul 12 21:20:51 2004  Dave Thomas  <dave@pragprog.com>
-
-	* html_generator.rb: Support hyperlinks of the form {any text}[xxx]
-	  as well as stuff[xxx]
-
-Sat Jul 10 09:30:24 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/soap/marshal/test_struct.rb: use qualified build-tin class name
-	  (::Struct) to avoid name crash.
-
-Sat Jul 10 04:21:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
-	  callbacks.
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-	* ext/tk/lib/tk/variable.rb: ditto.
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb (__def_validcmd):  add a module
-	  function of Tk::ValidateConfigure to define validatecommand
-	  methods easier
-
-Fri Jul  9 22:18:59 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
-
-	* numeric.c: rdoc patch.
-
-Fri Jul  9 19:26:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
-	  notice https is not supported.
-
-Fri Jul  9 14:28:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_raise): accept third argument as well as
-	  Kernel#raise, and evaluate the arguments to create an exception in
-	  the caller's context.  [ruby-talk:105507]
-
-Fri Jul  9 01:47:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib : bug fix
-	* ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
-	* ext/tk/lib/tkextlib/itk  : add [incr Tk] support
-	* ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
-	* ext/tk/sample/tkextlib/iwidgets : very simple examples of
-	  [incr Widgets]
-
-Thu Jul  8 19:27:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (rb_cv_stack_end_address): detect stack end address
-	  variable supplied by system.  [ruby-core:03115]
-
-	* gc.c (Init_stack): use system provided address if possible.
-
-Thu Jul  8 00:05:23 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile::initialize): got out code of
-	  generating tmpname.  [ruby-dev:23832][ruby-dev:23837]
-
-Wed Jul  7 02:31:41 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
-	  validation and validation which disregard order of elements.
-	* test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
-	  validation.
-	* test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
-	  name.
-
-Wed Jul  7 00:48:34 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tk/lib/tkextlib/tktrans.rb,
-	  ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
-
-Tue Jul  6 18:38:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib : improve framework of developping Tcl/Tk extension
-	  wrappers
-
-Mon Jul  5 23:56:42 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{trackback,syndication,dublincore,content}.rb: worked
-	  with ruby 1.6 again.
-
-	* test/rss/rss-assertions.rb: ditto.
-
-Mon Jul  5 22:54:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
-
-Mon Jul  5 09:02:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
-	  is a set of bit flags.  [ruby-dev:23859]
-
-Mon Jul  5 01:20:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
-	  the socket whose last-access-time is oldest. (and add new one)
-	  [ruby-dev:23860]
-
-Sun Jul  4 12:24:50 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb: added copyright header.
-
-Sat Jul  3 22:25:27 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* added files:
-	  * lib/soap/header/*
-	  * lib/soap/rpc/httpserver.rb
-	  * lib/wsdl/soap/cgiStubCreator.rb
-	  * lib/wsdl/soap/classDefCreator.rb
-	  * lib/wsdl/soap/classDefCreatorSupport.rb
-	  * lib/wsdl/soap/clientSkeltonCreator.rb
-	  * lib/wsdl/soap/driverCreator.rb
-	  * lib/wsdl/soap/mappingRegistryCreator.rb
-	  * lib/wsdl/soap/methodDefCreator.rb
-	  * lib/wsdl/soap/servantSkeltonCreator.rb
-	  * lib/wsdl/soap/standaloneServerStubCreator.rb
-	  * lib/wsdl/xmlSchema/enumeration.rb
-	  * lib/wsdl/xmlSchema/simpleRestriction.rb
-	  * lib/wsdl/xmlSchema/simpleType.rb
-	  * lib/xsd/codegen/*
-	  * lib/xsd/codegen.rb
-	  * sample/soap/authheader/*
-	  * sample/soap/raa2.4/*
-	  * sample/soap/ssl/*
-	  * sample/soap/swa/*
-	  * sample/soap/whois.rb
-	  * sample/wsdl/raa2.4/*
-	  * test/soap/header/*
-	  * test/soap/ssl/*
-	  * test/soap/struct/*
-	  * test/soap/swa/*
-	  * test/soap/wsdlDriver/*
-	  * test/wsdl/multiplefault.wsdl
-	  * test/wsdl/simpletype/*
-	  * test/wsdl/test_multiplefault.rb
-
-	* modified files:
-	  * lib/soap/baseData.rb
-	  * lib/soap/element.rb
-	  * lib/soap/generator.rb
-	  * lib/soap/netHttpClient.rb
-	  * lib/soap/parser.rb
-	  * lib/soap/property.rb
-	  * lib/soap/soap.rb
-	  * lib/soap/streamHandler.rb
-	  * lib/soap/wsdlDriver.rb
-	  * lib/soap/encodingstyle/handler.rb
-	  * lib/soap/encodingstyle/literalHandler.rb
-	  * lib/soap/encodingstyle/soapHandler.rb
-	  * lib/soap/mapping/factory.rb
-	  * lib/soap/mapping/mapping.rb
-	  * lib/soap/mapping/registry.rb
-	  * lib/soap/mapping/rubytypeFactory.rb
-	  * lib/soap/mapping/wsdlRegistry.rb
-	  * lib/soap/rpc/cgistub.rb
-	  * lib/soap/rpc/driver.rb
-	  * lib/soap/rpc/proxy.rb
-	  * lib/soap/rpc/router.rb
-	  * lib/soap/rpc/soaplet.rb
-	  * lib/soap/rpc/standaloneServer.rb
-	  * lib/wsdl/data.rb
-	  * lib/wsdl/definitions.rb
-	  * lib/wsdl/operation.rb
-	  * lib/wsdl/parser.rb
-	  * lib/wsdl/soap/definitions.rb
-	  * lib/wsdl/xmlSchema/complexContent.rb
-	  * lib/wsdl/xmlSchema/complexType.rb
-	  * lib/wsdl/xmlSchema/data.rb
-	  * lib/wsdl/xmlSchema/parser.rb
-	  * lib/wsdl/xmlSchema/schema.rb
-	  * lib/xsd/datatypes.rb
-	  * lib/xsd/qname.rb
-	  * sample/soap/sampleStruct/server.rb
-	  * sample/wsdl/amazon/AmazonSearch.rb
-	  * sample/wsdl/amazon/AmazonSearchDriver.rb
-	  * test/soap/test_property.rb
-	  * test/soap/calc/test_calc_cgi.rb
-	  * test/wsdl/test_emptycomplextype.rb
-
-	* summary
-	  * add SOAP Header mustUnderstand support.
-
-	  * add HTTP client SSL configuration and Cookies support (works
-	    completely with http-access2).
-
-	  * add header handler for handling sending/receiving SOAP Header.
-
-	  * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
-	    Model.  it caused error.
-
-	  * add WSDL simpleType support to restrict lexical value space.
-
-Sat Jul  3 17:19:44 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
-
-Thu Jul  1 18:36:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tcltklib : bug fix
-
-	* ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
-
-Thu Jul  1 18:31:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/pstore.rb (PStore#transaction): get rid of opening in write mode
-	  when read only transaction.  [ruby-dev:23842]
-
-Thu Jul  1 00:44:42 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
-	  re-implemnt (the arguments for this method is ).
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
-	  OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
-	  OpenSSL::Cipher::Cipher#key_len=.
-
-Wed Jun 30 19:48:09 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
-	  EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
-	  EVP_DigestFinal_ex and EVP_DigestInit_ex.
-
-	* ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
-
-	* ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
-	  EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
-	  OpenSSL 0.9.6.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
-	  ossl_cipher_copy, ossl_cipher_reset, ossl_cipher_encrypt,
-	  ossl_cipher_decrypt, ossl_cipher_final, ossl_cipher_set_key,
-	  ossl_cipher_set_iv): replace all EVP_CipherInit and
-	  EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
-	  and EVP_CIPHER_CTX_init should only be called once.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_set_padding): check for
-	  EVP_CIPHER_CTX_set_padding.
-
-	* ext/openssl/ossl_cipher.c (Init_ossl_cipher): Cipher#<< is deprecated.
-
-	* ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
-	  EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
-	  and EVP_MD_CTX_init should only be called once.
-
-	* ext/openssl/ossl_digest.c (digest_final): should call
-	  EVP_MD_CTX_cleanup to avoid memory leak.
-
-	* ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
-	  into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
-
-	* ext/openssl/ossl_hmac.c (hmac_final): should call
-	  HMAC_CTX_cleanup to avoid memory leak.
-
-	* test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
-	  test/openssl/test_hmac.rb: new file.
-
-Wed Jun 30 16:59:39 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/ruby/test_file.rb (test_fnmatch): some tests for File.fnmatch
-	  are added.
-
-Wed Jun 30 11:38:51 2004  Mikael Brockman <phubuh@phubuh.org>
-
-	* parse.y (primary): should not be NULL.  [ruby-core:03098]
-
-Wed Jun 30 02:41:10 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_emitter_new): set buffer after
-	  Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
-
-Tue Jun 29 10:31:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
-
-	* gc.c (define_final, run_final): preserve and restore safe level for
-	  finalizers.  [ruby-core:03058]
-
-	* signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
-	  safe level for signal handlers.  [ruby-dev:23829]
-
-Mon Jun 28 14:57:56 2004  Jeff Mitchell  <quixoticsycophant@yahoo.com>
-
-	* configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
-	  DOSISH compilers.  [ruby-core:03107]
-
-Mon Jun 28 00:35:29 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
-
-Sun Jun 27 22:36:47 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
-
-Sat Jun 26 15:17:11 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_mod_class_variables): class variables are no longer
-	  inherited.  [ruby-dev:23808]
-
-Sat Jun 26 11:07:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (aix): -b must come at the start of the command line,
-	  and -e must not appear while testing libraries.  [ruby-talk:104501]
-
-	* lib/mkmf.rb (find_header, dir_config): quote directory names if
-	  necessary.  [ruby-talk:104505]
-
-Sat Jun 26 00:13:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_fopen, rb_fdopen, rb_io_reopen): setvbuf() may return
-	  positive value on failure.  [ruby-dev:23792]
-
-Fri Jun 25 18:07:15 2004  Michal Rokos  <michal@ruby-lang.org>
-
-	* gc.c: bring back _stklen for DJGPP [ruby-core:3084]
-
-Fri Jun 25 15:33:01 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/extconf.rb: check stricter.  [ruby-talk:104501]
-
-Fri Jun 25 01:58:01 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
-	  including version.h. [ruby-talk:104456]
-
-Thu Jun 24 14:23:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_fread): return already read data when system call is
-	  interrupted.  [ruby-talk:97206]
-
-Thu Jun 24 01:25:21 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* version.h: added declarations of ruby_version,
-	ruby_release_date, ruby_platform.
-
-Thu Jun 24 01:07:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
-	  should give us packed address, not struct sockaddr.
-	  [ruby-core:03053]
-
-Wed Jun 23 22:19:10 2004  Dave Thomas  <dave@pragprog.com>
-
-	* ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
-	  with OS X not returning 'from' parameter to recvfrom for
-	  connection-oriented sockets.
-
-Wed Jun 23 22:16:16 2004  Michal Rokos  <michal@ruby-lang.org>
-
-	* io.c: io_seek()'s retval should be checked [ruby-core:03045]
-
-Wed Jun 23 21:48:27 2004  Michal Rokos  <michal@ruby-lang.org>
-
-	* time.c: Fix indentation.
-
-	* main.c: Remove _stklen, and _CRT_glob. Move _stacksize for
-	  __human68k__ to gc.c where the others are.
-
-	* gc.c: put _stacksize in place and clean the #ifdefs macros.
-
-Wed Jun 23 17:37:54 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb: added new option --ssl.
-
-Wed Jun 23 01:45:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
-	  Fix problem with the 'r' being dropped from %r{xxx}
-
-Wed Jun 23 00:10:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
-	  CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
-
-Wed Jun 23 00:00:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (return_jump, break_jump): raise unexpected local jump
-	  exception directly.  [ruby-dev:23740]
-
-	* io.c (rb_io_initialize): should check fcntl result.  [ruby-dev:23742]
-
-Tue Jun 22 23:35:43 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): support FZERO and FSPACE with NaN/Inf.
-
-	* test/ruby/test_sprintf.rb (test_nan, test_inf): add tests.
-
-Tue Jun 22 21:11:36 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
-	  dLibraries().
-
-	* ext/win32ole/win32ole.c (ole_event_free): ditto.
-
-	* ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
-	  before CR.
-
-Tue Jun 22 19:24:59 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): unify output of NaN, Inf and -Inf with
-	  "%f" or etc on all platform. [ruby-dev:23704], [ruby-dev:23747]
-
-Tue Jun 22 15:28:12 2004  Michal Rokos  <michal@ruby-lang.org>
-
-	* compar.c: Remove explicit NIL_P() checks since rb_cmpint() does it
-	again in the exactly same manner.
-
-Tue Jun 22 01:32:40 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
-	  empty pkey object if no argument is passed. [ruby-talk:103328]
-
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
-
-	* ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
-	  OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
-	  OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
-	  OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
-
-	* ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
-	  OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
-	  OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
-	  OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
-	  OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
-
-Mon Jun 21 09:24:51 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_opendir): should set errno if error occurs
-	  when calling OS API.
-
-Sun Jun 20 21:12:54 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (binary=): send TYPE commands only once.
-
-Sat Jun 19 13:27:01 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (method_call): allow changing $SAFE.  [ruby-dev:23713]
-
-	* eval.c (proc_set_safe_level, proc_invoke, rb_mod_define_method): not
-	  set $SAFE for methods defined from Proc.  [ruby-dev:23697]
-
-Sat Jun 19 01:10:12 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* sample/rss/tdiary_plugin/rss-recent.rb: added more information.
-
-Fri Jun 18 23:12:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
-	  safe level.
-
-Wed Jun 16 23:05:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_mod_freeze): prepare string representation before
-	  freezing. [ruby-talk:103646]
-
-Wed Jun 16 19:57:24 2004  Michal Rokos  <michal@ruby-lang.org>
-
-	* test/ruby/test_array.rb: extend testcase to check #first, #last,
-	  #shift, #unshift, #pop, #push
-
-Wed Jun 16 16:05:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (ary_new): move alloc behind checks.  [ruby-core:02982]
-
-	* array.c (rb_ary_pop_m, rb_ary_shift_m): take arg to behave as push
-	  and unshift.
-
-	* array.c (rb_ary_first, rb_ary_last): make shared array for result
-	  array, and correct doc for Array#first(n) and Array#last(n)
-
-	* array.c (rb_ary_select): not accept any arg.
-
-Wed Jun 16 16:03:59 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* object.c (rb_class_inherited_p): singleton class inherits Class
-	  rather than its object's class.  [ruby-dev:23690]
-
-Wed Jun 16 16:01:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (stack_grow_direction): memoize the direction.
-
-	* gc.c (Init_stack): should always move to end of VALUE.
-
-Tue Jun 15 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
-
-Mon Jun 14 18:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/remote-tk.rb: bug fix
-
-Sun Jun 13 00:23:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
-
-	* ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
-	                   eliminate warning about instance variable access
-
-	* ext/tk/lib/tk/menubar.rb: improve supported menu_spec
-
-	* ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
-
-	* ext/tk/lib/tk/root.rb: add menu_spec support
-
-	* ext/tk/lib/tk/text.rb: bug fix
-
-	* ext/tk/lib/tk/toplevel.rb: add menu_spec support
-
-	* ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
-
-Sat Jun 12 14:15:20 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c: RDOC for File::FNM_CASEFOLD was missed.
-
-Sat Jun 12 11:15:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (target_os): strip -gnu suffix on Linux.
-
-Fri Jun 11 22:08:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c: remove #indexes, #indices.
-
-	* hash.c: ditto.
-
-	* ext/dbm/dbm.c: remove #indexes, #indices, "values_at" warning
-	  from #select.
-
-	* ext/gdbm/gdbm.c: ditto.
-
-	* ext/sdbm/init.c: ditto.
-
-	* ext/dbm/dbm.c (Init_dbm): set VERSION constant as "unknown" when
-	  DB_VERSION_STRING is not available.
-
-Thu Jun 10 19:19:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
-	  [ruby-talk:103062]
-
-Wed Jun  9 16:09:01 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic::merge,
-	  URI::Generic::route_from): accepts non-hierarchical URI.
-	  [ruby-dev:23631]
-
-	* test/uri/test_generic.rb (TestGeneric::test_route,
-	  TestGeneric::test_merge): added tests for above changes.
-
-Wed Jun  9 15:39:55 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* configure.in: Add support for DragonFly BSD.
-
-Wed Jun  9 15:07:06 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess, config.sub: Update to a more recent version as of
-	  2004-01-20.
-
-Wed Jun  9 11:20:05 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c: remove unused functions and variables.
-
-Wed Jun  2 20:16:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_new4): should share shared instance if it already
-	  exists.  [ruby-dev:23665]
-
-Wed Jun  2 12:41:53 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_gets_m): set lastline ($_) even when read line is
-	  nil.  [ruby-dev:23663]
-
-Fri May 28 11:20:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): bad influence on frame node.
-
-	* eval.c (eval): reverted wrongly removed condition.  [ruby-dev:23638]
-
-Thu May 27 21:37:50 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#initialize): fix pathname initialization
-	  by pathname.
-
-Thu May 27 20:02:09 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
-
-Thu May 27 15:54:02 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
-	Thanks, Rutger Nijlunsing.
-
-Thu May 27 14:53:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
-	  add errno checking.  [ruby-dev:23627]
-
-	* io.c (rb_io_fwrite): should check if errno == ENOENT, too.
-
-Thu May 27 11:25:03 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/csv/test_csv.rb: illegal require module name (../lib/csv.rb).
-
-Wed May 26 23:12:13 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/csv.rb (CSV.read, CSV.readlines): added.  works as IO.read and
-	  IO.readlines in CSV format.
-
-	* lib/csv.rb (CSV.parse): [CAUTION] behavior changed.  in the past,
-	  CSV.parse accepts a filename to be read-opened (it was just a
-	  shortcut of CSV.open(filename, 'r')).  now CSV.parse accepts a
-	  string or a stream to be parsed e.g.
-	  CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
-
-	* test/csv/test_csv.rb: follow above changes.
-
-Wed May 26 14:19:42 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval, eval): make line number consistent on eval with
-	  Proc.  [ruby-talk:101253]
-
-Wed May 26 13:59:17 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
-	  'do' after for statement
-
-Wed May 26 13:56:03 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
-	  relative path to code CSS file
-
-Wed May 26 13:14:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_init_copy): copy also positions.  [ruby-talk:100910]
-
-Wed May 26 00:00:00 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.c (syck_new_parser): clear parser on init.
-	  thanks, ts. [ruby-core:02931]
-
-	* ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
-	  thanks, ts. [ruby-core:02929]
-
-	* lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
-
-Tue May 25 11:54:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_yield_0, proc_invoke, proc_arity): allow passing a block
-	  to a Proc.  [ruby-dev:23533]
-
-	* parse.y (block_par, block_var): ditto.
-
-Tue May 25 01:50:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
-	  workaround for the versions earlier than OpenSSL-0.9.7.
-
-Mon May 24 10:46:26 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
-	  must be absolute URIs
-
-Sun May 23 04:53:50 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* lib/pstore.rb (transaction): allow overriding dump and load.
-	  [ruby-dev:23567]
-
-	* lib/yaml/store.rb: follow lib/pstore.rb's change.
-
-Sat May 22 11:54:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* MANIFEST: add test/openssl/test_x509store.rb.
-
-	* ext/tk/MANIFEST: add recent files.
-
-Sat May 22 05:37:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
-	  on the other processes by Tcl/Tk's 'send' command
-
-Fri May 21 09:22:05 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
-	  Add ()'s around parameters that don't have them
-
-Fri May 21 02:21:11 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/csv.rb: fixed a few bugs around multi char record/field separator.
-
-	* test/csv/test_csv.rb: added boundary test for above feature.
-
-Thu May 20 17:02:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (check_sizeof): define result size.  [ruby-core:02911]
-
-	* lib/mkmf.rb (create_header): macro name should not include equal
-	  sign.
-
-Thu May 20 14:35:52 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c: check SCM_RIGHTS macro addition to
-	  the msg_control field to test existence of file descriptor passing
-	  by msg_control.
-
-Thu May 20 12:38:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (flo_eq): always check if operands are NaN.
-	  [ruby-list:39685]
-
-Thu May 20 12:34:39 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
-	  At Ryan Davis' suggestion, honor visibility modifers if guarded by a
-	  statement modifier
-
-Thu May 20 12:22:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (have_type): do not check pointer to incomplete type,
-	  which always get compiled.
-	  [ruby-list:39683]
-
-Wed May 19 23:45:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/inlinetest.rb (InlineTest::loadtest): requiring library with
-	  replaced $0 can make $0 == __FILE__ block be evaluated twice.
-
-	* test/ruby/envutil.rb (EnvUtil::rubybin): give priority to
-	  environment variable.  [ruby-dev:23538]
-
-Wed May 19 11:08:10 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
-	  private to public
-
-Wed May 19 02:29:36 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: support TRACE.
-
-Wed May 19 02:21:53 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: do not use class variables.
-
-Tue May 18 21:21:43 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/csv.rb: writes lines with "\n" when row separator is not given.
-	  formerly it was "\r\n".
-
-	* lib/csv.rb: [CAUTION] API change
-
-	  * CSV::Row removed.  a row is represented as just an Array.  since
-	    CSV::Row was a subclass of Array, it won't hurt almost all programs
-	    except one which depended CSV::Row#match.
-
-	  * CSV::Cell removed.  a cell is represented as just a String or
-	    nil(NULL).  this change will cause widespread destruction.
-
-      	      CSV.open("foo.csv", "r") do |row|
-		row.each do |cell|
-		  if cell.is_null       # Cell#is_null
-		    p "(NULL)"
-		  else
-		    p cell.data         # Cell#data
-		  end
-		end
-	      end
-
-	    must be just;
-
-	      CSV.open("foo.csv", "r") do |row|
-		row.each do |cell|
-		  if cell.nil?
-		    p "(NULL)"
-		  else
-		    p cell
-		  end
-		end
-	      end
-
-	* lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
-	  change.  CSV.open, CSV.parse, and CSV,generate now do not force
-	  opened file binmode.  formerly it set binmode explicitly.
-
-	  with CSV.open, binmode of opened file depends the given mode
-	  parameter "r", "w", "rb", and "wb".  CSV.parse and CSV.generate open
-	  file with "r" and "w".
-
-	   	  setting mode properly is user's responsibility now.
-
-	* lib/csv.rb: accepts String as a fs (field separator/column separator)
-	  and rs (record separator/row separator)
-
-	* lib/csv.rb: added CSV.foreach(path, rs = nil, &block).  CSV.foreach
-	  now does not handle "| cmd" as a path different from IO.foreach.
-	  needed?
-
-	* test/csv/test_csv.rb: updated.
-
-Tue May 18 14:24:20 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml.rb: added rdoc to beginning of lib.
-
-Tue May 18 14:00:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.h (NEW_DSTR): adjust list length.
-
-	* parse.y (literal_concat): ditto.
-
-Tue May 18 09:30:25 2004  SASADA Koichi  <ko1@atdot.net>
-
-	* eval.c (rb_method_node): search cache entry first.
-
-Mon May 17 16:04:06 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
-	  instead of "0.0e+00". [ruby-dev:23480]
-
-	* numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
-	  outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
-	  is considered, but there is assumption DBL_DIG == 15 in current
-	  implementation)
-
-Mon May 17 10:13:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (setup_domain_and_type): honor duck typing.
-	  [ruby-dev:23522]
-
-	* ext/socket/socket.c (sock_s_getnameinfo): ditto.
-
-Mon May 17 00:36:21 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
-	  of zero at times, which kept some blocks from getting indentation.
-
-Mon May 17 00:07:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/drb/drb.rb: Cosmetic documentation changes.
-
-Sun May 16 20:55:49 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
-	  specify an open flag.
-	  (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
-	  and DBM::NEWDB.
-
-Sat May 15 17:52:24 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/ruby/test_float.rb(test_strtod): Add test for signed 0.000...1
-
-Sat May 15 14:20:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/syck/depend: add ruby's headers.
-
-Sat May 15 13:38:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/syck/MANIFEST, ext/syck/depend: new file.
-
-	* lib/yaml/rubytypes.rb: range of exponential floats.  [ruby-core:02824]
-
-	* test/yaml/test_yaml.rb: tests for strings start with colon and some
-	  round trip.
-
-Sat May 15 12:04:58 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml.rb: removed fallback to pure Ruby parser.
-
-	* lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
-
-	* ext/syck/syck.h: reports style of scalars now, be they plain, block
-	  single-, or double-quoted.
-
-	* ext/syck/syck.c: ditto.
-
-	* ext/syck/gram.c: ditto.
-
-	* ext/syck/node.c: ditto.
-
-	* ext/syck/token.c: ditto.
-
-	* ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
-	  if scalar style is plain.
-
-	* test/yaml/test_yaml.rb (test_perl_regexp): updated test to
-	  match new regexp serialization.
-
-Sat May 15 01:41:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): forgot to restore $SAFE value before evaluating
-	  compiled node.  [ruby-core:02872]
-
-Sat May 15 01:33:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* range.c (range_each_func): terminates loop if generating value
-	  is same to @end.  [ruby-talk:100269]
-
-Fri May 14 22:08:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_new4): should not reuse frozen shared string if
-	  the original is not an instance of String. [ruby-talk:100193]
-
-Fri May 14 21:29:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_mdump): preserve GMT bit in the marshal data.
-	  [ruby-talk:100213]
-
-Fri May 14 18:37:49 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/canvas.rb: improve coords support for canvas
-	  items. Now, supports all of the followings.
-	       TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
-	       TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
-	       TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
-	       TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
-	       TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
-	       TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
-
-Fri May 14 13:30:39 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/ruby/test_float.rb: Add test for util.c revision 1.42.
-
-Fri May 14 12:13:46 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
-	 [ruby-dev:23498]
-
-Thu May 13 15:47:30 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/net/telnet.rb (Net::Telnet::login): "options" can specify
-	  regexps for login prompt and/or password prompt.
-
-Thu May 13 14:17:57 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c (yaml_org_handler): some empty strings were
-	  loaded as symbols.
-
-Thu May 13 11:04:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* pack.c (pack_pack): always add with null for 'Z'.
-
-	* pack.c (pack_unpack): terminated by null for 'Z'.  [ruby-talk:98281]
-
-Wed May 12 19:59:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
-	  [ruby-talk:99788]
-
-Wed May 12 17:41:42 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/resolv.rb (Resolv::DNS::Config): make it configurable without
-	  external file such as /etc/resolv.conf.
-
-Wed May 12 14:37:27 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c: attribute value of DC (short name of
-	  domainComponent) should be IA5String.
-
-Wed May 12 13:20:19 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/composite.rb: improve configure methods (based on
-	  the proposal of [ruby-talk:99671]).
-
-Wed May 12 11:51:08 2004  Dave Thomas  <dave@pragprog.com>
-
-	* class.c (rb_obj_singleton_methods): fix rdoc
-
-Tue May 11 07:09:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (is_defined): do not protect exception during receiver
-	  evaluation.
-
-Mon May 10 22:28:14 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/protocol.rb (each_crlf_line): remove junk line.
-
-Mon May 10 21:44:42 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Change scheme for
-	  looking up symbols in  HTML generator.
-
-Mon May 10 16:45:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): warning during eval should not cause deadlock.
-	  [ruby-talk:98651]
-
-	* eval.c (rb_eval): raise TypeError exception for superclass
-	  mismatch.  [ruby-list:39567]
-
-Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Hack to search parents
-	  for unqualified constant names.
-
-Mon May 10 01:18:15 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/pop.rb (logging): append "\n".
-
-Sun May  9 23:38:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/net/ftp.rb: ported documentation improvement from 1.8 branch
-
-	* lib/net/imap.rb:   ditto
-
-	* lib/net/pop.rb:    ditto
-
-	* lib/net/smtp.rb:   ditto
-
-	* lib/net/telnet.rb: ditto
-
-Sun May  9 23:34:51 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/ruby/test_float.rb: added test_strtod to test Float("0").
-
-Sun May  9 13:24:24 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/yaml/store.rb: use FileUtils::copy.
-
-Sun May  9 12:34:26 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regex.c : removed unused file.
-
-Sat May  8 10:53:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_open): open should not ignore block when "to_open"
-	  method is used.  [ruby-dev:23478]
-
-Fri May  7 22:07:39 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mv): new option `force'. [ruby-talk:99457]
-
-	* lib/fileutils.rb: new method for command option reflection:
-	  FileUtils.commands, .options, .have_option?, .options_of,
-	  .collect_methods.
-
-	* lib/fileutils.rb: module Verbose, NoWrite, DryRun do not have
-	  option flags @fileutils_verbose and @fileutils_noop, they make no
-	  sense.
-
-Fri May  7 21:50:21 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
-	  multiple arguments to 'include'
-
-Fri May  7 21:03:51 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
-	  [ruby-core:02843]
-
-	* test/fileutils/test_fileutils.rb (mkdir): test "\n" in path.
-
-Fri May  7 20:53:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dbm/dbm.c (fdbm_modify): typo fixed. [ruby-dev:23473]
-
-Fri May  7 11:17:27 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): "0.0000000000000000001" should be converted
-	  to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
-	  [ruby-talk:99318] [ruby-dev:23465]
-
-Thu May  6 22:27:32 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
-	  hostname.
-
-Thu May  6 22:09:29 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
-
-Thu May  6 14:22:29 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
-	  for Ranges, Strings, Structs, Regexps.
-
-	* lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
-	  String's flow style.
-
-	* lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
-
-	* ext/syck/gram.c: fixed transfer methods on structs, broke it
-	  last commit.
-
-Thu May  6 14:38:02 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (rb_push_glob): simplified code (not change behavior)
-
-Thu May  6 13:32:44 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: get rid of side effect of Config.expand, patched by
-	  <tttt01@infoseek.jp>  (ruby-bugs:PR#597)
-
-Thu May  6 11:40:28 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (string): accept NIL.
-
-	* lib/net/imap.rb (body_type_basic): allow body-fields omissions.
-
-Thu May  6 01:59:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
-	  Don't include the &block parameter if we have explicit
-	  yield parameters.
-
-Wed May  5 03:52:31 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/ring.rb: use recv instead of recvfrom.
-
-Wed May  5 00:38:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/gserver.rb: documented
-	* lib/xmlrpc/README.txt: introduced for documentation purposes
-
-Mon May  3 09:47:24 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
-	  Fix parsing bug if yield called within 1 line block
-
-Sun May  2 21:56:48 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb (rm_f, rm_r): test :force flag.
-
-Sun May  2 01:04:38 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib, ext/tk: renewal Ruby/Tk
-
-Fri Apr 30 20:08:41 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
-
-Wed Apr 28 01:26:11 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* oniguruma.h, regparse.c: imported Oni Guruma 2.2.8.
-
-Wed Apr 28 01:16:23 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* oniguruma.h, regparse.c: imported Oni Guruma 2.2.7.
-
-Tue Apr 27 14:43:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk: LIBURUBY_A is needed for extconf.rb even when
-	  cross-compiling.
-
-Tue Apr 27 13:33:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (string_content): turn off NODE_NEWLINE flag to avoid
-	  unnecessary line trace for inlined expression.
-	  (ruby-bugs PR#1320)
-
-Tue Apr 27 08:15:13 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: passing Range tests.
-
-	* ext/syck/syck.h: version 0.44.
-
-	* ext/syck/gram.c: transfers no longer open an indentation.
-	  fixed transfers which precede blocks.
-
-	* ext/syck/token.c: ditto.
-
-	* ext/syck/syck.c: fixed segfault if an anchor has been released already.
-
-	* ext/syck/node.c (syck_free_members): organized order of free'd nodes.
-
-	* ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
-	  StringValue.
-
-Mon Apr 26 23:56:54 2004  Daniel Kelley  <news-1082945587@dkelley.gmp.san-jose.ca.us>
-
-	* README.EXT, README.EXT.ja: fixed wrong function signature.
-	  [ruby-talk:98349]
-
-Mon Apr 26 21:40:09 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
-	  to instance methods.
-
-Sun Apr 25 18:26:23 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (ac_cv_func_fork): set to no on DJGPP.
-
-Sat Apr 24 14:32:03 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* re.c: applied stack error handling patch. [ruby-dev:23431]
-
-Sat Apr 24 10:38:31 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
-	  Fix bug where consecutive headings are merged.
-
-Fri Apr 23 23:24:47 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb: $hdrdir should not contain macros, for backward
-	  compatibility.  [bruby-dev:28]
-
-	* lib/mkmf.rb (create_makefile): in the case of extout, just copy
-	  script files, without comparison.
-
-Fri Apr 23 16:38:46 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: sync taint/freeze flag between
-	  a pathname object and its internal string object.
-
-Fri Apr 23 14:52:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt, arg, aref_args): should not make sole splat into
-	  array, in aref_args other than aref with op_asgn.
-
-Fri Apr 23 14:14:38 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/resolv.rb: don't use Regexp#source to embed regexps.
-	  [ruby-dev:23432]
-
-Thu Apr 22 18:25:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk, ext/extmk.rb: make ext and .ext get removed by distclean.
-
-Thu Apr 22 10:07:01 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* */Makefile.sub (distclean-local): should remove $(RBCONFIG).
-
-Thu Apr 22 04:17:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_mod_define_method): allow binding methods to modules.
-	  [ruby-dev:23410]
-
-	* parse.y (aref_args): should pass expanded list.  [ruby-core:02793]
-
-Thu Apr 22 01:12:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (flo_to_s): tweak output string based to preserve
-	  decimal point and to remove trailing zeros.  [ruby-talk:97891]
-
-	* string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
-	  search.  [ruby-talk:97342]
-
-Wed Apr 21 23:04:42 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
-
-Wed Apr 21 20:05:00 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
-	  [ruby-list:39542]
-
-Wed Apr 21 18:39:46 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/smtp.rb: merge SMTP-TLS patch.  This patch is
-	  contributed by Daniel Hob. [ruby-core:02789]
-
-Wed Apr 21 18:23:45 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/smtp.rb: change coding style: def m( a ) -> def m(a).
-
-Wed Apr 21 18:01:47 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/pop.rb: do not use class variables.
-
-	* lib/net/pop.rb (do_start): ensure to clean up connection when
-	  authentication failed.
-
-Wed Apr 21 17:23:59 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (HTTP#connect): CONNECT must precede SSL connect.
-	  [ruby-dev:23379]
-
-	* lib/net/http.rb (HTTP.new): class variables are not inherited
-	  now.
-
-Wed Apr 21 15:56:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/ui/console/testrunner.rb (test_started): restore $0
-	  after changing process title.  [ruby-talk:97426]
-
-Wed Apr 21 11:45:22 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* process.c: Recover wrongly removed spaces at end of the lines.
-
-Wed Apr 21 10:18:06 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* process.c(rb_spawn): fix SEGV at "p system('command line here')"
-	 (may happen only in bccwin32) [ruby-dev:23380]
-
-Mon Apr 19 20:58:44 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c: Updated RDocs.
-
-Mon Apr 19 18:11:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_hash_equal): returns true if two hashes have same set
-	  of key-value set.  [ruby-talk:97559]
-
-	* hash.c (rb_hash_eql): returns true if two hashes are equal and
-	  have same default values.
-
-Mon Apr 19 08:19:11 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
-
-	* dln.c, io.c, pack.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb,
-	  lib/date.rb, lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb,
-	  lib/matrix.rb, lib/monitor.rb, lib/set.rb, lib/thwait.rb,
-	  lib/timeout.rb, lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb,
-	  lib/net/ftp.rb, lib/net/http.rb, lib/net/imap.rb, lib/net/pop.rb,
-	  lib/net/telnet.rb, lib/racc/parser.rb, lib/rinda/rinda.rb,
-	  lib/rinda/tuplespace.rb, lib/shell/command-processor.rb,
-	  lib/soap/rpc/soaplet.rb, lib/test/unit/testcase.rb,
-	  lib/test/unit/testsuite.rb: typo fix.
-
-Mon Apr 19 08:14:18 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
-	  #ifdef HAVE_PROTOTYPES
-
-Fri Apr 16 17:04:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_equal): always returns true or false, never
-	  returns nil. [ruby-dev:23404]
-
-Fri Apr 16 12:38:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/drb/drb.rb (DRb::DRbUnknown::initialize): Exception#to_str is
-	  deprecated.
-
-	* lib/drb/drb.rb (DRb::DRbServer::InvokeMethod::perform): multiple
-	  value class changed.
-
-	* lib/drb/invokemethod.rb (DRb::DRbServer::InvokeMethod18Mixin::block_yield):
-	  ditto.
-
-Fri Apr 16 08:27:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: skip linking when libraries to be preloaded not
-	  compiled.  [ruby-list:39561]
-
-Thu Apr 15 19:57:11 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (pst_success_p): new method Process::Status#success?.
-	  [ruby-dev:23385]
-
-	* rubytest.rb: do nothing while cross-compiling, return status in
-	  system independent style.
-
-Thu Apr 15 19:26:54 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (rb_push_glob): Dir.glob() should return nil if block is given.
-	  (http://www.ruby-lang.org/ja/man/index.cgi?cmd=view;name=Dir)
-
-	* dir.c (push_braces): Dir.glob() should handle '{ }' nested more than
-	  3 times.
-
-	* dir.c (push_braces, rb_push_glob): Dir.glob() should handle escaped
-	  '{' and '}' and ','.
-
-	  [ruby-dev:23376]
-
-Thu Apr 15 17:12:13 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
-	  GDBM::WRCREAT and GDBM::NEWDB.
-	  (fgdbm_initialize): use specified read/write flag.
-
-Wed Apr 14 13:06:09 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
-
-	* array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
-	  process.c, re.c, string.c: typos in RDoc comments.  [ruby-core:02783]
-
-Wed Apr 14 11:29:56 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* numeric.c (flo_eq): workaround for bcc32's bug.
-	  (ruby-bugs-ja:PR#594)
-
-Wed Apr 14 11:06:38 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
-	  behavior of :enddoc: -- it now unconditionally terminates
-	  processing of the current file.
-
-Wed Apr 14 10:57:40 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* defines.h: include <net/socket.h> to get fd_set definition in BeOS.
-
-Tue Apr 13 23:00:55 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: change pattern matching.
-	  a === b -> a == b || a === b. [druby-ja:98]
-
-	* test/rinda/test_rinda.rb: ditto.
-
-Tue Apr 13 21:50:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bcc32/Makefile.sub (PHONY): Borland make disallows empty command
-	  rules.
-
-Tue Apr 13 17:55:16 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (begin_transport): should not overwrite HTTP
-	  request header. [ruby-list:39543]
-
-Tue Apr 13 16:48:00 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/pop.rb: merge POP3S patch.  This patch is contributed by
-	  Daniel Hobe.
-
-Tue Apr 13 02:56:29 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* common.mk: changed the order of ascii.c alphabetically.
-
-Mon Apr 12 19:11:21 2004  Eric Hodel  <drbrain@segment7.net>
-
-	* gc.c (rb_gc_copy_finalizer): typo.  [ruby-core:02774]
-
-Mon Apr 12 18:45:58 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
-	  a value.
-
-Mon Apr 12 10:39:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (rb_glob2, rb_glob, push_globs, push_braces, rb_push_glob):
-	  fix memory leak. (leaked when block was interrupted)
-
-Sun Apr 11 19:10:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (require_libraries): restore source file/line after
-	  statically linked extensions initialized.  [ruby-dev:23357]
-
-Sun Apr 11 10:47:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
-	  classes and modules are a special case too... (handle extending existing
-	  classes with or without :enddoc:)
-
-Sat Apr 10 23:51:13 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
-	  made one too many assumptions...
-
-Sat Apr 10 00:00:19 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup/inline.rb: Fix problem
-	  with \_cat_<b>dog</b>
-
-Fri Apr  9 17:05:21 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (has_magic, find_dirsep): incomplete '[' matches no character
-	  in Dir.glob. (follows File.fnmatch's behavior)
-
-	* dir.c (fnmatch_helper): incomplete escape is ignored in File.fnmatch.
-	  (follows Dir.glob's behavior)
-
-	* dir.c (find_dirsep): '/' between '[' and ']' is ignored in Dir.glob.
-	  (follows File.fnmatch with File::FNM_PATHNAME 's behavior)
-
-	* dir.c (find_dirsep): escaped slash '\/' loses its meaning as
-	  directory separator in Dir.glob.
-
-	  [ruby-dev:23291]
-
-Thu Apr  8 20:25:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): skip uncompiled extensions.
-
-	* lib/mkmf.rb (create_makefile): emit no rules for static library if
-	  $static is nil, e.g., outside of ext/.
-
-	* lib/test/unit/ui/console/testrunner.rb (test_started): show test
-	  name via $0.
-
-	* runruby.rb: set environments to use the compiled binary.
-
-	* test/runner.rb: do nothing while cross-compiling.
-
-	* test/drb/drbtest.rb, test/soap/calc/test_calc_cgi.rb: use envutil to
-	  know ruby binary, and restore $: after require.
-
-	* test/ruby/envutil.rb: give priority to RUBY environment variable to
-	  use just compiled binary and libraries.
-
-Thu Apr  8 19:03:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_binmode): inverted condition.  [ruby-dev:23349]
-
-Thu Apr  8 18:22:00 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_s_list): return encoding list if no block
-	  is given.  [ruby-dev:23063]
-
-Wed Apr  7 15:29:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): use NUM2INT() instead of num2i32().
-
-Wed Apr  7 12:32:02 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/parser.rb, lib/rss/1.0.rb: accepted rdf:resource or
-	  resource attribute in rdf:li.
-	* test/rss/test_parser.rb: added test for above change.
-
-	* lib/rss/dublincore.rb: reverted style.
-
-	* lib/rss/xmlparser.rb: normalized XMLParser class hierarchy.
-
-Wed Apr  7 10:43:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in, common.mk, */Makefile.sub (ext/extinit.o): OUTFLAG
-	  doesn't work for object files on VC.
-
-	* */Makefile.sub (config.h): need SIZEOF_TIME_T now.
-
-Wed Apr  7 00:24:34 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: fix hash tuple bug.
-
-	* lib/rinda/tuplespace.rb: ditto.
-
-	* test/rinda/test_rinda.rb
-
-Tue Apr  6 18:24:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (rb_get_path): get path string via "to_path" method if
-	  path object is not a string. [Ruby2]
-
-	* gc.c (rb_gc_call_finalizer_at_exit): do not free threads in the
-	  exit finalizers.
-
-	* io.c (rb_io_reopen): should use rb_io_check_io().
-
-Tue Apr  6 16:46:09 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: check the size of time_t.
-
-	* time.c (time_add): new function.
-	  (time_plus): use time_add.
-	  (time_minus): use time_add.
-
-Tue Apr  6 13:11:48 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (raise_socket_error): never return.
-
-	* ext/socket/socket.c (make_hostent): must return value.
-
-Tue Apr  6 00:14:43 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* error.c (Init_Exception): remove Exception#to_str. [Ruby2]
-
-	* eval.c (error_print): should no call "to_str" anymore use
-	  "message" method instead.
-
-	* io.c (rb_f_open): Kernel#open() calls "to_open" if the first
-	  argument responds to it. [Ruby2]
-
-Tue Apr  6 00:13:43 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: add require 'drb/drb'
-
-Mon Apr  5 22:25:32 2004  Tanaka Akira  <akr@m17n.org>
-
-	* test/zlib/test_zlib.rb: new file.
-	  (TestZlibGzipWriter#test_new_nil): test for [ruby-dev:23228].
-
-Mon Apr  5 22:16:23 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* parse.y (assoc_list): {a: 1, b: 2} should be allowed.
-	  [ruby-dev:23328]
-
-Mon Apr  5 19:43:40 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regexec.c: imported Oni Guruma 2.2.6.
-
-Mon Apr  5 19:39:10 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* regparse.c, oniguruma.h: imported Oni Guruma 2.2.6.
-
-Mon Apr  5 12:12:09 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (raise_socket_error): some platforms don't have
-	  EAI_SYSTEM.
-
-Mon Apr  5 08:18:23 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
-	  references work properly.
-
-Sun Apr  4 14:01:20 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/options.rb (Options::parse): Allow multiple -x options to
-	  RDoc. Fix bug where files weren't being excluded properly
-
-Sat Apr  3 09:36:38 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.h: version 0.43.
-
-Sat Apr  3 08:28:47 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/lib/gram.c: allow root-level inline collections.
-	  [ruby-talk:94922]
-
-	* lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
-	  [ruby-talk:94930]
-
-Fri Apr  2 19:28:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bcc32/Makefile.sub (OUTFLAG): needed for static-linked-ext.
-
-Fri Apr  2 18:00:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): extract necessary variables for static link
-	  from Makefile.
-
-	* lib/mkmf.rb (create_makefile): save preload and libpath for next
-	  compile.
-
-Fri Apr  2 17:27:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (top_include): include in the wrapped load is done for
-	  the wrapper, not for a singleton class for wrapped main.
-	  [ruby-dev:23305]
-
-Fri Apr  2 15:13:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (rb_big_eq): use temporary double variable to save the
-	  result (internal float register may be bigger than 64 bits, for
-	  example, 80 bits on x86).  [ruby-dev:23311]
-
-Fri Apr  2 14:35:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (block_pass): should generate unique identifier of the
-	  pushing block.  [ruby-talk:96363]
-
-Fri Apr  2 11:36:20 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* eval.c (Init_load): make $LOADED_FEATURES built-in.
-	  [ruby-dev:23299]
-
-	* ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
-
-	* lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
-
-Fri Apr  2 07:31:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c: mistakingly removed do_not_reverse_lookup.
-	  [ruby-list:39475]
-
-	* ext/socket/socket.c (make_hostent): fix memory leak, based on
-	  the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
-
-Thu Apr  1 22:55:33 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
-	  =begin rdoc/=end
-
-	* lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
-	  top-level method being taken as file comment.
-
-Thu Apr  1 22:55:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
-
-Thu Apr  1 19:58:37 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
-	  object with soap/marshal.
-	  added URIFactory class for URI mapping.  BasetypeFactory checks
-	  instance_variables when original mapping is not allowed (ivar must
-	  be empty).  Instance of URI have instance_variables but it must be
-	  llowed whenever original mapping is allowed or not.
-
-Wed Mar 31 19:06:23 2004  Tanaka Akira  <akr@m17n.org>
-
-	* time.c (year_leap_p): new function.
-	  (timegm_noleapsecond): ditto.
-	  (search_time_t): use timegm_noleapsecond instead of
-	  mktime for first guess.
-
-Wed Mar 31 12:05:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/delegate.rb (DelegateClass): define internal methods of the
-	  result class, but not metaclass of the caller.  [ruby-talk:96156]
-
-	* intern.h: provide proper prototypes.  [ruby-core:02724]
-
-	* ruby.h: missing.h is now prerequisite to intern.h.
-
-Wed Mar 31 11:17:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): raises RangeError if uv is out of UTF8 value
-	  range.  [ruby-dev:23281]
-
-	* io.c (rb_io_binmode): stdio buffer should be empty when calling
-	  IO#binmode.  [ruby-talk:96155]
-
-Tue Mar 30 20:25:34 2004  Tanaka Akira  <akr@m17n.org>
-
-	* time.c (search_time_t): limit guess range by mktime if it is
-	  available.  [ruby-dev:23274]
-
-Tue Mar 30 18:19:00 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): fix SEGV at retry in iterator's receiver.
-	  [ruby-dev:23227]
-
-Mon Mar 29 20:17:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_exec): follow older behavior if close-on-exec is not
-	  available.
-
-	* process.c (rb_fork): protect from exceptions while waiting failed
-	  process, if status is given.
-
-Sun Mar 28 16:25:37 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* cygwin/GNUmakefile.in (clean-local, distclean-local): remove
-	  work files.
-
-	* win32/Makefile.sub (clean-local): ditto.
-
-Sun Mar 28 14:23:02 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/pop.rb: def m( arg ) -> def m(arg).
-
-Sun Mar 28 14:09:13 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/pop.rb (auth): failed when account/password include "%".
-	  [ruby-talk:95933]
-
-Sat Mar 27 21:40:41 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb: permit extra semicolon in content-type field.
-
-Sat Mar 27 10:40:48 2004  Tanaka Akira  <akr@m17n.org>
-
-	* (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
-	  instead of PrettyPrint.
-
-Sat Mar 27 01:47:09 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/logger.rb: trim tail space of each line.  no user visible change.
-
-	* lib/rss/dublincore.rb: fixed class definition mismatch.
-
-	* sample/openssl/gen_csr.rb: fixed wrong usage text.
-
-Thu Mar 25 23:15:24 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
-	  Add --version option
-
-Thu Mar 25 21:45:00 2004  Shigeo Kobayashi <shigek@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c: Bug in + and - reported by Bret Jolly
-	  fixed.
-
-Thu Mar 25 21:01:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* version.c (ruby_show_copyright): obtain copyright year from
-	  RUBY_RELEASE_YEAR.
-
-	* win32/resource.rb: ditto.
-
-Thu Mar 25 19:37:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
-	  include them.
-
-	* win32/resource.rb: include winver.h for older WindowsCE.
-
-Thu Mar 25 14:01:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk, */Makefile.sub (lib, dll): phony targets.
-
-	* configure.in (ruby, miniruby): ditto.
-
-	* cygwin/GNUmakefile.in (rubyw): ditto.
-
-Thu Mar 25 04:16:18 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
-	  which dumps our all known names
-
-Thu Mar 25 03:57:47 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
-	  allow nested classes to be designated using "."--you must
-	  now use "::"
-
-Thu Mar 25 02:00:18 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/template/html/one_page_html.rb (Page):
-	  Fix to work with C modules.
-
-Wed Mar 24 20:49:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
-	* lib/uri/common.rb: Ditto.
-	* lib/uri/ftp.rb: Ditto.
-	* lib/uri/generic.rb: Ditto.
-	* lib/uri/http.rb: Ditto.
-	* lib/uri/https.rb: Ditto.
-	* lib/uri/ldap.rb: Ditto.
-	* lib/uri/mailto.rb: Ditto.
-
-Wed Mar 24 18:48:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
-	  DESTDIR after installed.
-
-	* lib/mkmf.rb (dummy_makefile): default file lists to be cleaned.
-
-Wed Mar 24 12:32:56 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
-	  Don't document methods if we don't know for sure the
-	  class or module.
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Don't store documentation for singleton classes if we
-	  don't know the real class.
-
-Wed Mar 24 11:11:26 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
-	  Allow non-RDoc templates by putting a slash in the template name
-
-Wed Mar 24 10:05:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile::_close): should not clear @tmpname
-	  until the file is really removed. [ruby-core:02684]
-
-Wed Mar 24 04:12:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_mod_cvar_get): new method Module#class_variable_get.
-
-	* object.c (rb_mod_cvar_set): ditto (Module#class_variable_set).
-
-Tue Mar 23 17:45:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_thread_atfork): 1.9 warns no more for thread
-	  termination.  [ruby-dev:23212]
-
-Tue Mar 23 14:46:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in, */Makefile.sub, common.mk (clean-local, distclean-local):
-	  separate files under directories due to directory separator.
-
-	* */Makefile.sub (MKFILES): common.mk and */Makefile.sub should not be
-	  removed.
-
-	* win32/Makefile.sub, wince/Makefile.sub: $* cannot appear in explicit
-	  rules.
-
-	* cygwin/GNUmakefile.in: some mingw stuffs were missed.
-
-	* lib/mkmf.rb (create_makefile): Borland make wrongly removes braces
-	  from command lines.
-
-	* bcc32/Makefile.sub: needs bcc32/mkexports.rb.
-
-Mon Mar 22 08:21:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in, */Makefile.sub, common.mk: extract common portions.
-
-	* Makefile.in, cygwin/GNUmakefile.in, */Makefile.sub (RBCONFIG):
-	  separated time stamp file for rbconfig.rb.
-
-	* configure.in: append common.mk to Makefile.
-
-	* mkconfig.rb: keep mtime of rbconfig.rb if unchanged.
-
-	* win32/rm.bat: remove multiple files.
-
-	* wince/mkconfig_wce.rb: use fake.rb instead.
-
-Sun Mar 21 22:17:35 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host):
-	  sort @virtual_hosts in address, port, host order.
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#lookup_server):
-	  hostname should not be match if :ServerAlias is not given.
-
-Sun Mar 21 21:11:16 2004  Keiju Ishitsuka  <keiju@ishitsuka.com>
-
-	* lib/shell/*: bug fix for Shell#system(command_line_string).
-
-Sun Mar 21 21:04:42 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ruby.1: add -width option to .Bl for old groff.
-
-Sun Mar 21 18:57:37 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* test/rss/*: Test::Unit::TestCase -> RSS::TestCase and
-	  Test::Unit::Assertions -> RSS::Assertions.
-
-Sun Mar 21 18:48:20 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{rss,dublincore,syndication}.rb: handled W3CDTF correctly.
-
-Sun Mar 21 18:15:29 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* test/rss/test_xml-stylesheet.rb: added tests for xml-stylesheet.
-
-	* lib/rss/xml-stylesheet.rb: added xml-stylesheet parsing
-	  function.
-
-Sat Mar 20 23:51:03 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* eval.c (rb_require_safe): preserve old ruby_errinfo.
-	  [ruby-talk:95409]
-
-	* eval.c (rb_f_raise): should not clear backtrace information if
-	  exception object already have one.
-
-Sat Mar 20 21:21:03 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/extmk.rb: rm -rf $extout, not extout.
-
-Sat Mar 20 15:25:36 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
-	  page background to white.
-
-Sat Mar 20 09:33:36 2004  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
-	  part of second minute that follows a comma or a full stop.
-
-Fri Mar 19 21:06:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (assoc_list): allow {sym: val} style Hash. [Ruby2]
-	  this change is done by Nobuyoshi Nakada <nobu@ruby-lang.org>.
-
-Fri Mar 19 15:15:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_cvar_set): class variables become private to the
-	  particular class/module. [Ruby2]
-
-	* variable.c (rb_cvar_get): ditto.
-
-	* variable.c (rb_cvar_defined): ditto.
-
-Fri Mar 19 11:31:32 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb ($beos, $solaris): add OS flags.
-
-	* lib/mkmf.rb (RUBY): / is not recognized as path separator on
-	   nmake/bmake. [ruby-list:39388]
-
-	* lib/mkmf.rb (CLEANLIBS, CLEANOBJS): should remove *.exp with *.so.
-
-Fri Mar 19 01:55:57 2004  Mauricio Fernandez  <batsman.geo@yahoo.com>
-
-	* io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
-
-Thu Mar 18 19:47:44 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* instruby.rb, rubytest.rb: do not depend on srcdir.
-
-Thu Mar 18 18:50:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* mkconfig.rb: no longer embed srcdir and compile_dir into
-	  rbconfig.rb.
-
-	* ext/extmk.rb, lib/mkmf.rb: obtain top_srcdir and topdir from library
-	  paths.
-
-Thu Mar 18 17:46:35 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: do not undef :to_a.
-
-Thu Mar 18 16:22:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_eq): avoid false positive by using scope and
-	  dyna_vars.  no longer use frame.uniq.
-
-	* eval.c (proc_arity): arity is now defined as number of
-	  parameters that would not be ignored. i.e. Proc.new{}.arity
-	  returns zero.  update test suites too.
-
-Thu Mar 18 15:27:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c: remove specialized version of rb_Array().  use simple
-	  one defined in object.c.
-
-	* object.c (Init_Object): remove Kernel#to_a.
-
-	* enum.c (enum_zip): use "to_a" instead of "to_ary".
-
-Wed Mar 17 00:22:03 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* oniguruma.h: imported Oniguruma 2.2.5.
-	* regparse.c: ditto.
-
-Tue Mar 16 11:14:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (fnmatch_helper): File.fnmatch('\.', '.') should return true.
-	  (Rev1.112 lost compatiblity)
-
-	* dir.c (fnmatch_helper): File.fnmatch('\/', '/', File::FNM_PATHNAME)
-	  should return true. (Rev1.112 lost compatiblity)
-
-	* dir.c (fnmatch): File.fnmatch('**/.boo', '.foo/.boo',
-	  File::FNM_PATHNAME) should return false because of leading period.
-
-Mon Mar 15 17:01:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* error.c (exc_initialize): calling 'to_str' each time just for
-	  type checking is too heavy.  [ruby-core:02661]
-
-Mon Mar 15 10:14:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SocketForwarder):
-	  add do_not_reverse_lookup.
-
-Mon Mar 15 07:39:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
-	  yield is not break destination. [ruby-dev:23197]
-
-Sun Mar 14 22:07:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_raise): err at unstarted thread.  (PR#1302)
-
-Sat Mar 13 14:56:32 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
-
-	* test/drb/ut_eval.rb: ditto.
-
-	* test/drb/ut_large.rb: ditto.
-
-	* test/drb/ut_safe1.rb: ditto.
-
-	* test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
-
-Fri Mar 12 23:52:56 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (fnmatch): directory recursion '**/' can be used with
-	  File::FNM_PATHNAME. [ruby-dev:22901]
-
-	* dir.c (fnmatch, fnmatch_helper): only '/' is accepted as path
-	  separator even in DOSISH environment. [ruby-dev:22974]
-	  [ruby-list:39337]
-
-	* dir.c (fnmatch_helper): faster '*' matching.
-
-Fri Mar 12 20:19:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (rb_cv_noreturn): default for platforms not support
-	  prototypes.
-
-	* ruby.c (ruby_init_loadpath): buffer for path name should have
-	  MAXPATHLEN.
-
-	* lib/mkmf.rb (configuration): include topdir and hdrdir in VPATH.
-
-	* lib/mkmf.rb (create_makefile): default dependency rule.
-
-Fri Mar 12 07:35:36 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/config.rb (WEBrick::Config::General): add
-	  :DoNotReverseLookup.
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#accept): call
-	  do_not_reverse_lookup for each socket if :DoNotReverseLookup
-	  is set.  [ruby-code:02357]
-
-Wed Mar 10 22:26:25 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (remove_dir): should handle symlink correctly.
-	  This patch is contributed by Christian Loew.  [ruby-talk:94635]
-
-Wed Mar 10 16:28:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (return_jump): set return value to the return
-	  destination.  separated from localjump_destination().
-
-	* eval.c (break_jump): break innermost loop (or thread or proc).
-
-	* eval.c (rb_yield_0): set exit_value for block break.
-
-Wed Mar 10 16:00:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* struct.c (rb_struct_s_def): Struct::new executes block with
-	  generated struct class. [ruby-talk:02606]
-
-Wed Mar 10 15:58:43 2004  Ryan Davis  <ryand@zenspider.com>
-
-	* eval.c (eval): Only print backtrace if generating the backtrace
-	  doesn't generate an exception.  [ruby-core:02621]
-
-Wed Mar 10 10:15:16 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ruby.c (opt_W_getter): get rid of warning.
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
-	  fixed dependency.
-
-Tue Mar  9 13:04:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_ungetc): raise IOError instead of calling
-	  rb_sys_fail().  [ruby-talk:23181]
-
-Tue Mar 09 10:03:40 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
-	  replaced regex.c entry with Oniguruma files.
-
-Tue Mar  9 01:09:46 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* Makefile.in: replaced regex.c entry with Oniguruma files.
-
-Mon Mar  8 23:16:07 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: HTTPHeader did not initialized correctly.
-
-	* lib/net/http.rb (connect): does same debug output.
-
-Mon Mar  8 21:38:18 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (add_header): remove warning. [ruby-dev:23170]
-
-Mon Mar  8 21:09:39 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (range): Cancel change for incomplete '['. More discussion
-	  is needed.
-
-Mon Mar  8 19:35:13 2004  akira yamada  <akira@arika.org>
-
-	* lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
-	  -> (?::#{PORT}).  [ruby-dev:23170]
-
-Mon Mar  8 15:03:24 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (range): treat incomplete '[' as ordinary character (like
-	  has_magic does). fix buffer overrun at incomplete escape like '[\'.
-
-Mon Mar  8 13:35:32 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* regparse.c (parse_exp): need to separate initialization for bcc32.
-	  [ruby-dev:23169]
-
-	* oniguruma.h (ONIG_EXTERN): check __GNUC__ instead of __CYGWIN__.
-
-Mon Mar  8 01:05:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/config.rb (WEBrick::Config::HTTP): rename :RequestHander
-	  to :RequestCallback and add new option :ServerAlias.
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): use
-	  :RequestCallback and warn if :RequestHandler is in server's option.
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should print
-	  error message for WEBrick::HTTPSataus::Error.
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#lookup_server):
-	  lookup for hostname from :ServerAlias if the req.host is not match
-	  to :ServerName.
-
-	* lib/webrick/httpservlet.rb (WEBrick::HTTPServlet::CGIHandler#do_GET):
-	  use $?.exitstatus and refine log message.
-
-Sun Mar  7 16:22:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* Makefile.in (lex.c): use $? instead of $<.
-
-	* lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
-	  [ruby-dev:23157]
-
-Sun Mar  7 05:34:42 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: HTTPHeader keeps its header fields as an array.
-
-	* lib/net/http.rb: new method HTTPHeader#add_header, get_fields.
-
-	* lib/net/http.rb: new method HTTPHeader#content_length=.
-
-	* lib/net/http.rb: new method HTTPHeader#content_type, main_type,
-	  sub_type, type_params, content_type=, set_content_type.
-
-	* lib/net/http.rb (HTTPHeader#basic_encode): result of pack(m) may
-	  contain multiple LFs.
-
-Sun Mar  7 03:11:00 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: new method Net::HTTPRequest#body(=).
-
-	* lib/net/http.rb: new method Net::HTTPRequest#body_stream(=).
-
-Sun Mar  7 02:06:07 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: spin off https code again.
-
-	* lib/net/https.rb: new file.
-
-	* ext/openssl/lib/net/https.rb: removed.  moved to net/https with
-	  slight modifications.
-
-	* ext/openssl/lib/net/protocol.rb: removed.  merged with net/http.
-
-	* lib/net/protocol.rb: new class BufferedIO.
-
-	* lib/net/protocol.rb: InternetMessageIO < BufferedIO.
-
-	* lib/net/protocol.rb: BufferedIO.new takes an IO.
-
-	* lib/net/smtp.rb: follow InternetMessageIO's change.
-
-	* lib/net/pop.rb: ditto.
-
-Sun Mar  7 00:55:03 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/protocol.rb: remove method: InternetMessageIO#address,
-	  port, ip_address, read_timeout(=), socket.
-
-	* lib/net/protocol.rb: simplify code.
-
-	* lib/net/protocol.rb: apply latest coding style.
-
-Sat Mar  6 15:15:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/strscan/depend: depends on re.h and regex.h.
-
-	* ext/strscan/strscan.c: no version check needed.
-
-	* ext/strscan/strscan.c (strscan_init_copy): struct re_registers must
-	  not be bitwise copied.
-
-Sat Mar  6 11:14:33 2004  David Black  <dblack@wobblini.net>
-
-	* lib/scanf.rb: refixed the previous fix in IO#block_scanf
-
-Sat Mar  6 10:49:40 2004  David Black  <dblack@wobblini.net>
-
-	* lib/scanf.rb: fixed a logic glitch in IO#block_scanf
-
-Sat Mar  6 02:00:19 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: net/https is merged.
-
-	* ext/openssl/lib/net/https.rb: ditto.
-
-Sat Mar  6 00:39:21 2004  Kazuo Saito  <ksaito@uranus.dti.ne.jp>
-
-	* oniggnu.h: imported from Oniguruma library.
-	* oniguruma.h: ditto.
-	* regcomp.c: ditto.
-	* regenc.c: ditto.
-	* regenc.h: ditto.
-	* regerror.c: ditto.
-	* regex.c: ditto.
-	* regexec.c: ditto.
-	* reggnu.c: ditto.
-	* regint.h: ditto.
-	* regparse.c: ditto.
-	* regparse.h: ditto.
-	* ascii.c: ditto.
-	* euc_jp.c: ditto.
-	* sjis.c: ditto.
-	* utf8.c: ditto.
-
-	* MANIFEST: added Oniguruma files listed above.
-
-	* LEGAL: added Oniguruma license.
-
-	* regex.h: now includes oniggnu.h.
-
-	* re.c: applied Oniguruma patch.
-
-Fri Mar  5 23:13:08 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: support WebDAV methods, PROPPATCH, LOCK,
-	  UNLOCK, OPTIONS, PROPFIND, DELETE, MOVE, COPY, MKCOL.
-	  This patch is contributed by Tatsuki Sugiura.
-
-Fri Mar  5 20:58:37 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: Net::HTTPResponse#response is obsolete.
-	  [ruby-core:02592]
-
-	* lib/net/http.rb: Net::HTTPResponse#header is obsolete.
-
-	* lib/net/http.rb: Net::HTTPResponse#read_header is obsolete.
-
-Fri Mar  5 20:10:57 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c: new method StringScanner#initialize_copy
-	  to allow #dup and #clone.
-
-	* test/strscan/test_strscan.rb: test StringScanner#dup.
-
-Fri Mar  5 19:42:09 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (HTTPResponse#to_ary): should return an object
-	  which does not respond to #to_ary.  It causes infinite loop in
-	  puts. [ruby-core:02578]
-
-Fri Mar  5 00:51:35 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/test/unit.rb: Move RDoc documentation so that you can
-	  now say 'ri Test::Unit'
-
-Thu Mar  4 22:31:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in: miniruby is not needed for cross compile.
-
-	* configure.in (PREP): miniruby for native compile.
-
-Thu Mar  4 11:46:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/drb/extservm.rb (DRb::ExtServManager#invoke_service_command):
-	  detach server processes to get rid of zombies.
-
-Thu Mar  4 10:41:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ruby.h (T_MASK): save 1 bit in flags bits by shifting T_xxx
-	  values.
-
-Thu Mar  4 08:08:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/syck/rubyext.c: get rid of warnings.
-
-	* lib/rss/taxonomy.rb: ditto.
-
-	* lib/rdoc/ri/ri_formatter.rb: ditto.
-
-	* test/ruby/test_assignment.rb: ditto.
-
-Thu Mar  4 01:17:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/ri/ri_display.rb (DefaultDisplay::page): wait until the
-	  pager terminates.
-
-Wed Mar  3 13:10:56 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (method_hash): new method. [ruby-talk:93968]
-
-	* eval.c (proc_eq): do not compare dyna_vars.
-
-	* eval.c (proc_hash): new method.
-
-	* eval.c (rb_yield_0): protect break/return from within orphan (or
-	  lambda) Proc object.
-
-Wed Mar  3 09:52:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb ($topdir): use compile_dir only when not installed yet.
-	  [ruby-talk:94098]
-
-Wed Mar  3 01:18:52 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/converter.rb: handled Uconv::Error.
-
-	* lib/rss/dublincore.rb: DublincoreModel -> DublinCoreModel
-
-Wed Mar  3 00:59:30 2004  David Black  <dblack@wobblini.net>
-
-	* lib/scanf.rb: soak_up_spaces only ungetc's non-space last
-	  character
-
-	* lib/scanf.rb: IO#block_scanf now returns partial last iteration
-	  array if format string matches partly
-
-Tue Mar  2 16:30:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (pipe_open): erred program name should be reported by
-	  exceptions, instead of the first argument.
-
-	* process.c (rb_spawn): ditto.
-
-	* process.c (proc_spawn_v): use first argument as program name.
-
-	* win32/win32.c (rb_w32_aspawn): ditto.
-
-	* win32/win32.c (CreateChild): search executable file if no program
-	  name given.
-
-	* lib/drb/extservm.rb (invoke_service_command): use Process.spawn.
-	  [ruby-dev:23103]
-
-	* lib/rdoc/ri/ri_display.rb (setup_pager): use IO.popen.
-	  [ruby-dev:23086], [ruby-dev:23103]
-
-	* lib/rdoc/diagram.rb (convert_to_png): ditto.
-
-	* lib/rdoc/generators/chm_generator.rb (compile_project): ditto.
-
-Tue Mar  2 12:24:03 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
-	  defined? NORETURN. [ruby-dev:23100]
-
-Tue Mar  2 11:28:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_iterator.rb (test_ljump): cannot use
-	  assert_nothing_raised due to passing block.
-
-Tue Mar  2 06:23:14 2004  David Black  <dblack@wobblini.net>
-
-	* lib/scanf.rb: fixed Kernel#scanf to propagate code block
-
-Mon Mar  1 23:25:40 2004  David Black  <dblack@wobblini.net>
-
-	* lib/scanf.rb: Partial fix so STDIN#scanf works with new
-	 STDIN#pos behavior
-
-Mon Mar  1 19:42:05 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/setup.mak: configure's default is "--enable-install-doc"
-
-	* win32/setup.mak: ditto.
-
-Mon Mar  1 12:24:10 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
-	  Allow aliases to have parentheses
-
-Sun Feb 29 23:14:53 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Handle :nodoc: on singleton classes.
-
-Sat Feb 28 21:50:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bcc32/Makefile.sub, bcc32/README.bcc32, bcc32/configure.bat,
-	  bcc32/setup.mak: new configure scheme. use ``configure --prefix=dir''
-	  instead of ``make DESTDIR=dir install''.
-	  --with-static-linked-ext support on bccwin32. [ruby-dev:23034]
-
-Sat Feb 28 21:50:20 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/setup.mak: "configure --disable-install-doc" is now working.
-
-	* win32/setup.mak: ditto.
-
-Sat Feb 28 15:09:49 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/configure.bat: append missing label ":exit".
-
-	* bcc32/configure.bat: fix typo.
-
-Sat Feb 28 10:31:03 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* MANIFEST: add test_erb.rb
-
-	* lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
-	  if both filename and safe_level given. [ruby-dev:23050]
-
-Sat Feb 28 01:08:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (yylex): should not allow symbol for invalid global
-	  variable (e.g. `:$-)`). [ruby-core:02518]
-
-Fri Feb 27 20:37:09 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): no orphan block check is needed when pcall
-	  is true.
-
-	* eval.c (localjump_destination): update localjump condition.
-
-Fri Feb 27 02:10:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (localjump_destination): lambda should not interfere
-	  return from the yielded block.
-
-Fri Feb 27 00:53:49 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
-
-Thu Feb 26 12:15:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (make_cmdvector): adjust successive double-quote
-	  handling.
-
-Thu Feb 26 09:42:56 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (delete_if_i): use st_delete_safe() (via
-	  rb_hash_delete()) instead of returning ST_DELETE.
-
-Thu Feb 26 02:35:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_f_exec): get rid of SEGV when exec failed for command
-	  in single string.
-
-Wed Feb 25 21:17:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (obj_free), io.c (rb_io_fptr_finalize), rubyio.h (OpenFile):
-	  sharing OpenFile.
-
-	* io.c (rb_io_initialize): accept IO instance.  [ruby-dev:22195]
-
-Wed Feb 25 21:16:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* instruby.rb (with_destdir): should return the given argument if no
-	  DESTDIR is given.
-
-	* instruby.rb: use path name expansion of cmd.exe.
-
-Wed Feb 25 20:44:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/cgi-lib.rb, lib/getopts.rb, lib/importenv.rb, lib/parsearg.rb:
-	  warn with caller position.
-
-	* test/rss/test_content.rb, test/rss/test_dublincore.rb,
-	  test/rss/test_syndication.rb, test/rss/test_trackback.rb: use cgi
-	  instead of cgi-lib.
-
-Tue Feb 24 18:42:03 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (glob_helper): '**/' should not match leading period
-	  unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
-
-Tue Feb 24 18:03:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_file.rb (test_fnmatch): test for dir.c:1.108.
-
-Tue Feb 24 17:07:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (fnmatch): File.fnmatch with File::FNM_PATHNAME was broken
-	  for the pattern including '*' followed by '/'.
-
-Tue Feb 24 13:22:21 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
-	  heuristics on which files to include and exclude. Now only include
-	  non-standard files if they are explicitly named in ARGV.
-
-Tue Feb 24 07:23:30 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
-	  choosing a default main page to display (ie. don't select a page
-	  if we don't have documentation for it).
-
-Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
-	  class variables in code listings
-
-Tue Feb 24 06:32:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
-	  aliases in C files.
-
-Tue Feb 24 06:16:22 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
-	  parsing files.
-
-Tue Feb 24 06:08:47 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
-	  Start collecting text of constant values earlier: was missing
-	  values in output if there was no space after '='
-
-Tue Feb 24 06:08:25 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Escape contant values.
-
-Tue Feb 24 03:45:06 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_config.c (ossl_config_each): add new method
-	  OpenSSL::Config#each. it iterates with section name, field name
-	  and value.
-
-	* ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
-
-Mon Feb 23 09:09:44 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* instruby.rb (parse_args): use optparse instead of getopts.
-
-	* instruby.rb (DOSISH): embedded path in batch files should not be
-	  prefixed by DESTDIR.  [ruby-core:02186]
-
-Sun Feb 22 14:58:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: $extstatic is Array or nil now.  [ruby-talk:93383]
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub: terminate options.
-
-	* lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
-
-Sun Feb 22 13:05:37 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
-
-Sun Feb 22 12:58:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: use optparse instead of getopts.
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub: ditto.
-
-Sun Feb 22 09:51:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* re.c: corrected documentation format (rb_reg_initialize_m)
-
-Sat Feb 21 22:41:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* ext/zlib/zlib.c: documented, but needs more effort.
-
-Sat Feb 21 14:33:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: prefer relative path.  [ruby-talk:93037]
-
-Sat Feb 21 11:12:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* missing/os2.c, missing/x68.c: typo fix.  pointed out by greentea.
-
-Fri Feb 20 19:11:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/ostruct.rb (OpenStruct#initialize_copy): should not share
-	  members.  [ruby-dev:22966]
-
-Fri Feb 20 18:59:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
-	  irb. [ruby-dev:39243]
-
-Fri Feb 20 12:55:27 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (pipe_open): fix typo.
-
-	* win32/win32.c (CreateChild): first argument to CreateProcess() must
-	  have path, not just basename.
-
-Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
-	  Support visibility modifiers for attributes
-
-Thu Feb 19 22:39:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/ostruct.rb: documented
-
-Thu Feb 19 22:39:04 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
-	  DRb.start_service could handle this.
-
-Thu Feb 19 22:24:04 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
-	  [ruby-dev:22588]
-	  c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
-
-Thu Feb 19 18:08:18 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* ext/strscan/strscan.c: improved documentation
-
-Thu Feb 19 18:08:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c, win32/win32.h: fixed prototypes.
-
-	* win32/win32.c (wait): same as waitpid() with -1.
-
-Thu Feb 19 02:34:28 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::include_file):
-	  Only strip comment markers if all lines start with comments.
-
-Thu Feb 19 03:05:49 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c: StringScanner#restsize is obsolete;
-	  use #rest_size instead.
-
-	* ext/strscan/strscan.c: StringScanner#matchedsize is obsolete;
-	  use #matched_size instead.
-
-Thu Feb 19 02:42:19 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c: don't use rb_eval_string, it defines
-	  classes under the module when required in module clauses.
-	  [ruby-dev:22951]
-
-Thu Feb 19 02:37:28 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c: merge documentation from 1.8 branch.
-	  Thanks Gavin Sinclair.
-
-Thu Feb 19 00:20:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/cgi-lib.rb:   deprecated after 1.8.1
-
-	* lib/getopts.rb:   ditto
-
-	* lib/importenv.rb: ditto
-
-	* lib/parsearg.rb:  ditto
-
-Thu Feb 19 00:11:05 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
-	  Strip extraneous space from filenames in :include:
-
-Wed Feb 18 22:53:41 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/unix.rb: remove O_NONBLOCk, thanks \ay
-
-Wed Feb 18 22:42:19 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/rinda/test_rinda.rb: improt test_rinda.rb
-
-Wed Feb 18 22:03:11 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/*: should not depend on $KCODE.
-
-Wed Feb 18 18:07:09 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_sprintf.rb: added tests.
-
-Wed Feb 18 17:18:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
-
-Wed Feb 18 10:40:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): sign bit extension should not be done
-	  if FPLUS flag is specified.  [ruby-list:39224]
-
-	* sprintf.c (rb_f_sprintf): do not prepend dots for negative
-	  numbers if FZERO is specified.  [ruby-dev:39218]
-
-Wed Feb 18 10:23:34 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): clean up.
-
-Tue Feb 17 23:40:34 2004  Guy Decoux  <ts@moulon.inra.fr>
-
-	* sprintf.c (rb_f_sprintf): preserve original val for
-	  format_integer. [ruby-talk:92975]
-
-Tue Feb 17 23:28:45 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/soap/marshal/test_marshal.rb, test/ruby/test_marshal.rb: do $:
-	  trick to share the testcase test/ruby/marshaltestlib.rb.
-
-Tue Feb 17 23:13:23 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/ruby/marshaltestlib.rb: common marshal testcase added.
-
-	* test/ruby/test_marshal.rb: use above testsuite.
-
-	* test/soap/marshal/test_marshal.rb: ditto.
-
-	* test/soap/marshal/cmarshal.rb: removed (not used).
-
-Tue Feb 17 19:34:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): $extout_prefix doesn't vary for libraries.
-
-	* ext/extmk.rb (extmake): remove compile directory if empty.
-
-	* ext/extmk.rb (parse_args) lib/mkmf.rb (create_makefile): move
-	  initialization of $extout_prefix from lib/mkmf.rb.  [ruby-dev:22928]
-
-	* ext/extmk.rb: clear ext and extout directory when cleaning.
-
-	* lib/mkmf.rb (CLEANLIBS): should be under $(arch) directory.
-
-Tue Feb 17 18:02:10 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c: ScanError may be (wrongly) garbage
-	  collected. (thanks Gavin Sinclair)
-
-	* ext/strscan/strscan.c: move ::ScanError to StringScanner::Error.
-	  ::ScanError is also defined for backward compatibility.
-
-	* ext/strscan/strscan.c: #peep is obsolete, use #peek.
-
-	* ext/strscan/strscan.c: #empty? is obsolete, use #eos?.
-
-	* ext/strscan/strscan.c: #clear is obsolete, use #terminate.
-
-	* ext/strscan/strscan.c: #getbyte is obsolete, use #get_byte.
-
-Tue Feb 17 12:12:47 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (parse_args): delay expanding $(extout) until invoking
-	  make.
-
-	* lib/mkmf.rb (CLEANLIBS): should remove files have specific
-	  extensions.
-
-Tue Feb 17 11:33:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rss/rexmlparser.rb: REXML version may be 4 digits.
-
-Tue Feb 17 10:45:59 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
-
-Tue Feb 17 07:48:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rexml/encodings/SHIFT_JIS: wrong library name.
-
-Tue Feb 17 01:35:28 2004  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
-	  to NODE_LIT.  [ruby-dev:22920]
-
-Tue Feb 17 01:20:57 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: new module FileUtils::DryRun.
-
-Mon Feb 16 23:28:14 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/csv.rb: document reduction.  [ruby-core:02429]
-
-	* test/yaml/test_yaml.rb: added 0..1 test with "0".."1" on display.
-	  it should be defined that the specification about what kind of Range
-	  is supported in ruby's custom type in YAML.
-
-Mon Feb 16 22:22:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/generator.rb: corrected doc format
-
-	* lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
-
-	* lib/rinda/tuplespace.rb: ditto
-
-	  [Note: rinda files actually committed Wed Feb 18 07:27:00 2004]
-
-Mon Feb 16 20:28:52 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: show more warnings. (refering to mingw)
-
-	* bcc32/setup.mak: ditto.
-
-Mon Feb 16 18:35:58 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/Makefile.sub (config.status): should create *.pdb on ext/,
-	  not .ext/.
-
-	* win32/Makefile.sub (config.status): convert the name of import
-	  library.
-
-	* lib/mkmf.rb (create_makefile): now don't need to remove
-	  $(TARGET).lib.
-
-Mon Feb 16 15:45:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check functions, fork spawnv.
-
-	* io.c (rb_io_s_popen): accept argv not only single command line.
-
-	* process.c (rb_proc_exec_n): export.
-
-	* process.c (rb_check_argv): check if arguments are safe to invoke.
-
-	* process.c (rb_fork): retry to fork.
-
-	* process.c (rb_spawn): spawn child process asynchronously.
-
-	* process.c (rb_f_system): raise an exception if the command could not
-	  execute.
-
-	* win32/win32.c (rb_w32_argv_size): count necessary size for joined
-	  arguments.
-
-	* win32/win32.c (rb_w32_join_argv): join arguments with quoting.
-
-	* win32/win32.c (rb_w32_pipe_exec, rb_w32_spawn, rb_w32_aspawn):
-	  accept program name adding to command line.
-
-Mon Feb 16 15:18:33 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/racc/parser.rb: add note for Racc full package.
-
-Mon Feb 16 15:13:01 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/racc/cparse/README: new file.
-
-	* ext/racc/cparse/MANIFEST: add README.
-
-Mon Feb 16 12:29:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_s_list): new method Iconv.list
-	  (libiconv only).
-
-Mon Feb 16 10:29:52 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (CompareImpl): File.fnmatch and Dir.glob get better performance
-	  in Win32. This is achived by calling downcase() for single-byte
-	  characters. (CharLower() is slower than downcase())
-
-Mon Feb 16 02:14:29 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: should warn suspicious pointer conversion.
-
-	* bcc32/setup.mak: ditto.
-
-Sun Feb 15 20:56:22 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (push_braces): remove wrong const. [ruby-dev:22891]
-
-Sun Feb 15 20:41:15 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* sample/soap/calc/httpd.rb, sample/soap/exchange/httpd.rb,
-	  sample/soap/sampleStruct/httpd.rb, sample/wsdl/googleSearch/httpd.rb:
-	  use soap/property instead of getopts for configuring DocumentRoot
-	  and port# of httpd.  see samplehttpd.conf below.
-
-	* sample/soap/calc/samplehttpd.conf,
-	  sample/soap/exchange/samplehttpd.conf,
-	  sample/soap/sampleStruct/samplehttpd.conf,
-	  sample/wsdl/googleSearch/samplehttpd.conf: added.
-
-Sun Feb 15 19:13:33 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/tuplespace.rb: read(tpl,0), raise RequestExpiredError
-	  if not found.
-
-Sun Feb 15 15:48:57 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
-	  Thanks, arton.
-
-Sun Feb 15 15:23:29 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ruby.h, dir.c (rb_glob): add const.
-
-Sun Feb 15 01:46:05 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
-	  [ruby-dev:22870]
-
-Sat Feb 14 23:59:11 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* mkconfig.rb: use fileutils.rb instead of ftools.rb.
-
-	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
-	  STACK_GROW_DIRECTION.
-
-	* bcc32/Makefile.sub (config.h): add newer checks.
-
-	* wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
-
-Sat Feb 14 23:26:27 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/un.rb: use OptionParser instead of getopts.
-
-Sat Feb 14 11:28:14 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* sample/drb/*: import lib/drb/sample
-
-Sat Feb 14 11:14:12 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: add pretty_print, thanks gotoken.
-
-Fri Feb 13 21:51:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/fileutils.rb: slighly improved documentation (sync with 1.8)
-
-Fri Feb 13 19:57:01 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* test/rss/test_trackback.rb: added tests for TrackBack with RSS
-	  2.0.
-
-	* test/rss/common.rb: added methods make RSS 2.0.
-
-	* lib/rss/trackback.rb: TrackBack API is decided.
-
-	* lib/rss/rss.rb: RSS::VERSION 0.0.7 -> 0.0.8.
-
-	* lib/rss/parser.rb, lib/rss/rss.rb: replaced $DEBUG by RSS::DEBUG.
-
-	* lib/rss/2.0.rb: removed RSS 2.0 URI. Because RSS 2.0 doesn't
-	  have URI.
-
-Fri Feb 13 14:41:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: en-bugged at last commit (Feb 11 23:24:22 2004)
-
-Fri Feb 13 12:26:37 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: rescue SystemCallError instead
-	  of EINVAL.  File.link may raise EACCES on network file systems.
-
-Fri Feb 13 05:18:58 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: File.link raises EINVAL on
-	  Win9x. [ruby-dev:22713]
-
-Thu Feb 12 21:49:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/ftools.rb: documented
-
-Thu Feb 12 21:19:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/base64.rb: added and tidied documentation
-
-Thu Feb 12 20:45:01 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/protocol.rb (WriteAdapater#puts): must append "\n" to
-	  the string, don't prepend. (ruby-bugs:PR#1280)
-
-Thu Feb 12 20:31:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
-	  directives in DOS line-ending files at all.
-
-Thu Feb 12 15:23:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (rparen): ignore preceding newlines to right parentheses.
-	  (ruby-bugs:PR#1221) [ruby-dev:22858]
-
-Thu Feb 12 14:17:43 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: set ac_cv_func_link to yes to enable link() on MinGW.
-	  [ruby-dev:22241]
-
-Thu Feb 12 13:32:49 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (link): raise NotImplementedError on Win9X.
-	  contributed by Tietew. [ruby-dev:22713]
-
-	* win32/win32.c, win32/win32.h (link): add const.
-
-Thu Feb 12 09:56:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/tk/lib/tk.rb (TkComm::tk_split_list): suppress a warning.
-
-Thu Feb 12 02:23:56 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: use assert_raise instead of assert_raises.
-
-	* lib/pp.rb: ditto.
-
-	* lib/time.rb: ditto.
-
-	* lib/tsort.rb: ditto.
-	  use TSortHash and TSortArray instead of Hash and Array in test.
-
-Wed Feb 11 23:24:22 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: properly treat a Tcl/Tk's string with escaping
-	  special characters.
-
-Tue Feb 10 20:49:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (method_proc): return bound Proc object.  [ruby-dev:22854]
-
-	* eval.c (rb_mod_define_method): bind method body itself for Method
-	  object.
-
-	* node.h (NODE_DMETHOD): deprecated.
-
-	* object.c (rb_class_inherited_p): export.
-
-Tue Feb 10 16:43:50 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (umethod_bind): purge unused check.  [ruby-dev:22850]
-
-Tue Feb 10 14:33:08 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* string.c (rb_str_match): raise TypeError when both arguments are
-	  strings. [ruby-dev:22851]
-
-	* string.c (rb_str_match2): removed.
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
-	  wince/Makefile.sub (string.c): now not depend on version.h.
-
-Mon Feb  9 17:46:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub, configure.in,
-	  runruby.rb: run rdoc, test and so on with compiled extension
-	  libraries.  [ruby-dev:22688]
-
-	* ext/extmk.rb, lib/mkmf.rb: make extension libraries in separated
-	  directory, similar to the actual directory structure.
-
-	* lib/fileutils.rb (FileUtils.copy_file): use the mode of the original
-	  file to create new file.
-
-	* lib/rdoc/ri/ri_paths.rb (RI::Paths::SYSDIR): get rid of unexpected
-	  influence by envirionment variable.
-
-	* bcc32/configure.bat, win32/configure.bat: add install-doc options.
-
-	* win32/win32.c, win32/win32.h (rb_w32_fstat): fix Borland C runtime
-	  bug which returns wrong mode.  [ruby-dev:22846]
-
-Mon Feb  9 16:30:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (detach_process_watcher): return the last status.
-	  [ruby-dev:22841]
-
-Sun Feb  8 16:46:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
-	  sign for higher heap areas.
-
-Sun Feb  8 16:18:27 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/yaml/test_yaml.rb (YAML_Unit_Tests::test_range_cycle):
-	  added tests.
-
-Sun Feb  8 15:51:57 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
-	  File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
-
-Sun Feb  8 15:41:45 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/yaml/test_yaml.rb (YAML_Unit_Tests::test_range_cycle):
-	  added tests. [ruby-core:02306] [ruby-core:02311]
-
-Sun Feb  8 14:24:35 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (HTTP#request): should not overwrite Connection
-	  header. (ruby-bugs:PR#1274)
-
-Sun Feb  8 10:11:21 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (glob_helper): Dir.glob('**/') did not work. [ruby-dev:22832]
-
-Sun Feb  8 00:29:26 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
-	  [ruby-dev:22815]
-
-	* dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
-	  [ruby-dev:22819]
-
-	* dir.c: Did some styles (no change to behavior)
-
-Sat Feb  7 19:56:11 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/irb/init.rb (IRB.rc_files): yield possible rc file names.
-
-	* lib/irb/input-method.rb (IRB::ReadlineInputMethod::initialize):
-	  load and save history automatically.  [ruby-core:02352]
-
-Fri Feb  6 22:48:16 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (gen_url): Support
-	  https in RDoc hyperlinks
-
-Fri Feb  6 22:41:22 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
-	  commit.  [ruby-dev:22813]
-
-Fri Feb  6 22:22:50 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
-	  variable which is defined in the test.
-
-Fri Feb  6 18:54:18 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_proc.rb (TestProc::test_eq): added a
-	  test.  [ruby-dev:22599]
-
-Fri Feb  6 18:26:00 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_proc.rb (TestProc::test_eq): added tests for
-	  Proc#==.  [ruby-dev:22592], [ruby-dev:22601]
-
-Fri Feb  6 10:12:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/socket.c (bsock_do_not_reverse_lookup): control reverse
-	  lookup for every instance.  [ruby-core:02346]
-
-Fri Feb  6 09:15:11 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/irb/extend-command.rb: add irb_help command.  [ruby-talk:91610]
-
-	* lib/irb/cmd/help.rb (IRB::ExtendCommand::Help): show RDoc.
-
-Fri Feb  6 00:48:37 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
-
-Thu Feb  5 23:56:55 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/prettyprint.rb (PrettyPrint#seplist): added.
-
-	* lib/pp.rb (PPMethods#pp_object): use seplist.
-	  (PPMethods#pp_hash): ditto.
-	  (Array#pretty_print): ditto.
-	  (Struct#pretty_print): ditto.
-	  (MatchData#pretty_print): ditto.
-
-	* lib/set.rb (Set#pretty_print): use seplist.
-
-Wed Feb  4 22:39:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_stat_mode): should not sign-expand, so backout.
-
-Wed Feb  4 02:12:06 2004  Tanaka Akira  <akr@m17n.org>
-
-	* file.c (test_l): fix wrong method name in document.
-	  (test_S): ditto.
-	  (test_b): ditto.
-	  (test_c): ditto.
-	  (test_suid): ditto.
-	  (test_sgid): ditto.
-	  (test_sticky): ditto.
-
-Tue Feb  3 22:36:25 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/2.0.rb, lib/rss/content.rb, lib/rss/dublincore.rb,
-	  lib/rss/rss.rb, lib/rss/syndication.rb: removed warnings.
-
-	* lib/rss/converter.rb: removed handling load error of nkf.
-
-	* test/rss/test_syndication.rb, test/rss/test_trackback.rb,
-	  test/rss/test_dublincore.rb, test/rss/test_content.rb: replaced
-	  'require "rss/parser"' by 'require "rss/1.0"'.
-
-	* test/rss/test_parser.rb, test/rss/test_accessor.rb: removed
-	  'require "rss/parser"'.
-
-Tue Feb  3 11:23:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (reduce_nodes): remove tail returns.  [ruby-talk:90934]
-
-Tue Feb  3 08:04:57 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
-
-Mon Feb  2 22:06:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (block_append, new_evstr, void_expr0): remove no longer used
-	  labels.
-
-Mon Feb  2 18:45:50 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* dln.c (dln_load): don't specify RTLD_GLOBAL on Interix,
-	  because it caused SEGV when running runner.rb.
-
-Mon Feb  2 01:54:00 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (Struct#pretty_print): make it 1.8 style.
-	  (Numeric#pretty_print, FalseClass#pretty_print)
-	  (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
-	  with instance variables.  [ruby-talk:91157]
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
-	  address.
-
-	* lib/resolv-replace.rb (BasicSocket#send): don't replace because
-	  it has no hostname argument.
-	  (IPSocket.getaddress): raise SocketError instead of
-	  Resolv::ResolvError for errors.
-	  (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
-	  (SOCKSSocket#initialize): use IPSocket.getaddress instead of
-	  Resolv.getaddress.
-	  (UDPSocket#send): recognize 3 arguments form.  try all addresses on
-	  4 arguments form.
-
-Sun Feb  1 23:00:00 2004  Shigeo Kobayashi <shigek@ruby-lang.org>
-
-	* ext/bigdecimal.c: Bug in BigDecimal("1e#{n}").add BigDecimal('.5'),n)
-	  reported and fixed by Javier Goizueta.
-
-Sun Feb  1 18:21:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	  From ruby_1_8 branch:
-	* lib/test/unit.rb: rearranged documentation for RDoc's sake.
-	* lib/matrix.rb: improved documentation.
-	* lib/net/http.rb: slight documentation formatting improvement.
-
-Sun Feb  1 05:30:06 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
-	 raise an errror on non-http proxy URI.
-	 (OpenURI::Buffer#<<): make a tempfile binmode.  [ruby-talk:90793]
-
-Sun Feb  1 00:57:41 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/parser.rb (RSS::Parser): added @@default_parser. Used
-	  XML parser became selectable.
-	* test/rss/test_parser.rb: added tests for
-	  RSS::Parser.default_parser.
-
-Sat Jan 31 02:28:15 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (RPATHFLAG): set to -Wl,-R like NetBSD on Interix.
-
-Sat Jan 31 01:09:41 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/logger.rb: leading 0 padding of timestamp usec part.
-
-Fri Jan 30 18:53:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (KR_REHASH): wrong hash value on sizeof(long) > sizeof(int).
-
-Thu Jan 29 23:11:57 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (DLEXT2): removed.  Ruby does not treat
-	  ".dll" as a extention library anymore.
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub (DLEXT2):
-	  ditto.
-
-	* util.c (mblen): fix overrun.  [ruby-dev:22672]
-
-Thu Jan 29 22:41:53 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
-	  THis means you can write "see f1[link:files/f1_rb.html]".
-
-Thu Jan 29 22:24:47 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* sample/openssl/gen_csr.rb: follow OpenSSL::X509::Name change.
-	  ASN.1 type of subject DN elements were wrong.
-
-Thu Jan 29 22:19:51 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/*: remove $: trick.  [ruby-dev:22763]  use test/runner.rb to
-	  run test.
-
-Thu Jan 29 19:28:16 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (Request#initialize): reject only when a path is
-	  empty. [ruby-dev:22771]
-
-Thu Jan 29 18:54:08 2004  H.Yamamoto  <ocean@m2.ccsnet.ne.jp>.
-
-	* dir.c (glob_helper): infinite loop bug in win32 code.
-	  [ruby-dev:22770]
-
-Thu Jan 29 17:03:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c: merge tuning from H.Yamamoto <ocean@m2.ccsnet.ne.jp>.
-	  [ruby-dev:22761]
-
-Thu Jan 29 11:32:14 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/rss/test_*: do $: trick while searching a module in the current
-	  directory.
-
-	* test/xsd/test_xmlschemaparser.rb, test/wsdl/test_emptycomplextype.rb,
-	  test/soap/helloworld/test_helloworld.rb,
-	  test/soap/calc/{test_calc.rb,test_calc2.rb}: do File.expand_path
-	  before using __FILE__.
-
-	* test/yaml/test_yaml.rb: assert_equals -> assert_equal.
-
-Thu Jan 29 01:56:02 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: usec round-tripping skew. [ruby-core:2305]
-
-	* lib/yaml/rubytypes.rb: character Range now round-trips. [ruby-core:2306]
-
-	* test/yaml/test_yaml.rb: add Time and Range tests.
-
-Thu Jan 29 00:00:46 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss: rss/parser.rb is always required.
-
-Wed Jan 28 15:09:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/rss/*.rb: remove "test/" prefix.
-
-Wed Jan 28 13:07:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/extconf.rb: include iconv.h for libiconv.  [ruby-dev:22715]
-
-Wed Jan 28 12:43:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rss: rss library imported. [ruby-dev:22726]
-
-Wed Jan 28 04:29:41 2004  Eric Schwartz  <emschwar@fc.hp.com>
-
-	* lib/cgi/session.rb: use LOCK_SH to read, and a few other
-	  improvements.  [ruby-core:02328]
-
-Tue Jan 27 15:00:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* misc/ruby-mode.el: better support for general delimited
-	  strings.  [ruby-dev:22695]
-
-Tue Jan 27 11:04:40 2004  FUKUMOTO Atsushi  <fukumoto@nospam.imasy.or.jp>
-
-	* ext/socket/socket.c (s_recvfrom): sending length should be an
-	  invariant while retrying on EAGAIN.  [ruby-talk:89962]
-
-Tue Jan 27 10:31:28 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/win32ole/win32ole.c (set_argv): fix condition.
-
-Tue Jan 27 02:26:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
-	  refine regex for header-name.
-
-Mon Jan 26 22:53:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* io.c: Remove documentation references to $defout.
-
-Mon Jan 26 14:41:46 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/weakref.rb (WeakRef::initialize): set up @__id before
-	  calling "super".
-
-	* lib/delegate.rb (Delegator::initialize): preserve
-	  singleton_method_added method [ruby-dev:22685]
-
-	* lib/delegate.rb (Delegator::initialize): use Kernel::raise
-	  instead of mere raise.  [ruby-dev:22681]
-
-Mon Jan 26 12:45:23 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
-
-Mon Jan 26 11:30:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
-	  (ruby-bugs:PR#1256)
-
-	* ext/win32ole/win32ole.c (set_argv): set real arguments to
-	  WIN32OLE::ARGV.  [ruby-list:39073]
-
-Sun Jan 25 18:25:26 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): third
-	  argument become optional.
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
-
-	* ext/openssl/ossl_x509name.c (Init_x509name): emailAddress and
-	  domainComponent should be IA5String.
-
-Sun Jan 25 01:45:38 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): support
-	  virtual host.
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): add
-	  new method to register virtual hosting server.
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#lookup_server): add
-	  new method to lookup virtual hosting server.
-
-Sat Jan 24 13:06:26 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
-	  second argument. it expected to be a Hash not an Integer.
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
-	  function for OpenSSL::X509::Name#add_entry.
-
-	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
-	  OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
-
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
-	  second argument takes OBJECT_TYPE_TEMPLATE by default.
-
-Fri Jan 23 02:26:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (num2i32): pack should not raise RangeError.
-	  [ruby-dev:22654]
-
-	* pack.c (pack_pack): do not auto convert nil to zero.
-
-Thu Jan 22 22:54:53 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
-	  strings for Novell GroupWise Internet Agent.
-
-	* lib/net/imap.rb (DATA_REGEXP): ditto.
-
-Thu Jan 22 18:35:49 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/e2mmap.rb (VERSION): remove unnecessary version checking.
-
-Thu Jan 22 16:21:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (string_content): reset lexical states at the beginning of
-	  string contents.  [ruby-list:39061]
-
-Thu Jan 22 08:08:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (opt_rescue): use NODE_ERRINFO() instead of
-	  NODE_GVAR("$!"), to avoid confusion from variable aliasing.
-	  [ruby-talk:90074]
-
-	* version.c (Init_version): remove obsolete constants VERSION
-	  etc.  [ruby-dev:22643]
-
-Thu Jan 22 01:46:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (newline_node): do not use NODE_NEWLINE node anymore,
-	  use NEWLINE flag instead.
-
-Thu Jan 22 01:12:12 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* missing/os2.c (chdir, getcwd):
-	  use _chdir2 and _getcwd2 supporting multiple drives in OS/2 with EMX.
-
-Thu Jan 22 00:33:52 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* configure.in: check availability of link(). [ruby-dev:22237]
-	* file.c (rb_file_s_link): raise an exception when link() is unavailable.
-	* missing/os2.c (link): removed. File#link isn't supported.
-	* bcc32/Makefile.sub: define HAVE_LINK to enable link(). [ruby-dev:22241]
-	* win32/Makefile.sub: ditto.
-
-Thu Jan 22 00:26:25 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* ChangeLog: typo: RUBY_MBCHAR_MAX was RUBY_MBCHAR_MAXSIZE.
-
-Thu Jan 22 00:12:51 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* defines.h: define RUBY_MBCHAR_MAX instead of MB_CUR_MAX.
-	* dir.c (Next, emx_mblen): use RUBY_MBCHAR_MAX for mblen().
-	* file.c (CharNext): ditto.
-	* ruby.c (translate_char): ditto.
-	* util.c (__crt0_glob_function): ditto.
-
-Thu Jan 22 00:10:01 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/base64.rb: :nodoc: the Deprecated module
-
-Wed Jan 21 23:52:39 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: Interix(SFU) support.
-
-Wed Jan 21 23:03:45 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
-	* lib/drb/extserv.rb: typo
-
-Wed Jan 21 17:57:56 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (envelope): allow NIL.
-	* lib/net/imap.rb (body): ditto.
-	* lib/net/imap.rb (number): ditto.
-	* lib/net/imap.rb (ensure_nz_number): show a detailed error
-	  message.
-
-Wed Jan 21 16:44:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (merge_libs): squeeze successive same libraries.
-	  [ruby-dev:22652]
-
-Wed Jan 21 16:10:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/base64.rb: enclosed in a module.  [ruby-core:02285]
-
-Wed Jan 21 16:01:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/digest/rmd160/extconf.rb: have_library appends found library.
-
-Wed Jan 21 11:36:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (sock_gethostbyname): returns host if
-	  ai_canonname is NULL. (ruby-bugs PR#1243)
-
-	* parse.y (block_append): update nd_end for "real" head node.
-	  [ruby-list:39058]
-
-Tue Jan 20 14:48:28 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
-	  of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
-
-Tue Jan 20 14:43:17 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/base64.rb: Add RDoc
-
-Tue Jan 20 14:25:51 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/abbrev.rb: Add RDoc
-
-Tue Jan 20 13:22:39 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Document aliases at
-	  top-most level.
-
-	* lib/English.rb: Document English.rb.
-
-Tue Jan 20 04:41:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_marshal.rb (MarshalTestLib::test_exception): test
-	  for [ruby-dev:22604].
-
-	* test/ruby/test_marshal.rb (MarshalTestLibtest_singleton): test
-	  for [ruby-dev:22588].
-
-Tue Jan 20 02:38:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_class): should not dump singleton class.
-	  [ruby-dev:22631]
-
-Tue Jan 20 02:49:22 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: add check for OpenSSL version.
-	  [ruby-list:39054]
-
-Mon Jan 19 23:56:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (name_err_mesg_to_str): inverted condition for result of
-	  inspection.  [ruby-dev:22628]
-
-Mon Jan 19 22:24:28 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* sample/exyacc.rb: escape '}' to avoid warning.
-
-	* lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
-
-Mon Jan 19 21:28:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/digest/defs.h, win32/win3.c, win32/win32.h, file.c: remove
-	  useless casts for Borland C.
-
-Mon Jan 19 17:39:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (NameError::message): internal use only.
-
-	* eval.c (rb_method_missing): use hidden constant.
-
-Mon Jan 19 16:30:53 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_time.rb: added tests for [ruby-dev:22614] and
-	  [ruby-dev:22617].
-
-Mon Jan 19 13:09:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/extmk.rb, win32/Makefile.sub, win32/configure.bat,
-	  win32/setup.mak: --with-static-linked-ext support on mswin32.
-
-Mon Jan 19 06:49:07 2004  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date.rb: zone was wrong when it was behind UTC.
-	  Thanks Mark J. Reed.
-
-	* lib/date/format.rb: %z is now always replaced by four digits
-	  with a leading plus or minus sign.
-
-	* sample/cal.rb: added a class, anyway.
-
-Mon Jan 19 01:08:39 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* class.c, error.c, eval.c, intern.h, object.c, variable.c:
-	  do not set path if it is a singleton class.  [ruby-dev:22588]
-
-	* lib/cgi.rb (CGI::QueryExtension): give extended string, not a
-	  delegater object.
-
-Sun Jan 18 23:59:44 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/charset_alias.rb: prefer us_EN locale encodings or
-	  former.  [ruby-dev:22609]
-
-	* ext/iconv/iconv.c (iconv_create): raise InvalidEncoding
-	  exception when EINVAL.
-
-Sun Jan 18 23:16:34 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c, error.c, file.c, io.c, numeric.c, object.c, re.c, struct.c,
-	  time.c: marked init_copy functions nodoc.
-
-Sun Jan 18 20:47:35 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ruby.c: use translate_char() on Cygwin.
-
-Sun Jan 18 20:00:16 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
-	  "parts" attribute of soap:body element in WSDL.
-
-	* lib/wsdl/xmlSchema/schema.rb: friendly warning message for
-	  simpleType element which is not supported for now.
-
-	* test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
-	  files.
-
-Sun Jan 18 16:46:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* time.c (time_overflow_p): should return results.  [ruby-dev:22614]
-
-Sun Jan 18 12:07:24 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* test/ruby/test_time.rb: new test case to test Time#[+-].
-
-	* time.c (time_plus, time_minus): fix RangeError for a negative
-	  argument in environments whose time_t is unsigned. [ruby-dev:22608]
-
-Sun Jan 18 02:33:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
-
-Sun Jan 18 00:23:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (class2path): check anonymous class/module before
-	  checking referable, and allow singleton classes.
-
-Sat Jan 17 23:58:51 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (NameError::Message): new class for lazy evaluation of
-	  message to ensure replaced before marshalling.  [ruby-dev:22604]
-
-	* eval.c (rb_method_missing): use NameError::Message.
-
-Sat Jan 17 21:49:50 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/time.rb (test_rfc2822, test_rfc3339, test_encode_xmlschema):
-	  should not expect that all platforms handle negative time_t value.
-
-Fri Jan 16 23:53:09 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_eq): compare also arguments and environment
-	  (including local variables).  [ruby-dev:22590]
-
-Fri Jan 16 14:33:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (class2path): get class path and check referable.
-	  [ruby-dev:22588]
-
-Thu Jan 15 12:58:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (argf_read): do not append EOF.  (ruby-bugs-ja:PR#585)
-
-	* io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
-	  weird behavior.  [ruby-dev:22424]
-
-Wed Jan 14 21:13:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/inlinetest.rb (InlineTest::eval_part): eval under the top
-	  level environment.
-
-Wed Jan 14 17:54:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/inlinetest.rb (InlineTest::loadtest): require instead of
-	  load, to get rid of multiple loading.
-
-Wed Jan 14 13:30:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
-
-Wed Jan 14 09:32:02 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* MANIFEST: add test/net/test_httpheader.rb. (commit miss?)
-
-Wed Jan 14 00:58:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (Init_Proc): move SystemStackError from under
-	  StandardError to Exception.  [ruby-talk:89782]
-
-Tue Jan 13 18:03:02 2004  Ian Macdonald  <ian@caliban.org>
-
-	* file.c (rb_stat_wr, rb_stat_ww): New functions
-	  implementing new methods (File::Stat#world_readable?,
-	  File::Stat#world_writable?).
-
-Tue Jan 13 16:53:25 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: omission of Date library code caused
-	  test suite failure. [ruby-core:2251]
-
-Tue Jan 13 16:50:03 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: use $0 as the default application class name.
-
-Tue Jan 13 14:48:00 2004  Ian Macdonald  <ian@caliban.org>
-
-	* lib/pathname.rb: New methods (Pathname#world_readable?,
-	  Pathname#world_writable?).
-
-Tue Jan 13 14:48:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (primary): allow no "when" case. [ruby-dev:22578]
-
-	* ruby.h (rb_class_of): reduce branch. [ruby-dev:22577]
-
-	* ruby.h (rb_type): ditto.
-
-Tue Jan 13 14:26:59 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
-	  moved run method which allows output level.  [ruby-dev:22554]
-
-Tue Jan 13 13:04:24 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/test_*.rb: Pathname#parent -> Pathname#dirname.
-
-Tue Jan 13 11:38:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/yaml/test_yaml.rb (YAML_Unit_Tests::test_spec_type_{int,float}):
-	  fix syntax error.
-
-Tue Jan 13 07:52:40 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/bytecode.c: turn off default implicit typing.
-
-	* ext/syck/implicit.c: detect base60 integers.
-
-	* ext/syck/rubyext.c: handle base60, as well as hex and octal
-	  with commas.  implicit typing of ruby symbols.
-
-	* test/yaml/test_yaml.rb: add test.
-
-Tue Jan 13 04:29:52 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
-	  Show fully-qualified class names in class list.
-
-Tue Jan 13 01:24:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (test_wr): Rdoc fix.  [ruby-core:02225]
-
-Tue Jan 13 01:04:37 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
-	  incorporating DESTDIR in the rdoc installation.
-
-Mon Jan 12 23:26:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): fix position after FCALL.  [ruby-dev:22574]
-
-Mon Jan 12 18:00:11 2004  Ian Macdonald  <ian@caliban.org>
-
-	* file.c (test_wr, test_ww): New functions implementing new
-	  methods (File::world_readable?, File::world_writable?).
-
-	* file.c (S_IRUGO, S_IGUGO): New macros.
-
-Mon Jan 12 12:07:22 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
-	  Someone changed the "// in eval.c" comments to "/*...*/" style,
-	  so the parsing of the source file name broke.
-
-	* object.c: Remove spurious space in TrueClass documentation.
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
-	  bad regexp: if the code before a documented method contained
-	  a comment that wasn't terminated by whitespace, that comment
-	  and all intervening code was included in the following
-	  method's documentation.
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
-	  HTML formats need explicit line breaks.
-
-Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
-	  generation support to ri (Elliot Hughes)
-
-Sun Jan 11 23:54:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* env.h (ruby_frame, ruby_scope, ruby_in_eval, ruby_class,
-	  ruby_dyna_vars): export.  [ruby-dev:22566]
-
-Sun Jan 11 02:35:53 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): a bug in brace position.
-
-	* configure.in: install rdoc by default. if you do not want to
-	  install rdoc, specify --disable-install-doc.
-
-Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
-	  Also accept command line options via the 'RI' environment variable.
-
-Sat Jan 10 21:27:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): need to add message delimiter. [ruby-dev:22561]
-
-Sat Jan 10 01:54:50 2004  Eric Sunshine  <sunshine@sunshineco.com>
-
-	* defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
-	  S_IRWXO, etc. macros are defined since future code might require
-	  them (even though present code only requires a subset).
-
-	* defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
-	  correctly on Rhapsody when -arch compiler flag was used (via
-	  configure's --enable-fat-binary option).
-
-Sat Jan 10 23:01:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
-	  quotes.  [ruby-dev:22564]
-
-	* lib/mkmf.rb (libpathflag): do not enclose with quotes always.
-
-	* {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
-
-Sat Jan 10 22:46:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dir_inspect): new method, Dir#inspect.  [ruby-dev:22562]
-
-Fri Jan  9 17:36:51 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): getaddrinfo(3) on BSD do not
-	  fill ai_canonname if serv is not supplied.  (ruby-bugs PR#1243)
-
-Fri Jan  9 13:14:59 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/test/unit/collector/dir.rb: do not ignore exceptions(LoadError
-	  and SystemExitError) while loading a testcase.  smell of bug.
-
-	* test/testunit/collector/test_dir.rb: add new test of the LoadError.
-
-	* test/drb/{test_drbssl.rb,test_drbunix.rb}: do not define testcase if
-	  openssl is not installed.
-
-	* test/testunit/collector/test_dir.rb: assert_raises -> assert_raise.
-
-Fri Jan  9 11:52:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* rubysig.h: <errno.h> is needed to use errno which may be a macro.
-
-Fri Jan  9 11:20:24 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* ext/extmk.rb (extmake): should not reduce necessary libraries.
-	  [ruby-dev:22440]
-
-	* lib/mkmf.rb (merge_libs): merge libraries according to
-	  dependency.
-
-Fri Jan  9 10:05:23 2004  Siena.  <siena@faculty.chiba-u.jp>
-
-	* lib/mkmf.rb (libpathflag): use single quotes.  [ruby-dev:22440]
-
-Thu Jan  8 23:49:21 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (RDOCTARGET): new macro.  if you want to install
-	  rdoc documentation, you need to run configure with
-	  --enable-install-doc.
-
-Thu Jan  8 21:17:43 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
-	  public key only.
-
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
-	  OpenSSL::PKey::DH#to_der.
-
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
-	  OpenSSL::PKey::DSA#to_der.
-
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
-	  OpenSSL::PKey::RSA#to_der.
-
-Thu Jan  8 18:25:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): should not recurse in exceptional status.
-
-Thu Jan  8 16:51:04 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
-	  dumps "E" at month-end.
-
-Thu Jan  8 11:20:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* eval.c, object.c, process.c, re.c: don't use C++ style comments.
-
-Thu Jan  8 08:46:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/syck/rubyext.c (yaml_org_handler): lazy-load Date for
-	  static-ext.
-
-Thu Jan  8 07:06:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: preserve order in Setup.  [ruby-dev:22503]
-
-	* ext/extmk.rb: move dependent libraries just after depended
-	  libraries.
-
-	* ext/digest/*/extconf.rb: depend on digest.
-
-Thu Jan  8 04:36:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
-	  @config[:Logger] if it was not given.
-
-Wed Jan  7 22:28:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): fix memory leak.
-
-Wed Jan  7 21:15:07 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* sample/webrick/*: new files.
-
-	* MANIFEST: add sample/webrick/*
-
-Wed Jan  7 20:51:51 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/net/test_httpheader.rb: new file.
-
-	* MANIFEST: add test/net/test_httpheader.rb.
-
-Wed Jan  7 20:42:06 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (HTTPHeader#content_length): should return nil
-	  unless header exists. [ruby-dev:22519]
-
-Wed Jan  7 14:26:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb (TkPanedWindow): use epath for embedded windows.
-
-	* ext/tk/lib/tktext.rb: use epath for embedded windows.
-
-	* ext/tk/lib/tkcanvas.rb: use epath for window items.
-
-Wed Jan  7 14:24:04 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/soap/{attachment.rb,mimemessage.rb}: added from soap4r/1.5.2.
-
-Wed Jan  7 13:00:18 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
-	  being too eager to find matches of ambiguous method
-	  names (such as "ri Thread.join" would return both
-	  Thread.join and ThreadsWait.join)
-
-Wed Jan  7 12:35:41 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/debug.rb: revert command parse regexps.  [ruby-list:39014] by
-	  Shirai,Kaoru.
-
-Wed Jan  7 08:21:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parserfactory.rb: Check for shebang
-	  line in files that would otherwise be treated as
-	  plain text.
-
-Tue Jan  6 22:13:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_mod_modfunc): should break if m has no super class.
-	  [ruby-dev:22498]
-
-Tue Jan  6 21:51:37 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (fptr_finalize): should save errno just after failure.
-	  [ruby-dev:22492]
-
-Tue Jan  6 20:51:10 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* lib/logger.rb(Logger#msg2str): no special treatment for the object
-	  which responds to :to_str.
-
-	* lib/logger.rb(LogDevice#initialize): remove type checking if the
-	  given object is a String.  Kernel.open handles it correctly.
-
-	* test/logger/test_logger.rb: follow above change (ArgumentError ->
-	  TypeError.)
-
-Tue Jan  6 14:53:14 2004  Dave Thomas  <dave@pragprog.com>
-
-	* bin/ri: split out the display side, making it pluggable. Added
-	  new ri_driver and ri_display files in lib/rdoc/ri.
-
-Tue Jan  6 11:29:43 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* test/inlinetest.rb, test/{test_generator.rb,test_ipaddr.rb,
-	  test_pathname.rb,test_pp.rb,test_prettyprint.rb,test_set.rb,
-	  test_time.rb,test_tsort.rb: added.
-
-Tue Jan  6 09:38:27 2004  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
-
-	* import soap4r/1.5.2;
-
-	* lib/soap/{attachment.rb,baseData.rb,encodingstyle/soapHandler.rb}:
-	  introduce SOAPExternalReference class as a referenct to SOAPEnvelope
-	  external content.
-
-	* lib/soap/{attachment.rb,mimemessage.rb}: great SwA (SOAP messages
-	  with Attachments) support code by Jamie Herre.
-
-	* lib/soap/{element.rb,marshal.rb,parser.rb,processor.rb,
-	  streamHandler.rb,wsdlDriver.rb}: SwA support.
-
-	* lib/soap/rpc/{cgistub.rb,driver.rb,element.rb,proxy.rb,router.rb,
-	  soaplet.rb}: SwA support and refactoring.
-
-	* lib/soap/generator.rb, lib/soap/mapping/mapping.rb: follow
-	  SOAPReference#initialize signature change.
-
-	* lib/soap/mapping/factory.rb: deleted unused methods.
-
-	* lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
-	  string <-> Ruby class name matching.
-
-	* lib/xsd/datatypes.rb: check the smallest positive non-zero
-	  single-precision float exactly instead of packing with "f".
-	  [ruby-talk:88822]
-
-	* test/soap/test_basetype.rb, test/xsd/test_xsd.rb: use 1.402e-45, not
-	  1.4e-45.  1.4e-45 is smaller than 2 ** -149...
-
-	* test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb,
-	  test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0".
-
-	* test/soap/test_streamhandler.rb: revert to the previous test that
-	  warns "basic_auth unsupported under net/http".
-
-Tue Jan  6 06:37:53 2004  Dave Thomas  <dave@pragprog.com>
-
-	* bin/rdoc: Add --ri-system switch
-
-	* lib/.document: Update with list of files that seem to have
-	  documentation
-
-	* lib/test/unit.rb: Reorder comment to make it RDoc friendly.
-
-	* Makefile.in: add install-nodoc target, and make it
-	  generate RDoc on default install.
-
-	* lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
-	  --doc-dir option to ri.
-
-Tue Jan  6 00:04:40 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
-	  fix parsing if there are braces in a method parameter list
-
-Tue Jan  6 01:01:04 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/dir.h, win32/win32.c: fix patch miss.
-
-	* win32/Makefile.sub: fix file dependency.
-
-Mon Jan  5 20:32:00 2004  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/logger.rb: enhanced documentation.
-
-Mon Jan  5 18:58:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c: merge tuning from H.Yamamoto <ocean@m2.ccsnet.ne.jp>.
-	  [ruby-dev:22486]
-
-	* pack.c (pack_unpack): unpack requires big endian offet (OFF16B
-	  and OFF32B).  The patch is from Minero Aoki in [ruby-dev:22489]
-
-	* pack.c (OFF16B): add big-endian offset again.
-
-Mon Jan  5 03:00:53 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/ruby/test_pack.rb: new test test_unpack_N.
-
-Mon Jan  5 01:47:53 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): remove duplicated object files
-	  from $objs on DOSISH platforms.
-
-Sat Jan  3 02:44:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* rubysig.h (TRAP_END): preserve errno before switching context.
-	  [ruby-core:02137]
-
-Sat Jan  3 01:18:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c: merge tuning from H.Yamamoto <ocean@m2.ccsnet.ne.jp>.
-	  [ruby-dev:22476]
-
-Fri Jan  2 14:54:11 2004  Dave Thomas  <dave@pragprog.com>
-
-	* bin/ri: Add new --classes option, and arrange for
-	  help messages to be paged too.
-
-	* bin/rdoc: Add statistics.
-
-	* process.c: (MG) Added Process documentation
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
-	  Fix problem with labels not displaying in RI labeled
-	  lists using BS and ANSI modes.
-
-Fri Jan  2 01:50:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_eof): ARGF.eof? should not have any side effect.
-	  [ruby-dev:22469]
-
-Thu Jan  1 09:03:20 2004  Dave Thomas  <dave@pragprog.com>
-
-	* bin/ri (report_class_stuff): Fix problem with ambiguous nested
-	  classes not matching.
-
-Wed Dec 31 17:25:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_each_byte): should return self.  [ruby-dev:22465]
-
-Wed Dec 31 15:05:00 2003  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/pathname.rb: Corrected small coding error.
-
-Wed Dec 31 15:00:00 2003  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/pathname.rb: Completed documentation.
-
-Wed Dec 31 11:20:34 2003    <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
-	  file referenced in "// in sss.c" relative to current file.
-
-Wed Dec 31 11:17:37 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Fix problem when
-	  a public method was aliased, but the alias is then
-	  made private, and hence doesn't appear in RDoc output.
-
-Wed Dec 31 01:33:05 2003  Dave Thomas  <dave@pragprog.com>
-
-	* array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
-	  string.c, time.c: Add RDoc for Kernel functions, and tidy.
-
-Tue Dec 30 19:39:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_readline): should raise EOFError at the end of
-	  files.  [ruby-dev:22458]
-
-	* io.c (argf_read): should concatenate input files when length
-	  argument is nil. [ruby-dev:22450]
-
-	* io.c (argf_read): should update supplied string buffer (2nd
-	  argument) even when IO#read is called multiple times.
-
-	* io.c: should initialize lineno by zero. [ruby-dev:22460]
-
-Tue Dec 30 12:30:30 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
-	  class and a method have the same name, finding Xxx.abc was trying
-	  to find 'abc' in method 'Xxx', not class 'Xxx'.
-
-Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
-	  Handle undoing nsting of yield parameters correctly for:
-
-	    def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
-
-Tue Dec 30 07:30:00 2003  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/pathname.rb: Added documentation.
-
-Mon Dec 29 20:08:17 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (GenericRequest#initialize): check if path
-	  begins with '/'.
-
-	* lib/net/http.rb: def m( arg ) -> def m(arg)
-
-Mon Dec 29 12:51:02 2003  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c: Add RDoc for Kernel global functions.
-
-Mon Dec 29 11:00:16 2003  Dave Thomas  <dave@pragprog.com>
-
-	* array.c: Tidy up RDoc loose ends.
-
-Mon Dec 29 05:05:51 2003  Dave Thomas  <dave@pragprog.com>
-
-	* struct.c, random: Add RDoc comments
-
-Mon Dec 29 02:25:00 2003  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/optparse.rb: Improved documentation.
-
-Mon Dec 29 02:20:54 2003  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c: Add RDoc for class Proc, Method, UnboundMethod
-
-Mon Dec 29 02:20:26 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* instruby.rb: fix install directory if destdir and compile_dir are
-	  not in the same drive.
-
-	* ext/extmk.rb: ditto. [ruby-list:39009]
-
-	* win32/Makefile.sub, win32/README.win32, win32/configure.bat,
-	  win32/setup.mak: new configure scheme. use ``configure --prefix=dir''
-	  instead of ``nmake DESTDIR=dir install''.
-
-Mon Dec 29 00:41:44 2003  Dave Thomas  <dave@pragprog.com>
-
-	* math.c: Add RDoc comments
-
-Sun Dec 28 20:19:11 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
-	  raise EOFError.
-
-	* ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
-	  gzfile_read_all returns "".
-
-Sun Dec 28 15:25:08 2003  Dave Thomas  <dave@pragprog.com>
-
-	* class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
-	  Object, Module, etc...
-
-Sun Dec 28 11:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
-	  [ruby-talk:88852]
-
-	* test/csv/{bom.csv,mac.csv}: removed.
-
-Sun Dec 28 08:56:51 2003  Dave Thomas  <dave@pragprog.com>
-
-	* eval.c: Thead[Group] RDoc (thanks to MG)
-
-Sun Dec 28 03:50:05 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
-	  Escape method names used in regexp
-
-Sun Dec 28 01:46:02 2003  Dave Thomas  <dave@wireless_3.local.thomases.com>
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
-	  Add support for rules in 'ri' output.
-
-Sun Dec 28 01:35:35 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
-	  Sometimes the Ruby source aliases two otherwise
-	  unrelated methods (for example Kernel#object_id and
-	  Kernel#hash are both the same C function). Provide a
-	  facility to allow the methods to be documented
-	  separately.
-
-Sun Dec 28 01:05:31 2003  Dave Thomas  <dave@pragprog.com>
-
-	* marshal.c, signal.c: RDoc collemts added by Elliott Hughes
-
-Sun Dec 28 00:46:25 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
-	  Some Ruby source uses lower-case class names for the
-	  Init_Xxx C function name.
-
-Sat Dec 27 23:41:46 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: fix "test: too many arguments" error.
-
-Sat Dec 27 15:32:40 2003  Dave Thomas  <dave@wireless_3.local.thomases.com>
-
-	* time.c: Add RDoc comments for Time class.
-
-Sat Dec 27 15:07:26 2003  Dave Thomas  <dave@pragprog.com>
-
-	* object.c: Add RDoc comments for Symbol class.
-
-Sat Dec 27 14:39:53 2003  Dave Thomas  <dave@pragprog.com>
-
-	* numeric.c (Init_Numeric): Add RDoc comments.
-
-Sat Dec 27 00:44:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (next_argv): warn always for stdin on inplace edit mode.
-
-	* io.c (read_all): need to check string value.
-
-	* io.c (argf_read): allow ARGF.read(nil).  [ruby-dev:22433]
-
-Fri Dec 26 23:02:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_backquote): need not to check nil result.
-	  [ruby-core:02078]
-
-	* io.c (rb_io_getline): should return nil when read_all gives
-	  empty string, even when nil rs is specified. [ruby-core:02077]
-
-Fri Dec 26 18:33:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check if getcontext and setcontext are available.
-
-	* eval.c: use presence of getcontext/setcontext.
-
-Fri Dec 26 16:40:53 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
-
-Fri Dec 26 14:05:13 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/ruby/test_pack.rb: new test test_pack_N.
-
-Fri Dec 26 12:53:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): add sign check for 'i', and 'l'.
-	  [ruby-dev:22427]
-
-	* bignum.c (rb_quad_pack): add range check for 'quad int'.
-
-Fri Dec 26 10:58:58 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* MANIFEST: add vms/config.h and remove vms/config.h_in.
-
-Fri Dec 26 10:42:00 2003  AKIYOSHI, Masamichi <masamichi.akiyoshi@hp.com>
-
-	* io.c: [VMS] "rfm=stmlf" is specified for open() and fopen().
-
-Thu Dec 25 22:29:53 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* string.c (rb_str_update): don't return any value.
-
-Thu Dec 25 15:30:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_update): call rb_str_modify().
-
-Thu Dec 25 05:08:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (search_required): search actual file name once when no
-	  extension specified.
-
-Thu Dec 25 04:00:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* stable version 1.8.1 released.
-
-Thu Dec 25 00:17:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* configure.in: check for nanosleep, -lrt if required.
-	  [ruby-core:02059]
-
-	* eval.c (thread_timer): use select(2) if nanosleep(2) is not
-	  available.
-
-	* eval.c: check __stub_getcontext for glibc on some platforms.
-	  [ruby-list:38984]
-
-Wed Dec 24 23:48:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
-	  test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
-	  to express -0.0.  [ruby-talk:88786]
-
-Wed Dec 24 23:29:30 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/tsort.rb (test_orphaned_break): removed.
-
-Wed Dec 24 20:53:06 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkmulticolumnlist.rb: new sample
-
-	* ext/tk/sample/tkmultilistframe.rb: bug fix
-
-Wed Dec 24 20:37:37 2003  Eric Sunshine  <sunshine@sunshineco.com>
-
-	* configure.in (LDSHARED): Fixed typographical error in assignment of
-	  LDSHARED for Rhapsody which caused linking of extension modules to
-	  fail.
-
-Wed Dec 24 17:51:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (rb_thread_flock): enable thread support again.
-
-Wed Dec 24 16:46:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (catch_timer): do not call rb_thread_schedule() inside to
-	  avoid pthread_mutex_lock() deadlock.  interrupts to system calls
-	  are detected by TRAP_END via EINTR error.
-
-	* eval.c (thread_timer): do not post signal unless it is
-	  absolutely necessary.
-
-	* rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
-
-	* regex.c (re_compile_pattern): check if nextp is smaller than
-	  pend.  [ruby-dev:22372]
-
-	* eval.c (umethod_bind): remove method overridden check.
-	  [ruby-dev:22366]
-
-Wed Dec 24 16:13:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
-	  status by SSL_get_error().
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
-
-Wed Dec 24 14:23:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): clear the buffer argument
-	  when returning nil.  [ruby-dev:22363]
-
-	* test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
-	  add buffer argument tests.
-
-Wed Dec 24 14:07:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: Modules are allowed to rescue.
-
-	* lib/test/unit/autorunner.rb: show output_level in order.
-
-	* lib/test/unit/collector/dir.rb: get rid of successive same
-	  directories in load path.
-
-	* test/testunit/test_assertions.rb (test_assert_nothing_raised,
-	  test_assert_raise): test for modules.
-
-Wed Dec 24 13:43:34 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
-	  strings.
-
-Wed Dec 24 11:26:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/fileutils/test_fileutils.rb: should not create any
-	  files or directories in current directory.  [ruby-talk:88724]
-
-Wed Dec 24 10:29:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): never return nil at
-	  unlimited read.  [ruby-dev:22334]
-
-	* ext/stringio/stringio.c (strio_read): support second
-	  argument.  [ruby-dev:22350]
-
-Wed Dec 24 09:38:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (arg): should return 0 after error.  [ruby-dev:22360]
-
-Wed Dec 24 00:56:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (read_all): do not return nil at the end of file.
-	  [ruby-dev:22334]
-
-	* io.c (argf_read): do not depend on nil at eof behavior of
-	  IO#read().
-
-	* eval.c (rb_thread_join): dup exception before re-raising it.
-
-	* io.c (rb_io_eof): call clearerr() to prevent side effect.  this
-	  patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
-	  [ruby-dev:22234]
-
-	* pack.c (OFF16): get offset for big endian machines.
-
-	* pack.c (pack_pack): use OFF16 instead of OFF16B.
-	  [ruby-dev:22344]
-
-	* pack.c (pack_unpack): ditto.
-
-Tue Dec 23 22:47:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_check_readable): set FMODE_RBUF always, even if
-	  NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
-
-	* io.c (rb_io_check_writable): clear FMODE_RBUF before writing
-	  something.
-
-Tue Dec 23 22:25:00 2003  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/optparse.rb: incomplete RDoc documentation added in place of
-	  existing RD comments.  Tabs converted to spaces.
-
-Tue Dec 23 19:44:47 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/test_streamhandler.rb (test_basic_auth): removed.
-	  soap4r + basic_auth is not officially supported in ruby/1.8.1 even
-	  though soap4r + basic_auth + http-access2 should run fine.
-
-Tue Dec 23 19:42:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_ungetc): raise an exception at unread stream to
-	  avoid unspecified behavior.  [ruby-dev:22330]
-
-	* test/ruby/test_system.rb (test_syntax): glob relatively from
-	  __FILE__.
-
-Tue Dec 23 18:09:40 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_pack): remove unnecessary negative value check.
-	  [ruby-dev:22329]
-
-Tue Dec 23 17:26:55 2003  KONISHI Hiromasa   <konishih@fd6.so-net.ne.jp>
-
-	* bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
-
-Tue Dec 23 16:08:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/rexml/encodings/US-ASCII.rb: typo.  [ruby-talk:88650]
-
-	* test/ruby/test_system.rb: num of asserts depended on running dir.
-
-	* test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
-	  handle euc-jp.  install iconv, uconv or xmlscan.
-
-Tue Dec 23 14:13:51 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic::check_userinfo,
-	  URI::Generic::check_user, URI::Generic::check_password): tests
-	  conflicts/depends with other components closely.
-
-	* test/uri/test_generic.rb (TestGeneric::test_set_component):
-	  added tets.
-
-Tue Dec 23 11:08:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
-	  "euc-jp" might not be in supported encoding name list.
-	  [ruby-talk:88650]
-
-Tue Dec 23 06:10:31 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (CGI): add support for mod_ruby.
-
-	* lib/webrick/cgi.rb (CGI::Socket): add check for existence of
-	  OpenSSL module in all HTTPS related methods.
-
-	* lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
-	  value to OpenSSL::SSLSocket#cipher.
-
-	* lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
-	  set "connection: close" if @keep_alive is false.
-
-	* lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
-	  SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
-
-Mon Dec 22 23:00:05 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
-
-Mon Dec 22 21:59:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (map_charset): always ensure code is a String.
-
-Mon Dec 22 21:15:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (rb_mod_init_copy): always copy singleton class.
-	  [ruby-dev:22325]
-
-Mon Dec 22 20:44:36 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
-	  has no host-part.
-
-	* test/uri/test_generic.rb (TestGeneric::test_route): added a test.
-
-Mon Dec 22 20:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/cgi.rb: reduce eval.
-
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
-	  local_path.  [ruby-list:38883]
-
-Mon Dec 22 20:09:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/test_property.rb: remove duplicated test method.
-
-Mon Dec 22 18:22:04 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
-	  HAVE_ISINF definition to follow previous commits of missing.h
-	  and win32/win32.h.
-
-Mon Dec 22 17:23:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (ac_cv_func_setitimer): moved from defines.h
-
-	* defines.h, rubysig.h, signal.c: removed macro handling which
-	  should be done in configure.
-
-	* configure.in (intrinsics.h): check if present.
-
-	* ruby.h: include intrinsics.h if available.
-
-	* bignum.c, marshal.c: include ieeefp.h if available.
-
-	* missing.h (isinf): define as a macro if finite() and isnan()
-	  are available.  [ruby-core:02032]
-
-Mon Dec 22 17:07:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (mingw): set isnan, finite and isinf to yes.
-
-Mon Dec 22 13:40:19 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/property.rb: passing block by reference.
-
-Mon Dec 22 00:32:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
-	  ALLOW_INTS which may switch context.  [ruby-dev:22319]
-
-	* ext/syck/emitter.c (syck_emitter_write): str bigger than
-	  e->bufsize causes buffer overflow.  [ruby-dev:22307]
-
-Sun Dec 21 17:29:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (rb_check_inheritable): new function.  [ruby-dev:22316]
-
-	* intern.h: add prototype.
-
-	* eval.c (superclass): use rb_check_inheritable().
-
-	* object.c (rb_class_initialize): check argument validity.
-
-Sun Dec 21 16:25:10 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
-	  beginning of the argument.
-	  (Pathname#join): concatenate from the last argument.
-	  (Pathname#parent): just use Pathname#+.
-
-Sun Dec 21 00:12:37 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
-
-	* ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
-
-Sat Dec 20 21:59:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
-
-	* lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
-	  instead of Status: header field.
-
-	* lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
-
-Sat Dec 20 16:07:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Completion::complete): wrong
-	  Regexp for word boundary.  pointed out by Gavin Sinclair.
-
-	* lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
-	  missing.
-
-Sat Dec 20 11:40:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/yaml.rb (YAML::YAML): adjust Marshal version.
-
-Sat Dec 20 03:56:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_with_disable_interrupt): prohibit thread context
-	  switch during proc execution.  [ruby-dev:21899]
-
-Sat Dec 20 02:41:02 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb: add file. (yet another CGI library)
-
-	* MANIFEST: add lib/webrick/cgi.rb.
-
-Sat Dec 20 02:18:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-calculate-indent): proper indentation
-	  inside of parentheses.  [ruby-dev:22308]
-
-Fri Dec 19 21:24:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
-	  HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
-
-	* lib/webrick/https.rb (HTTPRequest#parse): should check presence
-	  of cert() method to detect SSLSocket.
-
-Fri Dec 19 22:56:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/property.rb (SOAP::Property#load): new method for loading
-	  property value into existing property tree.
-
-	* test/soap/test_property.rb: add test.
-
-Fri Dec 19 19:21:49 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
-	  should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
-
-Fri Dec 19 17:36:49 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkmultilistbox.rb: bug fix
-
-	* ext/tk/sample/tkmultilistframe.rb: new sample script
-
-Fri Dec 19 03:44:27 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httputils.rb (parse_form_data): should return an
-	  empty Hash if the body is empty.
-
-Thu Dec 18 21:47:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): should remove deffile if it's
-	  made by miniruby. based on nobu's patch.
-
-Thu Dec 18 21:44:21 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval.c (stack_extend): ignore inline optimization on VC7.
-
-	* win32/Makefile.sub (OS, RT): can override.
-
-	* win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
-	  option. based on Tietew's patch [ruby-dev:22289]
-
-Thu Dec 18 16:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
-	  return NULL.
-
-Thu Dec 18 15:27:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
-	  [ruby-dev:21678]
-
-Wed Dec 17 15:15:30 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
-	  String#[] if more than one arguments are specified.
-
-	* lib/delegate.rb: avoid using common instance name as "@obj".
-
-	* lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
-	  subclass of String, but DelegateClass(String).
-
-	* ext/curses/extconf.rb: restore function check for init_color.
-	  [ruby-list:38905]
-
-	* Makefile.in: need to specify $(MAINLIBS) for the miniruby
-	  generation rule.
-
-	* configure.in: better FreeBSD -lc_r support.
-
-Wed Dec 17 00:16:14 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c: new method
-	  StringScanner#beginning_of_line? (alias #bol?)
-
-	* ext/strscan/strscan.c: new method StringScanner#concat and #<<.
-
-	* ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
-	  nor freeze STR (allow destructive modification).
-
-	* test/strscan/test_stringscanner.rb: test new methods above.
-
-	* test/strscan/test_stringscanner.rb: test destructive string
-	  modification.
-
-Tue Dec 16 21:20:47 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb: don't use local variable `pp'.
-
-	* lib/prettyprint.rb: ditto.
-
-Tue Dec 16 13:20:43 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: condition bug of if statement on
-	  {pack,grid}_propagate methods
-
-Tue Dec 16 03:17:29 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
-
-	* test/yaml/test_yaml.rb: add test.
-
-Tue Dec 16 01:14:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (catch_timer): check rb_thread_crtical in main native
-	  thread.
-
-	* eval.c (thread_timer): just sends signals periodically, to
-	  prevent main native thread from receiving them in critical
-	  section.  [ruby-core:01959]
-
-Mon Dec 15 13:32:22 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (check_dirname): check string safety and remove extraneous
-	  trailing directory separators.  [ruby-dev:22279]
-
-	* file.c: renamed and externalized rb_path_next,
-	  rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
-
-	* intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
-	  rb_path_last_separator, rb_path_end.
-
-Mon Dec 15 09:27:46 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
-	  of rb_protect should take an argument of VALUE.
-
-Sun Dec 14 18:46:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/socket/socket.c (Init_socket): IPv6 is not supported although
-	  AF_INET6 is defined on MinGW.
-
-	* lib/ipaddr.rb (AF_INET6): workaround in the environment which does
-	  not support IPv6.
-
-Sat Dec 13 18:55:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/charset_alias.rb: preserve original order.
-
-	* ext/iconv/extconf.rb: remove wrapper file at clean.
-
-Sat Dec 13 18:09:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (thread_timer): use timer by sub-thread and nanosleep.
-	  [ruby-talk:87519]
-
-	* gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
-
-Sat Dec 13 17:17:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_alloc): cache the created object at first time.
-	  [ruby-talk:61288], [ruby-dev:22240]
-
-Sat Dec 13 09:01:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check ucontext.h.
-
-	* eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
-	  on ia64 or with native thread enabled.  [ruby-core:01932]
-
-Sat Dec 13 03:09:14 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
-
-	* test/yaml/test_yaml.rb: add test.
-
-Fri Dec 12 22:36:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
-	  "#{aCell}" and so on.
-
-	* test/csv/test_csv.rb: add tests.
-
-Fri Dec 12 19:33:06 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
-
-	* lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
-
-	* lib/fileutils.rb (rmdir_r): ditto.
-
-	* lib/fileutils.rb (fu_copy_dir): check if it is a directory after
-	  mkdir(2).
-
-Fri Dec 12 06:06:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_invoke): fix class name in warning message for
-	  define_method.  [ruby-dev:22235]
-
-Thu Dec 11 21:24:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
-
-	* ext/openssl/ossl.[ch]: ditto.
-
-	* ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
-
-Thu Dec 11 20:54:28 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
-	  mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
-
-	* lib/fileutils.rb (fu_list): call to_str for all arguments.
-
-Thu Dec 11 20:07:01 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/ftools.rb (makedirs): sync with fileutils.
-
-Thu Dec 11 19:53:03 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
-	  (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
-
-Thu Dec 11 19:08:02 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mkdir_p): check if it is a directory after
-	  mkdir(2) instead of before mkdir(2), to avoid race condition.
-	  [ruby-talk:87730]
-	  Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
-
-Thu Dec 11 18:49:30 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: def m( arg ) -> def m(arg).
-
-Thu Dec 11 11:39:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (ieeefp.h), numeric.c: needed for finite() on
-	  Solaris.  [ruby-core:01921]
-
-	* file.c (rb_stat_inspect): adjust format specifier.
-
-	* parse.c (arg_prepend): nodetype() is for debug use.
-
-	* ruby.h (ISASCII, etc): cast to int to get rid of warning.
-
-	* ruby.h (alloca.h): include even in GCC.  [ruby-core:01925]
-
-	* ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
-	  specifier.
-
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
-	  BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
-
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
-
-	* ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
-	  volatile.
-
-	* ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
-	  format specifier.
-
-	* ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
-	  define unless used.
-
-	* ext/pty/pty.c (getDevice): get rid of warning.
-
-	* ext/socket/socket.c (port_str, sock_s_getaddrinfo,
-	  sock_s_getnameinfo): FIX2INT() now returns long.
-
-	* ext/socket/socket.c (init_inetsock_internal): uninitialized
-	  variable.
-
-	* ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
-
-	* ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
-	  ISDIGIT() instead of isdigit() to avoid warnings and for
-	  platforms which don't support non-ascii charater.
-
-Wed Dec 10 19:28:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): set EOF flag at short read.
-	  [ruby-dev:22223], [ruby-dev:22224]
-
-Wed Dec 10 18:07:25 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
-
-Wed Dec 10 17:54:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): do not set EOF flag when
-	  requested length is zero.  [ruby-dev:22214]
-
-Wed Dec 10 17:17:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (read_all): should return given string even if data read is
-	  empty.  [ruby-dev:22207]
-
-Wed Dec 10 17:16:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): adjust behavior at reading
-	  beyond EOF to IO.  [ruby-dev:22205]
-
-	* test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
-	  beyond EOF.
-
-	* test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
-	  TestEOF::Seek test case.
-
-Wed Dec 10 15:01:19 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/monitor/test_monitor.rb (test_cond): use Queue#deq
-	  instead of sleep.
-
-Wed Dec 10 14:45:39 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
-	  for TIOCSCTTY on *BSD.  based on gotoyuzo's patch.
-	  (ruby-bugs:PR#1211)
-
-	* ext/pty/pty.c (establishShell): should close descriptors if fork
-	  failed.
-
-Wed Dec 10 12:53:05 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* win32/win32.h: define execv() using do_aspawn().
-
-	* process.c (proc_exec_v): remove #ifdef's which stopped needing.
-
-Tue Dec  9 23:32:23 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
-	  ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
-	  ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
-	  ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
-	  ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
-	  ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
-	  overrided instance methods, which are private methods on the super
-	  class, are changed to 'private'
-
-Tue Dec  9 19:53:02 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
-	  for host-part.
-
-	* test/uri/test_generic.rb (test_route): added tests for the above
-	  change.
-
-Tue Dec  9 14:10:48 2003  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
-	  to avoid clearing EOF flag.
-	  (rb_io_check_writable): ditto.
-
-Tue Dec  9 02:53:55 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkalignbox.rb: new sample script
-
-Tue Dec  9 00:45:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
-	  and made the former call the latter. [ruby-core:01890]
-
-	* test/testunit/test_assertions.rb: ditto.
-
-Tue Dec  9 00:07:35 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
-	  methods as delegates to WEBrick.
-
-	* test/soap/calc/{test_calc.rb,test_calc2.rb},
-	  test/soap/helloworld/test_helloworld.rb,
-	  test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
-	  follow the change.
-
-Mon Dec  8 22:48:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/autorunner.rb: remove dependency to a particular
-	  runner.  [ruby-core:01901], [ruby-list:38869]
-
-	* lib/test/unit/ui/testrunnerutilities.rb: moved output level
-	  constants from Console.
-
-	* lib/test/unit/ui/console/testrunner.rb: ditto.
-
-	* lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
-	  accept output_level.
-
-Mon Dec  8 15:03:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
-
-Mon Dec  8 13:02:11 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
-
-	* test/uri/test_common.rb: add test for URI.regexp.
-
-Mon Dec  8 12:44:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c: define swap16 and swap32 only if they are not
-	  defined. OpenBSD defines these macros. [ruby-dev:22181]
-
-Sun Dec  7 20:54:17 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/iconv/iconv.c (map_charset): make case sensitive.
-	  ext/iconv/charset_alias.rb (charset_alias): don't ignore
-	  config.charset's information.  sort aliases.
-
-Sat Dec  6 22:58:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
-	  SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
-	  but not finished the handshake process, we should retry it.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
-
-Sat Dec  6 21:45:10 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (flush_before_seek): flush before seek on any platform.
-
-	* configure.in: ditto.
-
-Sat Dec  6 17:23:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
-	  as well as downcase one.
-
-	* lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
-
-Fri Dec  5 23:22:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
-	  Test::Unit::Assertions::assert_nothing_raised): use the last
-	  argument as message unless class object.
-
-	* test/testunit/test_assertions.rb (test_assert_raises): test for
-	  multiple exception list.  [ruby-core:01891]
-
-	* test/testunit/test_assertions.rb (test_assert_nothing_raised): test
-	  for non-exception classes.
-
-Fri Dec  5 22:23:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/netHttpClient.rb: proxy support did not work.  fixed.
-
-	* lib/soap/property.rb: add class methods for loading property from
-	  stream/file/propertyfile.  propertyfile is a file which is located at
-	  somedir in $:.
-
-	* lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
-	  lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
-	  e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
-
-	* test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
-
-Fri Dec  5 17:26:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_exec_end_proc): maintain tmp_end_procs.
-	  [ruby-dev:22154]
-
-Fri Dec  5 13:36:59 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_exec_end_proc): should not clear end_procs and
-	  ephemeral_end_procs before execution. [ruby-dev:22144]
-
-	* eval.c (rb_obj_extend): call Module#extended hook after
-	  extended_object.  [ruby-list:38866]
-
-	* object.c (Init_Object): Module#extended defined.
-
-Fri Dec  5 13:17:30 2003  Tanaka Akira  <akr@m17n.org>
-
-	* test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
-
-Fri Dec  5 11:54:45 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): follow IO#read.
-
-	* test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
-	  test/stringio/test_stringio.rb: add EOF test.
-
-Fri Dec  5 02:49:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
-	  allow multiple exception list.  [ruby-core:01884]
-
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
-	  check whether arguments are subclass of Exception.
-
-Thu Dec  4 23:54:00 2003  Rick Ohnemus  <rick.ohnemus@systemware.com>
-
-	* dln.c (aix_loaderror): should not use member named 'errno' which
-	  might be a macro (e.g. on AIX).
-
-Thu Dec  4 23:32:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (read_all): do not depend on lseek position.
-	  [ruby-dev:22026]
-
-Thu Dec  4 22:37:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): preserve $! value when retry happens in the
-	  rescue clause.  [ruby-talk:86697]
-
-Thu Dec  4 21:50:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
-	  should rescue errors and re-raise DRbConnError on write too.
-	  [ruby-dev:22132]
-
-Thu Dec  4 16:41:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (exc_list): allow expanding list.  [ruby-dev:22134]
-
-Thu Dec  4 14:09:24 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb (test_cp): test if the error is
-	  kind of SystemCallError.  It is needless details that which errno
-	  is set on each systems.
-
-Thu Dec  4 13:24:13 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: use Object#__send__ instead of Object#send.
-
-Thu Dec  4 13:17:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/streamHandler.rb: support latest released version of
-	  http-access2.
-
-Thu Dec  4 13:04:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/soap.rb: add SOAP::Env module for environment repository
-	  such as HTTP_PROXY.
-
-	* lib/soap/property.rb: property implementation.
-
-	* lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
-	  lib/soap/rpc/driver.rb: use soap/property.rb.
-
-	* lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
-	  use SOAP::Env.
-
-	* lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
-	  management interface, but ignored for now.
-
-	* lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
-	  wiredump charset explicitly.  it was fixed to 'utf-8' when iconv or
-	  uconv module was found.
-
-Thu Dec  4 10:43:58 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
-	  feature.
-
-Thu Dec  4 10:27:12 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: update hyperlink to the Japanese document.
-
-Thu Dec  4 09:12:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
-	  the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
-
-Thu Dec  4 08:29:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  Exception to avoid unexpected aborting. [ruby-core:01853]
-
-	* lib/webrick/server.rb (GenericServer#start_thread): should check
-	  that peeraddr isn't nil before printing.
-
-	* lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
-	  rescue Exception to avoid unexpected aborting of thread.
-
-Thu Dec  4 03:48:59 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
-	  (Pathname#make_link, Pathname#make_symlink): new method.
-
-Thu Dec  4 01:45:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_read): should not terminate on empty string; wait
-	  until real EOF.  [ruby-dev:21969]
-
-	* io.c (argf_read): should adjust length to read, when length is
-	  specified and read spans command line argument files.
-
-Wed Dec  3 19:38:36 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
-
-Wed Dec  3 13:49:07 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
-
-	* ext/tk/lib/tkafter.rb: ditto.
-
-	* ext/tk/lib/tkcanvas.rb: ditto.
-
-	* ext/tk/lib/tkdialog.rb: ditto.
-
-	* ext/tk/lib/tktext.rb: ditto.
-
-Wed Dec  3 13:28:13 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (lex.c): try gperf first, and copy from the source
-	  directory if failed.  [ruby-dev:22123]
-
-	* ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
-
-	* lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
-
-Tue Dec  2 23:18:12 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: wrote the warning about HTTP_PROXY environment
-	  variable.
-
-Tue Dec  2 21:31:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bin/testrb: new test runner.  [ruby-core:01845]
-
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
-	  Test::Unit::AutoRunner#process_args): take test list to run and
-	  options.
-
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
-	  Test::Unit::AutoRunner#run): should not exit inside a library,
-	  just return the result instead.
-
-	* lib/test/unit.rb: ditto.
-
-	* test/runner.rb: exit with the test result.
-
-Tue Dec  2 20:18:48 2003  Eric Sunshine <sunshine@sunshineco.com>
-
-	* configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
-	  instead of Bison or byacc.
-
-	* parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
-	  10000 (Bison's default) since some old versions of Yacc define it as
-	  low as 150 by default, which is too low for Ruby to parse some files,
-	  such as date/format.rb.  Among other issues, the parse problem causes
-	  "make test" to fail.
-
-Tue Dec  2 20:03:20 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: check if Pathnames are usable
-	  for arguments.
-
-Tue Dec  2 04:22:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: fixed #assert_no_match message.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-Tue Dec  2 00:43:00 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.c: string buffering bug.  decrementing by full
-	  max_size now. [ruby-core:01834]
-
-Mon Dec  1 21:33:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (num_sadded): prohibit singleton method definition for
-	  Numerics.  fill yet another gap between Fixnum and Bignum.
-
-Mon Dec  1 17:33:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (htov16): converts endian using swap16. htov32(), hton16,
-	  hton32 as well. [ruby-talk:85377]
-
-	* pack.c (swap16): swap 2 bytes no matter how big short is on the
-	  platform.  swap32() is also prepared.
-
-	* numeric.c (rb_num2int): returns long to preserve information.
-	  rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
-	  [ruby-talk:85377]
-
-	* numeric.c (rb_num2uint): should not check for value range if the
-	  source value is negative.
-
-Mon Dec  1 17:14:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sample/optparse/opttest.rb: added.
-
-Mon Dec  1 16:10:52 2003  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
-
-Mon Dec  1 14:17:49 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
-	  Pathname for arguments. [ruby-core:01795]
-
-	* test/fileutils/test_fileutils.rb: does much strict test on
-	  "same" files detecting.
-
-Mon Dec  1 09:28:14 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): re-export $(XCFLAGS).
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
-
-Mon Dec  1 01:03:27 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
-	  and ARCH_FLAG.  [ruby-dev:22085]
-
-Sun Nov 30 20:18:07 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
-	  [ruby-core:01819]
-
-	* Makefile.in: add ARCH_FLAG to CFLAGS.
-
-	* Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
-
-	* lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
-
-	* lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
-
-	* Makefile.in: add ARCH_FLAG to DLDFLAGS.
-
-	* configure.in: should put getcwd in AC_CHECK_FUNCS, not
-	  AC_REPLACE_FUNCS.  [ruby-core:01826]
-
-Sun Nov 30 18:22:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
-	  DLDFLAGS and LDSHARED.
-
-	* configure.in: XCFLAGS for compiling ruby itself.  ARCH_FLAG is
-	  reflected in CFLAGS.
-
-	* lib/mkmf.rb: ditto.  do not import XCFLAGS from config.status.
-
-Sun Nov 30 17:37:36 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
-
-Sun Nov 30 13:02:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
-	  Conditional Expressions.
-
-	* lib/wsdl/soap/definitions.rb: refactoring - Move Method.
-
-	* test/xsd/{test_noencoding.rb,noencoding.xml}: new files.  test for
-	  encoding unspecified XML file parsing.
-
-	* test/wsdl/{test_fault.rb,map,datetime}: new files.  test of
-	  SOAPFault, dateTime and Apache's Map.
-
-Sun Nov 30 09:35:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_update): get rid of SEGV at just allocated String.
-	  [ruby-core:01812]
-
-Fri Nov 28 23:19:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (gc_mark): explicitly check mark recursion levels, instead
-	  of unreliable stack length.
-
-Fri Nov 28 22:49:56 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
-
-Fri Nov 28 21:44:40 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
-	  a directory for FreeBSD.
-
-Fri Nov 28 19:37:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (env_has_value, env_index): must match exactly.
-
-	* test/ruby/test_env.rb (test_has_value, test_index): condition for
-	  aboves.
-
-Fri Nov 28 17:59:20 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* test/ruby/test_env.rb: add tests for ENV.
-
-Fri Nov 28 17:47:46 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
-	  DRbConnError.
-
-Fri Nov 28 15:41:15 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
-	  argument.
-
-Fri Nov 28 14:41:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/streamHandler.rb: drop unused http parameters.
-
-	* lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
-	  lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
-	  lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
-	  under WSDL dynanic client environment.  fixed.
-
-	* test/wsdl/raa/*: add tests.
-
-	* lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
-	  bug of soap4r.  XSDDateTimeImple.to_time passed a Float to
-	  Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
-	  causes rounding error.
-
-	* test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
-
-Fri Nov 28 04:15:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (method_arity): used wrong Proc object.  [ruby-talk:86504]
-
-Fri Nov 28 00:47:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
-	  success, false as failure.  [ruby-dev:22067]
-
-	* eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
-	  ANSI macro instead of hard coded value.
-
-	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
-	  TYPEs.
-
-Thu Nov 27 22:05:48 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
-	  process to get the base address for the RSE backing store, so
-	  hardcode it for the moment.
-	  [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
-
-Thu Nov 27 17:36:42 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
-	  TkTimer#wait recieves the exception of the callback.
-	  The exception is kept on @return_value.
-
-Thu Nov 27 16:58:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
-
-Wed Nov 26 15:38:47 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/fileutils/test_fileutils.rb (test_ln_s): should take the
-	  existing symbolic link for OpenBSD.
-
-Wed Nov 26 04:48:42 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/token.c: removed YYTOKTMP references which
-	  were causing buffer overflows on large block scalars,
-	  comments, quoted scalars and plain scalars.
-
-	* ext/syck/rubyext.c: dynamic changing of buffer size.
-
-	* ext/syck/syck.h: default buffer size of 4k.
-
-Wed Nov 26 00:55:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
-
-	* lib/webrick/httpserver.rb (HTTPServer#run): should pass the
-	  request's keep_alive flag to the response.
-
-Tue Nov 25 21:41:35 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* defines.h (ENV_IGNORECASE): should define when DOSISH without
-	  human68k. [ruby-dev:22047]
-
-	* hash.c (env_has_value, env_index): don't ignore case of value.
-	  [ruby-dev:22048]
-
-Tue Nov 25 21:39:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (path_check_1): honor sticky bits always.
-	  [ruby-talk:86273]
-
-Tue Nov 25 20:02:14 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: do test in more deep
-	  directory.
-
-	* test/fileutils/test_nowrite.rb: ditto.
-
-Tue Nov 25 19:04:23 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
-	  refined.
-
-Tue Nov 25 18:13:30 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
-	  test. [ruby-dev:22045]
-
-	* test/fileutils/test_nowrite.rb: ditto.
-
-Tue Nov 25 17:52:11 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
-	  if the environment variable is case sensitive.
-
-Tue Nov 25 16:41:33 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
-	  removed.  this test requires extra libraries in soap4r/1.5.*.
-
-Tue Nov 25 16:24:42 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
-	  GPL2 -> Ruby's.
-
-	* lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
-	  lib/soap/streamHandler.rb: add interface to streamhandler.
-
-	* lib/soap/marshal.rb: raise error if parse fails.
-
-	* lib/soap/netHttpClient.rb: add https support.  Patched by
-	  Oliver M. Bolzer.
-
-	* lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
-
-	* lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
-	  lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
-	  using charset for parsing response from buggy server.
-
-	* lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
-	  typed multi-ref array.
-
-	* lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
-	  SOAPStruct which has multi-accessors which name are the same, to an
-	  array.
-
-	* lib/soap/rpc/element.rb: fixed illegal parameter order.
-
-	* lib/soap/rpc/element.rb: element name of response message could have
-	  the name other than 'return'.
-
-	* lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
-	  lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
-	  lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
-	  fault definition in a operation. [ruby-talk:84948]
-
-	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
-	  test for above fix.
-
-	* lib/wsdl/soap/complexType.rb: support WSDL array definition with
-	  maxOccures="unbound".
-
-	* lib/xsd/charset.rb: use cp932 under emx.  Patched by
-	  Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
-
-	* lib/xsd/xmlparser/parser.rb: set @charset nil by default.  Nil means
-	  'follow encoding declaration in XML'.
-
-	* sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
-	  sample/wsdl/googleSearch/sampleClient.rb,
-	  sample/wsdl/googleSearch/wsdlDriver.rb,
-	  test/wsdl/test_emptycomplextype.rb,
-	  test/wsdl/marshal/test_wsdlmarshal.rb,
-	  test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
-	  instead of File.open(...).read. [ruby-dev:21964]
-
-	* test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
-	  simplify the test case.
-
-	* test/wsdl/axisArray/*: add tests for axis's array encoding.
-
-Tue Nov 25 16:15:29 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ruby.h: don't treat Cygwin as Windows.
-
-Tue Nov 25 15:18:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: change default value of --enable-pthread (default: no)
-
-Tue Nov 25 07:31:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): allow newlines just before right argument
-	  parenthesis.  (ruby-bugs:PR#1221)
-
-Mon Nov 24 23:32:06 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
-	  catch/throw for redirection instead of exception.
-	  (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
-
-Mon Nov 24 19:59:48 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
-	  instead of HTTP_PROXY in the CGI environment.
-
-Mon Nov 24 19:32:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/etc/extconf.rb: check for pw_passwd in struct passwd and
-	  gr_passwd in struct group for DJGPP.
-
-	* ext/etc/etc.c: ditto.
-
-	* ext/Setup.dj: support for curses, etc, zlib.
-
-Mon Nov 24 17:00:00 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb: validate option names.
-	  :content_length_proc and :progress_proc option implemented.
-
-Mon Nov 24 14:53:10 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
-
-Sat Nov 22 23:09:45 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: set enable_pthread to no on MinGW.
-
-Sat Nov 22 22:56:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: add --enable-pthread option (default: yes)
-
-Sat Nov 22 22:48:46 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
-
-	* ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
-
-	* ext/tk/sample/tkcombobox.rb: new sample script
-
-	* ext/tcltklib/tcltklib.c: add native thread check
-
-Sat Nov 22 18:49:47 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
-	  libcruses returns no value, just like keypad().
-
-Sat Nov 22 17:36:36 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (HAVE_GETCWD): output to config.h.
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): output to config.status.
-
-Sat Nov 22 13:10:10 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
-
-Sat Nov 22 11:28:48 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (Init_stack): stack region is far smaller than usual if
-	  pthread is used.
-
-Sat Nov 22 07:30:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
-	  when an exception had no backtrace.
-
-	* test/testunit/util/test_backtracefilter.rb: ditto.
-
-Fri Nov 21 16:44:18 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
-	  substitutions on validatecommand option of TkEntry widget
-
-	* ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
-
-Fri Nov 21 16:12:11 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ruby.1: Fix markups and grammar.
-
-Fri Nov 21 14:49:42 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* ruby.1: wrote about ruby related environment variables.
-
-Fri Nov 21 12:28:03 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_extended): singleton methods should not be checked
-	  when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
-
-Fri Nov 21 01:40:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: check <pthread.h>
-
-	* ruby.h: include pthread.h if existence.
-	  define is_ruby_native() macro when not HAVE_NATIVETHREAD
-
-	* eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
-
-Fri Nov 21 00:43:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: use #__send__ instead of #send.
-
-	* lib/test/unit/testcase.rb: ditto.
-
-Thu Nov 20 19:19:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: don't find the Cygwin's pthread library on MinGW.
-
-Thu Nov 20 19:15:50 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
-	  have st_ino (always 0). [ruby-dev:21972]
-
-	* lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
-	  allow overwriting files by rename(2).
-
-	* test/fileutils/test_fileutils.rb: windows? ->
-	  have_drive_letter?, have_file_perm?
-
-Thu Nov 20 17:50:58 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkballoonhelp.rb: new sample script
-
-	* ext/tk/sample/tkmultilistbox.rb: ditto
-
-	* ext/tk/sample/tktextframe.rb: ditto
-
-Thu Nov 20 13:37:34 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ruby.h: define is_ruby_native_thread() for no native thread
-	  environment
-
-	* eval.c: ditto
-
-Thu Nov 20 12:42:47 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: always check existence of the pthread library
-
-	* ruby.h: define macros for ruby's native thread check
-
-	* eval.c: add ruby's native thread check
-
-	* gc.c: ditto
-
-Wed Nov 19 14:45:18 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (to_ary): print more friendly warning message.
-
-Wed Nov 19 14:32:08 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_same?): add djgpp and wince.
-
-	* lib/fileutils.rb (cannot_overwrite_file?): add wince.
-
-Wed Nov 19 11:04:47 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
-	  is same as mswin32.
-
-Wed Nov 19 07:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit.rb: do not run tests if $! is set.
-
-	* lib/test/unit/assertionfailederror.rb: extend StandardError instead
-	  Exception (irb catches the former but not the latter).
-
-Tue Nov 18 23:31:36 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* missing/memmove.c (memmove): take void *, not char *.
-
-	* missing.h (memmove): ditto.
-
-	* missing.h (strchr, strrchr): return char *, not int.
-
-Tue Nov 18 22:20:10 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_same?): temporal fix for windows.
-
-Tue Nov 18 19:05:04 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_same?): check by inode instead of path
-	  name, to detect two hard links pointing to the same content.
-
-	* test/fileutils.rb: did not create correctly looped symlinks.
-
-Tue Nov 18 18:23:05 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_read): behave as IO at empty string.
-	  [ruby-dev:21939], [ruby-dev:21941]
-
-	* ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
-
-	* ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
-	  clear EOF flag.
-
-	* test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
-
-Tue Nov 18 14:06:35 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
-	  [ruby-talk:85344] [ruby-core:01699]
-
-	* lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
-	  e.g. remote objects for receivers.
-
-	* lib/fileutils.rb: FileTest -> File.
-
-	* lib/fileutils.rb: put parentheses for arguments of File.xxxx?
-
-	* test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
-
-	* test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
-
-	* test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
-
-	* test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
-
-	* test/fileutils/test_fileutils.rb (test_install): test "install a a".
-
-	* test/fileutils/fileasserts.rb: new method assert_symlink.
-
-	* test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
-
-Mon Nov 17 19:38:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (getcwdofdrv): avoid using getcwd() directly, use
-	  my_getcwd() instead.
-
-	* merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
-	  <sunshine@sunshineco.com>.  [ruby-core:01596]
-
-Mon Nov 17 10:50:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Completion::complete): allow least
-	  common completion for three or more candidates.
-
-Mon Nov 17 09:41:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/ui/tk/testrunner.rb,
-	  lib/test/unit/ui/gtk/testrunner.rb:
-	  run GUI main loop in sub thread.
-
-	* lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
-
-	* lib/test/unit/autorunner.rb (keyword_display): sort keywords.
-
-Sun Nov 16 18:10:57 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): iterator should return value from next inside
-	  begin/rescue/end.  (ruby-bugs:PR#1218)
-
-Sun Nov 16 13:26:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): LINK check earlier than anything else,
-	  i.e. do not dump TYPE_IVAR for already dumped objects.
-	  (ruby-bugs:PR#1220)
-
-	* eval.c (rb_eval): call "inherited" only when a new class is
-	  generated; not on reopening.
-
-	* eval.c (eval): prepend error position in evaluating string to
-	  "mesg" attribute string only when it's available and is a
-	  string.
-
-Sun Nov 16 12:16:10 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/protocol.rb: logging response body. [experimental]
-	  [ruby-list:38800]
-
-Sun Nov 16 10:49:38 2003  Gavin Sinclair <gsinclair@soyabean.com.au>
-
-	* lib/thread.rb (Thread.exclusive): wrap method definition in
-	  class Thread to enable rdoc to process.
-
-Sun Nov 16 09:45:23 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (set_debug_output): warn if method is called
-	  after #start.  [ruby-dev:38798]
-
-Sun Nov 16 04:41:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): do not re-raise exception to avoid unnecessary
-	  exception copying, instead modify exception and internal
-	  information to adjust eval().
-
-	* eval.c (backtrace): can return the current frame information
-	  only if lev < -1.
-
-Sat Nov 15 22:16:42 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
-	  refine error message.
-
-Sat Nov 15 10:05:40 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
-	  refactored to support options.
-	  (Buffer): maintain size by this class.
-
-Sat Nov 15 07:40:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_method_node): new API to retrieve method body.
-
-Fri Nov 14 13:21:30 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
-
-	* ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
-	  argument [ruby-talk:85066]
-
-Thu Nov 13 20:53:35 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
-	  [ruby-ext:02251]
-
-Thu Nov 13 19:17:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
-	  (if available)
-
-Thu Nov 13 17:56:41 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
-	  reported by Take_tk <ggb03124@nifty.ne.jp>.
-	  [ruby-ext:02245]
-
-Thu Nov 13 16:45:53 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
-	  X509::Request#to_der.
-
-Thu Nov 13 11:31:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Completion#complete): prior shorter
-	  name to containing longer name.
-
-Thu Nov 13 06:08:54 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: stop freezing some classes
-
-	* ext/tk/lib/multi-tk.rb: ditto.
-
-Wed Nov 12 17:32:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
-	  uncaught throw in sub thread raises ThreadError.
-
-	* lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
-	  necessary.
-
-Wed Nov 12 14:09:43 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/monitor/test_monitor.rb: fix the timing problem by Queue.
-
-Wed Nov 12 12:59:44 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/monitor/test_monitor.rb: added.
-
-Wed Nov 12 10:14:28 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
-
-Wed Nov 12 06:11:39 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
-	  add functions to convert STACK into Array.
-
-	* ext/openssl/ossl.h: add prototypes.
-
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
-	  ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
-	  ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
-	  PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
-
-Wed Nov 12 00:47:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
-
-Tue Nov 11 23:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
-	  the case when the requested font is not available.
-
-Tue Nov 11 22:44:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (appendline): file may not end with newline.  a bug if
-	  READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
-
-Tue Nov 11 10:42:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: raise an exception when creating TkWindow
-	  object, because TkWindow class is an abstract class.
-
-Tue Nov 11 03:30:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
-	  if the specified value doesn't exist.
-
-	* lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
-	  a empty hash if the specified section doesn't exist.
-
-Mon Nov 10 11:40:29 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb (wait): return true on signal/broadcastfalse and
-	  false on timeout. Thanks Gennady Bystritsky.
-
-Mon Nov 10 00:07:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): primary_value may be 0 when syntax error.
-	  [ruby-talk:84893]
-
-Sun Nov  9 02:05:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
-	  maintain symmetry with #assert_nil. Also added better output for
-	  #assert_kind_of.
-
-	* test/testunit/tc_assertions.rb: ditto.
-
-Sat Nov  8 18:50:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
-	  reading.
-
-	* test/soap/marshal/*: backport from soap4r/1.5.1.  all differences are
-	  for ruby/1.6.
-
-	* lib/soap/*: backport from soap4r/1.5.1.  all differences are for
-	  ruby/1.6.
-
-	* lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
-	  ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
-	  [ruby-talk:84813]
-
-	* lib/wsdl/soap/definitions.rb: element name typo in custom exception
-	  struct definition which is needed for wsdlDriver; camelCase ->
-	  underscore_name.
-
-Sat Nov  8 13:49:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in: improvement of pthread check
-
-Sat Nov  8 13:28:46 2003 Takaaki Tateishi <ttate@ttsky.net>
-	* ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
-	  Thanks, Kaoru Shirai.
-
-Sat Nov  8 06:19:38 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
-	  TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
-	  (queueing a handler to the EventQueue).
-
-	* ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
-
-Fri Nov  7 23:23:04 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#+): if self or the argument is `.', return
-	  another.
-	  (Pathname#parent): if self is `.', return `..'.
-	  (Pathname#children): if self is `.', don't prepend self for a
-	  pathname in a result.
-	  (Pathname#join): re-implemented using Pathname#+.
-	  (Pathname#find): if self is `.', remove `./' prefix of yielding
-	  pathname.
-
-Fri Nov  7 10:23:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
-	  lookup failure.  (ruby-bugs:PR#1215)
-
-Fri Nov  7 04:08:05 2003  UENO Katsuhiro  <katsu@blue.sky.or.jp>
-
-	* ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
-	  an alias of Zlib::GzipReader#each.
-
-Fri Nov  7 01:03:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_load): save and restore rb_prohibit_interrupt.
-	  [ruby-dev:21857]
-
-Thu Nov  6 18:05:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_inspect): show the path also at a closed file.
-	  [ruby-dev:21851]
-
-Thu Nov  6 11:42:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_set_string, strio_reopen): check
-	  tainted.
-
-	* ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
-	  strio_putc): add infection.
-
-	* ext/stringio/stringio.c (strio_path): just nil.  [ruby-dev:21846]
-
-	* ruby.c (proc_options): reserve searched script path in the
-	  source file name table.  [ruby-list:38765]
-
-	* lib/optparse.rb (OptionParser::Completion#complete): default not to
-	  ignore case on completion.  [ruby-talk:84726]
-
-	* win32/win32.c (make_cmdvector): process backslashes even if a quote
-	  is not enclosed.
-
-Wed Nov  5 23:49:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* sample/openssl/gen_csr.rb: there (at least) is a CA which does not
-	  accept DN in UTF8STRING format.  it's a sample.
-
-Wed Nov  5 22:55:16 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* configure.in, eval.c, signal.c: : add '--with-pthread-ext'
-	  option to fix the pthread trouble on 'tcltklib'
-
-	* ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
-
-	* ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
-	  to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
-
-	* ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
-	  tk_menuSetFocus
-
-Wed Nov  5 17:33:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_load): allow interrupt during loaded program
-	  evaluation.  [ruby-dev:21834]
-
-	* hash.c (rb_hash_fetch): always warn if default argument and a
-	  block are supplied at the same time. [ruby-dev:21842]
-
-	* hash.c (env_fetch): ditto.
-
-	* array.c (rb_ary_fetch): ditto.
-
-Wed Nov  5 19:08:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
-	  do not remove next argument if empty value is placed.
-
-	* test/optparse: added.
-
-Wed Nov  5 17:05:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/ui/gtk/testrunner.rb: typo.
-
-Wed Nov  5 11:13:32 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* string.c: add #include "version.h". this file still depends on it.
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
-	  wince/Makefile.sub: add version.h dependency to string.c.
-
-Wed Nov  5 09:14:23 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: revert to the previous revision.
-
-Wed Nov  5 08:39:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
-
-	* lib/webrick/https.rb (HTTPRequest#meta_vars): create
-	  SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
-	  if no cert-chain was given.
-
-Tue Nov  4 23:44:48 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
-	  remove needless version.h dependency.
-
-Tue Nov  4 23:38:43 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* class.c, hash.c, string.c: remove #include "version.h".
-
-	* Makefile.in: remove needless version.h dependency.
-
-Tue Nov  4 06:54:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (read_all): fptr->f may be NULL, if IO is closed in the
-	  signal handler.
-
-	* io.c (io_read): ditto.
-
-	* string.c (get_pat): remove 1.8.0 warning code.
-
-	* string.c (rb_str_match): extend warning until 1.8.2.
-
-	* string.c (rb_str_match2): ditto.
-
-	* class.c (class_instance_method_list): remove 1.8.0 warnings.
-	  method_list now recurs.  [ruby-dev:21816]
-
-	* class.c (rb_obj_singleton_methods): ditto.
-
-	* array.c (rb_ary_select): remove select with block.
-	  [ruby-dev:21824]
-
-	* hash.c (rb_hash_select): ditto.
-
-	* hash.c (env_select): ditto.
-
-	* re.c (match_select): ditto.
-
-	* struct.c (rb_struct_select): ditto.
-
-Mon Nov  3 22:53:21 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/racc/parser.rb: synchronize with Racc 1.4.4.
-
-	* ext/racc/cparse/cparse.c: ditto.
-
-	* ext/racc/cparse/cparse.c (parse_main): should abort when
-	  the length of LR state stack <=1, not ==0.
-
-Mon Nov  3 08:50:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (check_uid_switch): remove duplicated error messages.
-
-	* process.c (check_gid_switch): ditto.
-
-Sun Nov  2 02:28:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/ssl.rb: new option :SSLExtraChainCert.
-
-Sun Nov  2 01:02:04 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* string.c (rb_str_hash): Update the HASH_PERL alternative hash
-	  algorithm in sync with Perl 5.8.
-
-	* st.c (strhash): Ditto.
-
-Sat Nov  1 18:21:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
-	  SSLSocket#peer_cert_chain.
-
-	* ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
-	  which returns underlying X509_REQ.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
-	  ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
-	  ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
-	  use underlying C struct without duplication not to leak momory.
-
-Sat Nov  1 01:49:03 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/mapping/factory.rb: mark marshalled basetype objects when
-	  @allow_original_mapping is true.  multi-referencing basetype node is
-	  prohibited in SOAP/1.1 encoding but soap4r's original ruby object
-	  mapping requires basetype to be marked to detect self referencing
-	  loop.  e.g. o = 1; o.instance_eval { @iv = o }  soap4r's original
-	  mapping is only used through soap/marshal API.
-
-	* test/soap/marshal/test_marshal.rb: add tests for self referencing
-	  immutable objects.
-
-	* test/soap/calc/test_calc_cgi.rb: fix test name.
-
-Fri Oct 31 22:26:29 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
-
-	* wince/string_wce.c (strrchr): should decrement pointer.
-
-	* wince/Makefile.sub: correct a range of isdigit().
-
-Fri Oct 31 12:55:24 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
-	  [ruby-dev:21791]
-
-	* bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
-
-Fri Oct 31 01:38:14 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
-	  at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
-
-Fri Oct 31 01:02:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* compar.c (cmp_equal): protect exceptions from <=> comparison
-	  again.  returns nil if any exception or error happened during
-	  comparison.
-
-	* eval.c (search_required): should update *featurep when DLEXT2 is
-	  defined. (ruby-bugs-ja:PR#581)
-
-Thu Oct 30 23:41:04 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: add DRbArray
-
-	* lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
-
-	* lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
-
-Thu Oct 30 23:19:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/generator.rb: better XML pretty printing.
-
-	* lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
-	  assignment in the element which has "encodingStyle" attribute, and
-	  add necessary namespace assignment for "arrayType" attribute.
-
-	* test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
-	  through CGI.
-
-Thu Oct 30 22:59:39 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/yaml2byte.c: HASH const too long.  Thanks, matz.
-
-Thu Oct 30 19:13:53 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/syck/MANIFEST: Add yamlbyte.h.
-
-Thu Oct 30 14:25:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
-	  buffer filled.
-
-	* io.c (rb_io_fptr_cleanup): move path deallocation to
-	  rb_io_fptr_finalize (finalizer called by GC).
-
-Thu Oct 30 13:23:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (logop): left may be NULL. [ruby-talk:84539]
-
-	* eval.c (rb_eval): NODE_CASE nd_head may be NULL.
-
-Thu Oct 30 10:14:51 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/test/unit/autorunner.rb: make fox runner work.
-
-Thu Oct 30 09:32:26 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* process.c (rb_f_system): fixed lack of security check before
-	  calling do_spawn() on win32. [ruby-talk:84555]
-
-Thu Oct 30 02:46:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): single array value to normal Proc#call
-	  (i.e. not via lambda call), should be treated just like yield.
-	  [ruby-dev:21726]
-
-Thu Oct 30 02:25:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
-	  add new method to inherit @sync from @io.sync.
-
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
-	  set sync flag explicitly.
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
-	  certificates in @extra_chain_cert.
-
-Wed Oct 29 22:02:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
-	  interpreter to exec, instead of test/ruby/envutil.rb,
-
-Wed Oct 29 19:58:59 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
-	  defined and TCL_MAJOR_VERSION >= 8.
-
-	* ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
-	  rb_threadVwaitProc): use CONST84 instead of CONST.
-
-	* ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
-	  ip_rb_threadTkWaitCommand): use CONST84 always.
-
-Wed Oct 29 17:27:05 2003  Tanaka Akira  <akr@m17n.org>
-
-	* re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
-
-	* lib/pathname.rb (realpath): examine Dir.pwd because it may have
-	  symlinks.
-
-Wed Oct 29 17:16:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_longjmp): must not disturb original jump.
-	  [ruby-dev:21733]
-
-Wed Oct 29 15:28:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (Init_Proc): taint preallocated exception object
-	  sysstack_error. [ruby-talk:84534]
-
-Wed Oct 29 11:27:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (ret_args): node may be NULL. [ruby-talk:84530]
-
-Tue Oct 28 15:20:12 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
-	  WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
-	  ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
-	  rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
-	  ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
-	  avoid VC++ warnings.
-
-Mon Oct 27 19:19:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_longjmp): ignore reentering error while warning.
-	  [ruby-dev:21730]
-
-Mon Oct 27 00:23:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
-	  calling 'exit' in the Tk callback procedure. [ruby-list:38656]
-
-Sat Oct 25 09:18:04 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_method_missing): protect exception from within
-	  "inspect".  (ruby-bugs:PR#1204)
-
-Fri Oct 24 23:26:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_hash_each): Hash#each should yield single value.
-	  [ruby-talk:84420]
-
-	* hash.c (env_each): ditto for ENV.each.
-
-Thu Oct 23 20:25:32 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  IOError from IO::accept. [ruby-dev:21692]
-
-Thu Oct 23 17:59:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): initialize stack bottom for embedding.
-	  [ruby-dev:21686]
-
-	* ext/dl/extconf.rb: move list of files to clean from DEPEND file,
-	  to get rid of macro redefinitions.
-
-Thu Oct 23 13:44:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y: integrate operations for stack_type.  [ruby-dev:21681]
-
-Thu Oct 23 00:41:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/calc/*, test/soap/helloworld/*: set logging threshold
-	  to ERROR.
-
-Wed Oct 22 12:53:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  ignore tests which raised LoadError.
-
-	* test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
-	  test/ruby/test_system.rb: avoid requiring same file twice.
-
-	* test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
-	  ARGV unless invoked directly.  do not create test cases unless
-	  required libraries are available.
-
-Wed Oct 22 02:31:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): should not ignore exit_value in END
-	  execution. [ruby-dev:21670]
-
-Tue Oct 21 23:16:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): call finalizers and exit procs before
-	  terminating threads.
-
-	* eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
-
-Tue Oct 21 15:57:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  prepend the directory of target file to the load path.
-
-Tue Oct 21 15:08:53 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* win32/win32.c (do_spawn, do_aspawn): should wait child process even
-	  if callded with P_OVERLAY.
-
-	* win32/win32.c (do_spawn, do_aspawn): should return child's exit
-	  status to parent.
-
-Tue Oct 21 00:35:02 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/calc/*, test/soap/helloworld/*: catch the exception from
-	  test server thread and recover.
-
-Tue Oct 21 00:22:57 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/*: import drb/runit.
-
-Mon Oct 20 23:55:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): set current node after arguments evaluation.
-	  [ruby-dev:21632]
-
-	* eval.c (rb_yield_0): set current node and keep it at local jump.
-
-Mon Oct 20 22:01:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_cleanup): keep thread group for main thread.
-	  [ruby-dev:21644]
-
-Mon Oct 20 18:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_catch): backout.
-
-Mon Oct 20 17:31:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
-	  destination.
-
-	* eval.c (localjump_destination): use unique number in ruby_frame
-	  for localjump destination.
-
-Mon Oct 20 11:31:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_signal.rb (test_signal): restore old trap.
-
-Mon Oct 20 11:00:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (gc_sweep): loosen page free condition to avoid add_heap()
-	  race condition. [ruby-dev:21633]
-
-	* gc.c (gc_sweep): do not update malloc_limit when malloc_increase
-	  is smaller than malloc_limit.
-
-Mon Oct 20 09:45:12 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* lib/debug.rb (debug_command): remove debug print.
-
-Sun Oct 19 13:12:30 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
-
-Sun Oct 19 00:14:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
-	  server. (17171)
-
-Sat Oct 18 23:01:32 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
-
-Sat Oct 18 05:48:59 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: YAML::Syck::compile method.
-
-	* ext/syck/syck.c: Buffer edge bug.
-
-	* ext/syck/yaml2byte.c: YAML to bytecode converter.
-
-	* ext/syck/yamlbyte.h: Ditto.
-
-	* ext/syck/bytecode.c: Bytecode parser fixes to empty collections
-	  and empty strings.
-
-	* ext/syck/token.c: Ditto.
-
-Fri Oct 17 23:07:38 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
-	  Provide Kernel#to_enum as an alias for Kernel#enum_for.  Maybe
-	  this is a better name.
-
-Fri Oct 17 23:00:30 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/generator.rb: Add rdoc documentation.
-
-Fri Oct 17 22:16:42 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/set.rb: Reword and fix Overview.
-
-	* lib/set.rb: It is not necessary to require
-	  'test/unit/ui/console/testrunner'.
-
-Fri Oct 17 11:15:22 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* test/ruby/test_range.rb: added.
-
-	* MANIFEST: add test/ruby/test_range.rb.
-
-Fri Oct 17 03:21:23 2003  William Sobel  <will.sobel@barra.com>
-
-	* ext/socket/socket.c (make_hostent): h_aliases may be NULL.
-	  (ruby-bugs:PR#1195)
-
-	* ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
-
-Fri Oct 17 00:12:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
-	  without initializing on TkComposite module.
-
-Thu Oct 16 23:51:04 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
-	  in a callback operation, Ruby/Tk shows a (verbose) backtrace
-	  information on the callback process.
-
-Thu Oct 16 17:09:19 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
-	  debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
-
-Thu Oct 16 16:54:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_upto): ("a"..."a").to_a should return [].
-	  [ruby-core:01634]
-
-Thu Oct 16 16:40:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb:
-	  Add Tk::EncodedString and Tk::UTF8_String class to support
-	  characters using the \uXXXX escape to the UNICODE string.
-
-	* ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
-	  new demo-scripts (samples of Tk::UTF8_String)
-
-	* ext/tk/sample/{demos-en,demos-jp}/widget
-	  add entries for 'unicodeout.rb'
-
-Thu Oct 16 08:38:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/digest/test_digest.rb (test_eq): show failed class.
-
-	* test/ruby/test_iterator.rb (test_break, test_return_trace_func):
-	  test localjump destination.
-
-Wed Oct 15 20:22:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
-	  instance_eval('path_query').  [ruby-list:38575]
-
-Wed Oct 15 17:24:45 2003  URABE Shyouhei  <root@mput.dip.jp>
-
-	* lib/cgi.rb (CGI::Cookie): tiny typo fix.
-
-Wed Oct 15 15:00:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_run): just return FAILURE instead of parse error
-	  count.  [ruby-list:38569]
-
-Wed Oct 15 13:17:02 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/digest/digest.c (rb_digest_base_alloc): need to initialize
-	  buffer. [ruby-dev:21622]
-
-Wed Oct 15 11:23:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): dump extended modules as well.
-
-	* marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
-	  modules before invoking marshal_load.  these two fixes are done
-	  by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
-
-Wed Oct 15 09:30:34 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
-
-	* ext/syck/syck.h: include stdio.h for definition of FILE.
-
-Wed Oct 15 08:09:07 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/bytecode.c: Checkin of YAML bytecode support.
-
-	* ext/syck/gram.c: Ditto.
-
-	* ext/syck/syck.c: Ditto.
-
-	* ext/syck/token.c: Ditto.
-
-	* ext/syck/handler.c: Ditto.
-
-	* ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
-
-	* ext/syck/rubyext.c: Ditto (on both counts).
-
-Wed Oct 15 05:05:53 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/generator.rb: A new library which converts an internal
-	  iterator to an external iterator.
-
-	* lib/abbrev.rb: A new library which creates an abbreviation table
-	  from a list.
-
-Wed Oct 15 04:31:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
-	  new demo-scripts
-
-	* ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
-	  add entries for 'entry3.rb'
-
-Wed Oct 15 04:31:47 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* test/digest/test_digest.rb: Moved from ext/digest/test.rb.
-
-Wed Oct 15 03:53:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
-	  on the last commit).
-
-Wed Oct 15 00:25:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (yylex): argument parentheses preceded by spaces should
-	  be warned; not error.  [ruby-talk:84103]
-
-Wed Oct 15 00:20:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
-	  switch on threads smoothly and avoid seg-fault.
-
-	* ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
-	  _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
-	  and tkwait command wait on an eventloop.)
-
-	* ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
-	  _thread_tkwait.
-
-	* ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
-	  If 1st argument is true, waits on a thread. If false, waits on
-	  an eventloop. If 2nd argument is true, checks existence of
-	  rootwidgets. If false, doesn't. Default is wait(true, false).
-
-	* ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
-	  TkVariable#wait(arg, true). wait_visibility and wait_destroy
-	  have an argument for waiting on a thread or an eventloop.
-
-	* ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
-
-	* ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
-	  an eventloop'.
-
-Wed Oct 15 00:10:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
-	  SOAPBasetype and SOAPCompoundtype.
-
-	* lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
-	  Encoding methods signature change.  Pass SOAPGenerator as a parameter.
-
-	* lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
-	  for better marshalling/unmarshalling support.  Now I think SOAP
-	  marshaller supports all kind of object graph which is supported by
-	  Ruby's original marshaller.  Of course there could be bugs as always.
-	  Find it.  :-)
-
-	* lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
-	  DEBUG is too noisy.
-
-	* lib/xsd/datatypes.rb: DateTime#of is obsoleted.  Use DateTime#offset.
-
-	* test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
-	  useless warning.
-
-Tue Oct 14 19:09:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_finalize_0): return the given exit status unless
-	  SystemExit got raised.
-
-Tue Oct 14 11:53:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* intern.h (ruby_stop): never return.
-
-	* ruby.h (ruby_run): ditto.
-
-Tue Oct 14 04:43:55 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (realpath): make ELOOP check bit more robust.
-	  (children): prepend self by default.
-	  (chroot): obsoleted.
-
-Tue Oct 14 02:29:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_require_safe): segfault after loading .so.
-
-Tue Oct 14 02:05:23 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
-	  module for the Enumerable interface.
-
-Mon Oct 13 23:55:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
-	  not "ruby".
-
-Mon Oct 13 23:57:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_feature_p): match by classified suffix.
-
-	* eval.c (rb_require_safe): require library in the specified safe
-	  level.
-
-	* variable.c (rb_autoload, rb_autoload_load): restore safe level
-	  when autoload was called.  [ruby-dev:21338]
-
-	* intern.h: prototypes; rb_require_safe.
-
-	* test/runner.rb: accept non-option arguments.
-
-Mon Oct 13 20:49:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_new4): should not preserve FL_TAINT status in the
-	  internal shared string. [ruby-dev:21601]
-
-	* string.c (rb_str_new4): ditto.
-
-	* eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
-
-	* process.c: ditto. [ruby-list:38521]
-
-Mon Oct 13 19:51:02 2003  Koji Arai  <jca02266@nifty.ne.jp>
-
-	* lib/debug.rb (debug_command): should enter emacs mode when
-	  assigned any value to the environment variable "EMACS".
-	  On Meadow, (getenv "EMACS") is "meadow".
-
-Sun Oct 12 14:45:03 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/win32ole/extconf.rb: check "windows.h", not "windows".
-	  [ruby-talk:84051]
-
-Sat Oct 11 20:41:03 2003  Corinna Vinschen  <corinna@vinschen.de>
-
-	* file.c (eaccess): Use access(2) on Cygwin.
-
-Sat Oct 11 17:09:21 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/rexml/quickpath.rb (REXML::QuickPath::match):
-	  escape '[' to avoid warning.
-
-Sat Oct 11 16:08:41 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (realpath): check existence of the file.
-
-	* lib/pathname.rb (realpath): re-implemented.
-	  (realpath_root?, realpath_rec): removed
-
-Sat Oct 11 10:19:39 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
-	  Bystritsky.
-
-Fri Oct 10 07:50:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (is_defined): inheritance line adjustment as like as
-	  rb_call_super().
-
-Fri Oct 10 01:19:00 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
-	  optional argument to specify the DirectoryString type
-	  (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
-	  for DirectoryString, and strongly requires to use UTF8String for
-	  all certificates issued after December, 31 2003.
-
-	* ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
-
-Thu Oct  9 23:50:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_start_0): prevent thread from GC.
-	  [ruby-dev:21572]
-
-Thu Oct  9 19:11:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_start_0): non-volatile should be restored from
-	  volatile.
-
-Thu Oct  9 17:43:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_save_safe_level, proc_get_safe_level,
-	  proc_set_safe_level): save/restore safe level 1..4.
-
-Thu Oct  9 16:33:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (r_object0): remove unnecessary iv restoration for
-	  USRMARSHAL. [ruby-dev:21582]
-
-	* marshal.c (w_object): dump generic instance variables from
-	  a string from '_dump'.
-
-	* variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
-	  is not set.
-
-	* time.c (time_dump): copy instance variables to dumped string, to
-	  be included in the marshaled data.
-
-	* bignum.c (rb_big2ulong): add range check to ensure round trip.
-
-Thu Oct  9 15:45:27 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (uv_to_utf8): change message to "out of range", since
-	  negative values are not "too big". [ruby-dev:21567]
-
-Thu Oct  9 14:05:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
-	  [ruby-dev:21557]
-
-Thu Oct  9 10:51:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_yield_0): no error if block is empty.
-
-Thu Oct  9 06:43:33 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (localjump_error): id should be ID.
-
-	* eval.c (rb_eval): nd_rval is set in copy_node_scope().
-
-	* eval.c (rb_yield_0): unused variable.
-
-	* eval.c (rb_yield_0): nothing to do for empty node.
-
-	* eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
-	  [ruby-dev:21551]
-
-	* eval.c (rb_thread_start_0): set the value by break as the result.
-	  [ruby-dev:21552]
-
-	* eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
-	  variables across THREAD_SAVE_CONTEXT.
-
-Thu Oct  9 12:05:46 2003  Eric Sunshine <sunshine@sunshineco.com>
-
-	* configure.in: revived NextStep, OpenStep, and Rhapsody ports which
-	  had become unbuildable; enhanced --enable-fat-binary option so that
-	  it accepts a list of desired architectures (rather than assuming a
-	  fixed list), or defaults to a platform-appropriate list if user does
-	  not provide an explicit list; made the default list of architectures
-	  for MAB (fat binary) more comprehensive; now uses -fno-common even
-	  when building the interpreter (in addition to using it for
-	  extensions), thus allowing the interpreter to be embedded into a
-	  plugin module of an external project (in addition to allowing
-	  embedding directly into an application); added checks for
-	  <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
-	  ensures that -I/usr/local/include is employed when extensions'
-	  extconf.rb scripts invoke have_header() since extension checks on
-	  NextStep and OpenStep will fail without it if the desired resource
-	  resides in the /usr/local tree; fixed formatting of --help message.
-
-	* Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
-	  invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
-	  (see configure's --enable-fat-binary option); added rule for new
-	  missing/getcwd.c.
-
-	* defines.h: fixed endian handling during MAB build (see configure's
-	  --enable-fat-binary option) to ensure that all portions of the
-	  project see the correct WORDS_BIGENDIAN value (some extension modules
-	  were getting the wrong endian setting); added missing constants
-	  GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
-	  and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
-	  define in NeXT section.
-
-	* dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
-	  NextStep since, on some installations, this value always resolves
-	  uselessly to zero.
-
-	* dln.c: added error reporting to NextStep extension loader since the
-	  previous behavior of failing silently was not useful; now ensures
-	  that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
-	  for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
-	  on Rhapsody since this header lacks multiple-include protection,
-	  which resulted in "redefinition" compilation errors.
-
-	* main.c: also create hard reference to objc_msgSend() on NeXT
-	  platforms (in addition to Apple platforms).
-
-	* lib/mkmf.rb: now exports XCFLAGS from configure script to extension
-	  makefiles so that extensions can be built MAB (see configure's
-	  --enable-fat-binary option); also utilize XCFLAGS in cc_command()
-	  (but not cpp_command() because MAB flags are incompatible with
-	  direct invocation of `cpp').
-
-	* ext/curses/extconf.rb: now additionally checks for presence of these
-	  curses functions which are not present on NextStep or Openstep:
-	  bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
-	  setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
-	  wscrl(), wsetscrreg()
-
-	* ext/curses/curses.c: added appropriate #ifdef's for additional set of
-	  curses functions now checked by extconf.rb; fixed curses_bkgd() and
-	  window_bkgd() to correctly return boolean result rather than numeric
-	  result; fixed window_getbkgd() to correctly signal an error by
-	  returning nil rather than -1.
-
-	* ext/etc/etc.c: setup_passwd() and setup_group() now check for null
-	  pointers before invoking rb_tainted_str_new2() upon fields extracted
-	  from `struct passwd' and `struct group' since null pointers in some
-	  fields are common on NextStep/OpenStep (especially so for the
-	  `pw_comment' field) and rb_tainted_str_new2() throws an exception
-	  when it receives a null pointer.
-
-	* ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup().
-
-	* ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
-	  gethostbyaddr(), and gethostbyname() from (const char*) to non-const
-	  (char*) for older platforms such as NextStep and OpenStep.
-
-	* ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup(); include
-	  <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
-	  argument of gethostbyaddr() and getservbyname() from (const char*) to
-	  non-const (char*) for older platforms.
-
-	* ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup().
-
-Wed Oct  8 22:19:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit.rb: removed installation instructions.
-
-	* lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
-	  central location.
-
-	* lib/test/unit.rb: ditto.
-
-	* lib/test/unit.rb: extracted the running code in to AutoRunner.
-
-	* lib/test/unit/autorunner.rb: added.
-
-	* lib/test/unit/collector/objectspace.rb: extracted common test
-	  collection functionality in to a module.
-
-	* lib/test/unit/collector.rb: ditto; added.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-	* lib/test/unit/collector/dir.rb: added. Supports collecting tests out
-	  of a directory structure.
-
-	* test/testunit/collector/test_dir.rb: added.
-
-	* test/runner.rb: simplified to use the new capabilities.
-
-Tue Oct  7 15:23:09 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
-
-	* test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
-
-	* test/ruby/endblockwarn.rb: new file added to test of END-in-method
-	  warning.
-
-Tue Oct  7 12:23:47 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
-
-	* ext/socket/extconf.rb: useless assignment removed.
-
-Tue Oct  7 09:13:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
-	  allowed in eval.
-
-Tue Oct  7 04:15:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt): should not expand mrhs if lhs is solely starred.
-
-Tue Oct  7 02:57:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (stmt): rhs of multiple assignment should not be
-	  expanded using "to_a". [ruby-dev:21527]
-
-Tue Oct  7 01:42:34 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
-	  free function for ASN1_OBJECT.
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
-	  ASN1::ObjectId#sn; it returns short name text representation of OID.
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
-	  ASN1::ObjectId#ln; it returns long name text representation of OID.
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
-	  ASN1::ObjectId#oid; it returns numerical representation of OID.
-
-Mon Oct  6 22:59:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
-	  respond_to?(:binmode).  record separator was wrong when you gave
-	  text mode IO to Reader.parse and Writer.generate.
-
-	* test/csv/test_csv.rb: add tests for above change.
-
-Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
-
-	* ext/socket/socket.c (thread_read_select): restored.
-
-Mon Oct  6 16:23:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_object): wrong method name in the message.
-
-Mon Oct  6 16:02:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (stmt): END in method should cause warning.
-	  [ruby-dev:21519]
-
-Mon Oct  6 15:17:23 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_iterator.rb (test_block_argument_without_paren):
-	  added. (follows sample/test.rb)
-
-Mon Oct  6 11:57:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
-	  test for eval-ed BEGIN END order.
-
-Mon Oct  6 09:19:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): should pass "weak" value to next level.
-	  [ruby-dev:21496]
-
-	* eval.c (proc_alloc): should not use cached object if klass is
-	  different. [ruby-talk:83685]
-
-Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: version information is added in document.
-
-Sun Oct  5 23:07:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_f_END): block should be given.  [ruby-dev:21497]
-
-Sun Oct  5 22:51:23 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/ext/openssl/extconf.rb: add check for some engine functions
-	  unavailable in OpenSSL-0.9.6.
-
-	* lib/ext/openssl/ossl_engine.c: ditto.
-
-Sun Oct  5 17:56:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): fix evaluation order.  [ruby-list:38431]
-
-Sun Oct  5 15:05:06 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/uri/*: translated RUNIT to Test::Unit.
-
-Sun Oct  5 14:37:39 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
-
-	* test/soap/marshal/test_marshal.rb: ditto.
-
-	* test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
-	  RUBYBIN.
-
-Sun Oct  5 13:47:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
-	  about scope, order and allowed syntax.
-
-Sun Oct  5 11:54:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/envutil.rb: added.  split "rubybin" from test_system.rb.
-
-	* test/ruby/test_system.rb: use envutil.rb
-
-	* test/ruby/test_beginendblock.rb: added.
-
-	* test/ruby/beginmainend.rb: added.  used in test_beginendblock.rb.
-
-Sun Oct  5 11:23:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* test/testunit/runit/test_testresult.rb: removed some unnecessary
-	  cruft.
-
-Sun Oct  5 11:14:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/rubyunit.rb: aliasing TestCase into the top level is
-	  problematic.
-
-	* lib/runit/assert.rb: fixed a couple of bugs caused by recent
-	  refactoring in Test::Unit.
-
-	* test/testunit/runit/*: added.
-
-Sun Oct  5 10:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
-	  work.  [ruby-dev:21484]
-
-Sun Oct  5 09:52:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: will use pp for output if available.
-	  Can be disabled by setting Assertions.use_pp = false.
-
-	* test/testunit/test_assertions.rb: made a small change to exception
-	  formatting.
-
-Sun Oct  5 07:42:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: made small improvements to assertion
-	  messages. Deprecated Assertions#assert_not_nil; use #assert instead.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-	* test/testunit/util/test_procwrapper.rb: use #assert instead of
-	  #assert_not_nil.
-
-Sun Oct  5 04:10:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: refactored message building.
-
-Sun Oct  5 03:40:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.h: global symbols should be declared
-	  as external.
-
-Sun Oct  5 03:03:20 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_exception.rb (test_else): added.
-
-Sun Oct  5 02:12:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: changed assertion messages to rely more
-	  heavily on #inspect. Added backtrace filtering for exceptions in
-	  assertion messages.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-Sun Oct  5 02:12:00 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/acl.rb, lib/drb/ssl.rb: added.
-
-	* lib/drb/drb.rb: exit from a thread using 'break'.
-
-Sat Oct  4 21:49:14 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* gc.c (Init_stack): the type of space is changed to unsigned int
-	  from double.  [ruby-dev:21483]
-
-Sat Oct  4 17:52:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/netHttpClient.rb: follow http-access2.  hosts which matches
-	  ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
-	  - [,:] separated. ("ruby-lang.org:rubyist.net")
-	  - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
-	  - if you want specify host by IP address, give full address.
-	    ("192.168.1.1, 192.168.1.2")
-
-	* lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
-
-	* test/runner.rb: give testsuite name.
-
-Sat Oct  4 15:16:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): instance variable dump do not cause error
-	  for objects that cannot be dumped, if they traversed from
-	  marshal_dump.  they are just ignored.
-
-	* gc.c (Init_stack): cast "space" (doble value) into unsigned
-	  int.  should run on PowerPC.
-
-	* eval.c (rb_eval): should not execute else part if any exception
-	  is caught. [ruby-dev:21482]
-
-	* parse.y (f_args): should allow unparenthesized block argument.
-
-	* parse.y (f_rest_arg): should allow unparenthesized rest
-	  argument.
-
-Sat Oct  4 14:59:51 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (initialize): raise ArgumentError if argument has
-	  '\0' character.
-	  (relative_path_from): new method.
-	  (each_entry): new method for replacement of dir_foreach.
-	  (foreach, foreachline, dir_foreach, chdir): obsoleted.
-
-Sat Oct  4 12:58:48 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/uri/* (6 files): added.
-
-Sat Oct  4 12:44:45 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
-
-Sat Oct  4 07:33:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/testsuite.rb: changed #<< to return self, and added
-	  #delete.
-
-	* test/testunit/test_testsuite.rb: ditto. Also slightly refactored
-	  #test_size.
-
-	* lib/test/unit/collector/objectspace.rb: collector now preserves the
-	  hierarchy of suites.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-Sat Oct  4 04:48:49 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: default keys handled.
-
-	* ext/syck/syck.h: lowered default buffer size to 16k for increased
-	  performance.
-
-	* test/yaml: checkin of basic unit tests.
-
-Sat Oct  4 04:24:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: add check for X509V3_set_nconf.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
-	  cannot implement if X509V3_set_nconf doesn't exist.
-
-Sat Oct  4 02:12:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/xsd/datatypes.rb: dump sign by itself.  under the problematic
-	  platform, sprintf("%+.10g", -0.0) => +0.  sigh.
-
-	* sample/wsdl/amazon/*: update schema ver2 to ver3.
-
-Sat Oct  4 01:33:46 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (initialize): duplicate and freeze argument.
-	  (to_s): return duplicated string.
-	  (children): new method.
-	  (each_line): new alias to foreachline.
-
-Fri Oct  3 16:13:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c: add DER encoder and decoder.
-
-	* ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
-
-	* ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
-
-	* ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
-
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
-	  DER encoded data argument.
-
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
-	  DER encoded data in OpenSSL::ASN1 types.
-
-Fri Oct  3 13:02:00 2003  Nathaniel Talbott <ntalbott@ruby-lang.org>
-
-	* lib/test/unit.rb: refactored to use optparse.
-
-	* lib/test/unit.rb: added support for selecting the output
-	  level from the command-line.
-
-	* lib/test/unit.rb: added a command-line switch to stop processing
-	  the command-line, allowing arguments to be passed to tests.
-
-	* lib/test/unit.rb: changed the method for specifying a runner or a
-	  filter from the command-line.
-
-	* lib/test/unit/collector/objectspace.rb: fixed a bug causing all
-	  tests to be excluded when the filter was set to an empty array.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-Fri Oct  3 08:14:32 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
-	  'class ::Foo' syntax. [ruby-talk:83514]
-
-Fri Oct  3 08:01:00 2003  Nathaniel Talbott <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: added a default message for #assert,
-	  #assert_block, and #flunk.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-	* lib/test/unit/failure.rb: failures now show a better trace of where
-	  they occurred.
-
-	* test/testunit/test_failure.rb: ditto (added).
-
-	* lib/test/unit/testcase.rb: ditto.
-
-	* test/testunit/test_testcase.rb: ditto.
-
-	* lib/test/unit/util/backtracefilter.rb: added.
-
-	* test/testunit/util/test_backtracefilter.rb: added.
-
-	* lib/test/unit/error.rb: changed to use BacktraceFilter and improved
-	  output.
-
-	* test/testunit/test_error.rb: ditto.
-
-Thu Oct  2 20:33:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_failure_initialize): conform with
-	  orthodox initialization method.
-
-	* ext/iconv/iconv.c (iconv_fail): initialize exception instance
-	  from the class, and do not share instance variables with the
-	  others.  [ruby-dev:21470]
-
-Thu Oct  2 18:20:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* time.c (Init_Time): define initialize.  [ruby-dev:21469]
-
-Thu Oct  2 17:39:38 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
-	  it supports OpenSSL hardware cryptographic engine interface.
-
-	* ext/openssl/ossl_engine.h: ditto.
-
-	* ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
-
-	* ext/openssl/extconf.rb: add check for openssl/engine.h.
-
-	* ext/openssl/ossl.c: call Init_ossl_engine().
-
-	* ext/openssl/ossl.h: include openssl/engine.h.
-
-	* ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
-	  EVP_PKEY referes engine.
-
-Thu Oct  2 17:22:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_load): restore instance variables (if any) before
-	  loading from marshaled data.
-
-Thu Oct  2 14:19:15 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
-	  set error object to $!.
-
-	* ext/iconv/iconv.c (iconv_convert): error handler block should
-	  return appended part and the rest.  if rest is nil, the
-	  conversion stops.
-
-Thu Oct  2 12:00:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_const_defined_0): look up constants in Object as
-	  well.  [ruby-dev:21458]
-
-	* test/ruby/test_defined.rb (TestDefined::test_defined): test for
-	  constants.
-
-Thu Oct  2 11:17:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: should not capture an
-	  AssertionFailedError unless explicitly requested.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-	* test/testunit/collector/test_objectspace.rb: fixed a test failure
-	  caused by methods being returned in different orders on different
-	  platforms by moving test sorting from TestSuite into the locations
-	  where suites are constructed. [ruby-talk:83156]
-
-	* lib/test/unit/testcase.rb: ditto.
-
-	* lib/test/unit/testsuite.rb: ditto.
-
-	* lib/test/unit/collector/objectspace.rb: ditto.
-
-Thu Oct  2 03:25:01 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* eval.c (rb_thread_raise): prototype; avoid VC++ warning.
-
-Thu Oct  2 01:37:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_mdump): new marshal dumper. _dump is still
-	  available for compatibility.
-
-	* time.c (time_mload): new marshal loader.
-
-	* marshal.c (w_object): preserve instance variables for objects
-	  with marshal_dump.
-
-	* marshal.c (r_object0): restore instance variables before calling
-	  marshal_load.
-
-	* error.c (rb_warn_m): always return nil.
-
-Thu Oct  2 01:32:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_block_given_p): real required condition is
-	  ruby_frame->prev->iter == ITER_CUR.
-
-	* eval.c (rb_block_given_p): ditto.
-
-	* eval.c (block_pass): update ruby_frame->iter only when previous
-	  value is ITER_NOT.
-
-Thu Oct  2 01:02:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_const_defined_at): should exclude constants from
-	  Object when TYPE(klass) == T_MODULE *and* exclude is on.
-	  [ruby-dev:21458]
-
-	* variable.c (rb_const_get_0): do not lookup constants from Object
-	  when TYPE(klass) == T_MODULE *and* exclude is on.
-
-Thu Oct  2 00:21:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/logger/test_logger.rb: unlinking file before close causes
-	  problem under win32 box.
-
-	* lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
-	  when stringified and embedded into XML instance.  Ruby's sprintf may
-	  format -0.0 as "0.0" (no minus sign) depending on underlying C
-	  sprintf implementation.
-
-	* test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
-
-	* test/soap/calc/*: give httpd config param "CGIInterpreter".
-	  "/usr/bin/env ruby" thing does not work under non-Unix boxes.
-
-Thu Oct  2 00:25:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* signal.c (ruby_signal_name): adjust to the prototype.
-
-	* process.c (pst_inspect): ditto.
-
-	* ext/etc/etc.c (etc_getgrent, Init_etc): typo.
-
-Wed Oct  1 20:49:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (heaps): manage slots and limits together.  [ruby-dev:21453]
-
-	* gc.c (add_heap): should not clear heaps slot even if realloc()
-	  failed.
-
-Wed Oct  1 20:36:49 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* MANIFEST: add wince/mkconfig_wce.rb.
-
-Wed Oct  1 17:22:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
-	  setgrent, getgrent, endgrent.
-
-	* ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
-
-Wed Oct  1 17:01:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_load): Object scope had priority over required file
-	  scope.  [ruby-dev:21415]
-
-Wed Oct 01 14:09:53 2003  Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
-	* wince/mkconfig_wce.rb: sorry, forget to commit.
-
-Wed Oct 01 10:08:42 2003  Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
-	* wince/setup.mak: add sigmarionIII SDK support.
-
-	* wince/Makefile.sub: ditto.
-
-	* wince/mkexports.rb: fix linker error in SH4.
-
-	* wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
-
-Wed Oct 01 08:02:52 2003  Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
-	* wince/time_wce.c (time): add zero check.
-
-Tue Sep 30 16:11:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* Makefile.in: copy lex.c from $(srcdir) if it's not the current
-	  directory.  [ruby-dev:21437]
-
-Tue Sep 30 11:29:23 2003  Tanaka Akira  <akr@m17n.org>
-
-	* process.c (pst_inspect): describe stopped process "stopped".
-
-Tue Sep 30 09:31:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/runner.rb: glob for directories.
-
-Tue Sep 30 09:11:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): while/until should not capture break unless
-	  they are destination of the break.
-
-Tue Sep 30 03:12:02 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (finish): revert to 1.93.
-
-	* lib/net/pop.rb (finish): revert to 1.60.
-
-	* lib/net/smtp.rb (finish): revert to 1.67.
-
-	* lib/net/http.rb (do_start): ensure to close socket if failed to
-	  start session.
-
-	* lib/net/pop.rb (do_start): ditto.
-
-	* lib/net/smtp.rb (do_start): ditto.
-
-	* lib/net/smtp.rb: SMTP#started? wrongly returned false always.
-
-Tue Sep 30 02:54:49 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/ruby/test_iterator.rb: new test
-	  test_break__nested_loop[123].
-
-Mon Sep 29 23:39:13 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb (finish): does not raise IOError even if
-	  !started?, to allow closing socket which was opened before
-	  session started.
-
-	* lib/net/pop.rb (finish): ditto.
-
-	* lib/net/smtp.rb (finish): ditto.
-
-Mon Sep 29 19:06:51 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/win32ole/extconf.rb: add windows.h checking.
-	  (ruby-bugs:PR#1185)
-
-Mon Sep 29 16:18:30 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb: check if the given logdevice object respond_to :write
-	  and :close, not is_a? IO.  duck duck.
-
-	* test/logger/test_logger.rb: self IO.pipe reading/writing may be
-	  locked by the flood.  use tempfile.
-
-	* lib/wsdl/xmlSchema/data.rb: wrong constant reference.
-
-Mon Sep 29 16:11:23 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: clean up temporary symlink.
-	  Patched by NaHi.  [ruby-dev:21420]
-
-Mon Sep 29 11:16:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_thread_atfork): wrong format specifier.
-	  [ruby-dev:21428]
-
-	* process.c (pst_inspect): better description.
-
-Mon Sep 29 02:31:44 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/utils.rb (Utils::su): use setgid and setuid to
-	  set real and effective IDs. and setup group access list by
-	  initgroups.
-
-Sun Sep 28 11:14:19 2003  Koji Arai  <jca02266@nifty.ne.jp>
-
-	* ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
-	  `initialize_copy' should be defined.
-
-	* ext/stringio/stringio.c (Init_stringio): ditto.
-
-Sat Sep 27 18:25:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
-	  $KCODE = "NONE" environment.  check added.
-
-	* test/xsd/test_xsd.rb: add tests for above fix.
-
-Sat Sep 27 15:58:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
-
-	* lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
-	  a chance to reset logging severity threshold.
-
-	* test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
-	  silent.
-
-Sat Sep 27 09:44:18 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: clear all errors on Windows.
-	  [ruby-dev:21417]
-
-	* test/fileutils/test_nowrite.rb: ditto.
-
-Sat Sep 27 04:57:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_file.rb: new file.  only asserts unlink-before-close
-	  behaviour now.
-
-	* test/soap/marshal/test_digraph.rb: should close before unlink.
-	  unlink-before-close pattern is not needed here.
-
-Sat Sep 27 03:32:37 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
-	  each module namespace.  TestMarshal in
-	  test/soap/marshal/test_marshal.rb crashed with
-	  test/ruby/test_marshal.rb.
-
-Sat Sep 27 01:30:59 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (ruby_connect): on win32, type of the 4th
-	  argument of getsockopt is char *.
-
-Fri Sep 26 18:35:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv-replace.rb: 1.8 compliance.  [ruby-talk:82946]
-
-Fri Sep 26 17:39:27 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_marshal.rb: add test for ruby's objects.
-
-Fri Sep 26 09:52:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* defines.h (flush_register_windows): use volatile only for gcc on
-	  Solaris.  [ruby-dev:21403]
-
-	* lib/mkmf.rb (xsystem): use system directly to honor shell meta
-	  charaters.
-
-Fri Sep 26 00:10:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/README: updated.
-
-Thu Sep 25 17:48:10 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
-	  rb_protect.
-
-	* ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
-	  value.
-
-Thu Sep 25 09:00:00 2003  Nathaniel Talbott <ntalbott@ruby-lang.org>
-
-	* lib/ostruct.rb: Added OpenStruct#==.
-
-	* test/ostruct/test_ostruct.rb: Added.
-
-Thu Sep 25 07:55:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
-	  ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
-	  not use C++ or C99 style comment yet.  (ruby-bugs:PR#1184)
-
-Thu Sep 25 00:23:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* MANIFEST: add SOAP4R.
-
-Thu Sep 25 00:13:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/* (29 files): SOAP4R added.
-
-	* lib/wsdl/* (42 files): WSDL4R added.
-
-	* lib/xsd/* (12 files): XSD4R added.
-
-	* test/soap/* (16 files): added.
-
-	* test/wsdl/* (2 files): added.
-
-	* test/xsd/* (3 files): added.
-
-	* sample/soap/* (27 files): added.
-
-	* sample/wsdl/* (13 files): added.
-
-Wed Sep 24 02:08:11 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
-	  [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
-
-Tue Sep 23 23:10:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb: add Logger#<<(msg) for writing msg without any
-	  formatting.
-
-	* test/logger/test_logger.rb: ditto.
-
-Tue Sep 23 20:47:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* error.c (rb_warn_m): should not warn if -W0 is specified.
-	  [ruby-talk:82675]
-
-Mon Sep 22 21:28:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* MANIFEST: updated.
-
-Mon Sep 22 19:22:26 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* configure.in (AC_CHECK_FUNCS): add setuid and setgid.
-
-Mon Sep 22 12:34:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* util.c (ruby_strtod): skip preceding zeros before counting
-	  digits in the mantissa. (ruby-bugs:PR#1181)
-
-Sun Sep 21 04:12:36 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
-	  should be a String.
-
-	* ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
-
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
-
-Sat Sep 20 11:49:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb: typo fixed.
-
-	* test/logger/test_logger.rb: new file.
-
-Fri Sep 19 11:39:00 2003  Nathaniel Talbott <ntalbott@ruby-lang.org>
-
-	* test/testunit/*: Added.
-
-	* lib/test/unit.rb: Documentation update.
-
-	* lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
-	  Ditto.
-
-	* lib/test/unit.rb: Factored out an ObjectSpace collector.
-
-	* lib/test/unit/collector/objectspace.rb: Ditto.
-
-	* sample/testunit/*: Added.
-
-Fri Sep 19 01:00:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
-	  condition.
-
-	* lib/webrick/log.rb (BasicLog#format): add "\n" to message.
-
-Thu Sep 18 22:43:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
-
-	* eval.c (proc_invoke): should update "result" for orphans.
-
-Thu Sep 18 20:33:03 2003  Tietew  <tietew-ml-ruby-list@tietew.net>
-
-	* parse.y (str_xquote): do not prepend escapes in
-	  backqoute literals.  [ruby-list:38409]
-
-Thu Sep 18 20:30:17 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: update document.
-
-Thu Sep 18 15:27:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb: new file.  Logger, formerly called devel-logger or
-	  Devel::Logger.
-
-	* sample/logger/*: new file.  samples of logger.rb.
-
-Wed Sep 17 23:41:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (localjump_destination): should not raise ThreadError
-	  exception for "break". [ruby-dev:21348]
-
-	* eval.c (proc_invoke): use result instead of prot_tag->retval.
-	  retval is no longer propagated to the ancestors.
-
-Wed Sep 17 20:34:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (tokadd_string, parse_string, yylex): escaped terminator
-	  is now interpreted as is.  [ruby-talk:82206]
-
-Wed Sep 17 18:52:36 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/fileassertions.rb: new file.
-
-	* test/fileutils/test_fileutils.rb: new file.
-
-	* test/fileutils/test_nowrite.rb: new file.
-
-Wed Sep 17 18:51:02 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/strscan/test_stringscanner.rb: require test/unit.
-
-Wed Sep 17 18:35:34 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* test/strscan/test_stringscanner.rb: new file.
-
-Wed Sep 17 18:03:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl: all files are reviewed to simplify and avoid memory leak.
-
-	* ext/openssl/extconf.rb: add check for assert.h.
-
-	* ext/openssl/ossl.c (ossl_buf2str): new function to convert
-	  C buffer to String and free buffer.
-
-	* ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
-	  Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
-
-	* ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
-	  functions to convert object to DER string.
-
-	* ext/openssl/ossl.h: ditto.
-
-	* ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
-	  BIO to String object and free BIO.
-
-	* ext/openssl/ossl_bio.h: ditto.
-
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
-
-	* ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
-	  and reimplement in openssl/x509.rb.
-
-	* ext/openssl/ossl_x509attr.c: reimplemented and disable some
-	  method temporarily. this class doesn't work fine without ASN.1
-	  data support;-) I'll rewrite in near future.
-
-	* ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
-	  unused code.
-
-	* ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
-
-Tue Sep 16 22:25:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/csv/test_csv.rb: add negative tests of row_sep.
-
-Tue Sep 16 18:02:36 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* regex.c (re_compile_pattern): should not translate character
-	  class range edge. [ruby-list:38393]
-
-Tue Sep 16 16:47:56 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* MANIFEST: add test/csv/mac.csv.
-
-	* win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
-
-Mon Sep 15 19:02:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/csv.rb: add extra pamameter to specify row(record) separater
-	  character.  To parse Mac's CR separated CSV, do like this.
-	    CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
-	  The 3rd parameter in this example ?, is for column separater and the
-	  4th ?\r is for row separater.  Row separater is nil by default.  Nil
-	  separater means "\r\n" or "\n".
-
-	* test/csv/test_csv.rb: add tests for above feature.
-
-	* test/csv/mac.csv: added.  Sample CR separated CSV file.
-
-Fri Sep 12 22:41:48 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-
-	* ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
-
-	* ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
-
-	* ext/openssl/ossl_asn1.[ch]: new files
-
-	* ext/openssl/ossl_bio.[ch]: new files
-
-Fri Sep 12 12:30:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* intern.h (rb_disable_super, rb_enable_super): replace with dummy
-	  expressions instead of prototypes.  the functions remain yet for
-	  binary compatibility.  [ruby-talk:81758]
-
-Fri Sep 12 12:09:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (rb_big_and): convert argument using 'to_int'.
-
-	* bignum.c (rb_big_or): ditto.
-
-	* bignum.c (rb_big_xor): ditto.
-
-Fri Sep 12 07:06:14 2003   David Black <dblack@superlink.net>
-
-	* lib/scanf.rb: Took out useless @matched_item variable; some small
-	  refactoring.
-
-Thu Sep 11 08:43:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
-	  name is not tainted.
-
-	* lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
-	  Supports StringIO.
-
-Wed Sep 10 22:47:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.h: add a workaround for win32 platform.
-	  libeay32.dll doesn't export functions defined in conf_api.h.
-
-	* ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
-
-	* ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
-
-	* ext/openssl/ossl_config.c (set_conf_section_i): should check
-	  if the argument is Array.
-
-Wed Sep 10 22:41:54 2003  Tietew <tietew@tietew.net>
-
-	* eval.c (win32_get_exception_list): avoid VC7 warning.
-	  [ruby-win32:577]
-
-Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (struct tag): dst should be VALUE.
-
-Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (localjump_destination): stop at the scope where the current
-	  block was created.  [ruby-dev:21353]
-
-Tue Sep  9 05:17:04 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
-
-Tue Sep 9 02:41:35 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-
-	* ext/openssl/ossl_config.c: Refine compatibility.
-
-Tue Sep  9 01:50:45 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
-	  the message.
-
-	* lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
-
-Mon Sep  8 22:15:33 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: modify security check at creating
-	  a new interpreter
-
-Mon Sep  8 20:00:12 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb, lib/optparse/version.rb: search also all
-	  capital versions.
-
-Mon Sep  8 19:26:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
-
-	* ext/openssl/ossl_config.c: refine all with backward compatibility.
-
-	* ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
-
-	* ext/openssl/ossl_x509.c: added new constants under X509 module.
-	  DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
-	  DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
-	  the members of the struct. it's left to GC.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
-
-	* ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
-	  add attr readers: issuer_certificate, subject_certificate,
-	  subject_request, crl and config.
-
-Mon Sep  8 18:26:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
-	  instead of config[:Port] or req.request_uri.port.
-
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
-
-	* lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
-
-	* lib/webrick/config.rb: :Listen option never be used.
-
-	* lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
-	  option and add warning message.
-
-	* lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
-
-	* lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
-
-Sun Sep  7 16:08:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
-
-	* ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
-
-Sat Sep  6 02:26:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_*.rb: assert_same, assert_match, and so on.
-
-Sat Sep  6 18:45:46 2003  Mauricio Fernandez <batsman.geo@yahoo.com>
-
-	* parse.y (assignable): call rb_compile_error(), not rb_bug().
-	  [ruby-core:01523]
-
-Sat Sep  6 17:40:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ruby_missing.c: rid of unnecessary backward
-	  compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
-	  all sources.
-
-	* ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
-
-	* ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
-
-	* ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
-
-	* ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
-
-Sat Sep  6 01:23:22 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
-
-	* win32/win32.c (CreateChild): fix condition about whether to call
-	  shell or not.
-
-Sat Sep  6 00:36:20 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
-
-	* Makefile.in (test): phony target.
-
-	* lib/mkmf.rb (have_library, find_library): configure by library
-	  name.
-
-	* lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
-	  array as argument.
-
-	* test/ruby/test_*.rb: moved invariants to left side in
-	  assert_equal, and use assert_nil, assert_raises and so on.
-
-	* win32/win32.c (isInternalCmd): distinguish command.com and
-	  cmd.exe.
-
-	* win32/win32.c (make_cmdvector): a character just after wildcard
-	  was ignored.  [ruby-core:01518]
-
-Fri Sep  5 20:27:08 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
-
-Fri Sep  5 18:00:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
-
-	* ext/openssl/ossl_digest.c: add ossl_digest_new().
-
-	* ext/openssl/ossl_digest.h: ditto.
-
-	* ext/openssl/ossl_cipher.c: add ossl_cipher_new().
-
-	* ext/openssl/ossl_cipher.h: ditto.
-
-Fri Sep  5 15:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
-	  search delimiter forward if found in backward.
-
-Fri Sep  5 13:32:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/runner.rb: arguments should be keys.
-
-Fri Sep  5 12:09:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/ruby/test_system.rb (test_system): check existence of ruby
-	  interpreter.
-
-Fri Sep  5 11:32:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (--version): fix assignment/reference order.
-
-	* lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
-	  be deprecated in future.
-
-	* lib/optparse/version.rb (OptionParser#show_version): hide Object.
-
-	* test/runner.rb: fix optparse usage.
-
-	* test/runner.rb: glob all testsuits if no tests given.
-
-Fri Sep  5 10:42:58 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/runner.rb: added.  gets testcases from command line and runs it.
-
-	* test/ruby/test_gc.rb: remove useless part which was for dumping test
-	  result.
-
-Fri Sep  5 09:28:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby/test_gc.rb: added.  splitter.rb which I made to split
-	  sample/test.rb into test/ruby/test_* kindly removed GC test (the
-	  last section in the original test) to reduce things to be worried.
-
-Fri Sep  5 03:00:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/ruby/test_iterator.rb (test_block_in_arg): add no block
-	  given tests.
-
-	* test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
-	  test.
-
-Fri Sep  5 01:10:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/ruby: tests for ruby itself.
-
-	* test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
-	  some tests could not be translates...  search '!!' mark to see it.
-
-	* test/csv/test_csv.rb: should require 'csv', not '../lib/csv'.  test
-	  runner should set load path correctly.
-
-Fri Sep  5 01:03:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
-	  opened file cannot be removed under win32 box.
-
-Thu Sep  4 23:59:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (tokadd_string): newlines have no special meanings in
-	  %w/%W, otherwise they are ignored only when interpolation is
-	  enabled.  [ruby-dev:21325]
-
-Thu Sep  4 19:38:25 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* ext/io/wait/.cvsignore: added.
-
-	* ext/openssl/.cvsignore: added.
-
-Thu Sep  4 19:28:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* sample/openssl: added.  Sample of standard distribution library
-	  should be locate in sample/{module_name}/*.
-
-	* ext/openssl/sample/*: removed.  move to sample/openssl/*.
-
-Thu Sep  4 18:02:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/csv/test_csv.rb: use remove_const to reduce warnings.  use
-	  Dir.tmpdir to locate working files.
-
-Thu Sep  4 17:41:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
-	  valid delimiter.
-
-	* misc/ruby-mode.el (ruby-here-doc-end-match): must quote
-	  arbitrary string to use as regexp.
-
-	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
-	  call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
-	  matched.
-
-Thu Sep  4 15:40:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/csv/test_csv.rb: run on test/unit original layer.
-
-Thu Sep  4 12:54:50 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/token.c: headerless documents with root-level spacing now
-	  honored.
-
-Thu Sep  4 00:06:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (mark_frame_adj): need to adjust argv pointer if using
-	  system's alloca. [ruby-core:01503]
-
-Wed Sep  3 21:33:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test: add test directory.  Test::Unit aware testcases and needed
-	  files should be located in this directory.  dir/file name convention;
-	    test/{module_name}/test_{testcase_name}.rb
-	    test/{module_name}/{needed_files}
-	  someday, someone will write testrunner which searches test_*.rb and
-	  run testcases automatically.
-
-	* test/csv/*: add testcase for lib/csv.rb.
-
-Wed Sep  3 01:37:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_f_gets): should call next_argv() before type check
-	  current_file. [ruby-list:38336]
-
-Tue Sep  2 20:37:15 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
-	  for skipping server verification.
-
-Tue Sep  2 23:36:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (proc_invoke): should retrieve retval when pcall is true.
-
-Tue Sep  2 14:09:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
-	  the patch is submitted by nmu <nmu@users.sourceforge.jp>.
-
-	* ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
-	  some platforms.
-
-	* ext/socket/getnameinfo.c (getnameinfo): ditto.
-
-Tue Sep  2 14:02:19 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
-
-	* ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
-	  bug fix and improvement of font control
-
-Tue Sep  2 09:51:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): should not handle exceptions within rescue
-	  argument.  [ruby-talk:80804]
-
-Tue Sep  2 00:44:37 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (rb_memsearch): fix overrun.  [ruby-talk:80759]
-
-Tue Sep  2 00:41:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (map_charset): use lower case keys.
-
-	* ext/iconv/iconv.c (iconv_fail): just yield error and return the
-	  result if a block is given.
-
-	* ext/iconv/iconv.c (iconv_convert): yield error and append the
-	  result if a block is given.
-
-	* ext/iconv/charset_alias.rb (charset_alias): optional third
-	  argument.
-
-	* ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
-	  SHIFT_JIS on cygwin.
-
-Mon Sep  1 18:34:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): make tail recursion in ELSE clause of
-	  RESCUE a jump.
-
-Mon Sep  1 18:00:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
-	  Dave Butcher.
-
-	* eval.c (Init_Thread): protect thgroup_default.  suggested by Guy
-	  Decoux in [ruby-talk:80623]
-
-Mon Sep  1 16:59:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
-	  thread termination.
-
-	* eval.c (rb_thread_start_0): should not error_print() within
-	  terminated thread, because $stderr used by it might be
-	  overriden now.  [ruby-dev:21280]
-
-Sun Aug 31 22:46:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* eval.c (TAG_DST()): take no argument.
-
-	* process.c (p_gid_sw_ensure): return VALUE.
-
-Sun Aug 31 22:27:10 2003  Hidetoshi NAGAI  <nagai@dumbo.ai.kyutech.ac.jp>
-
-	* process.c (p_gid_sw_ensure): lack of function type
-
-Sun Aug 31 12:25:06 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
-
-	* lib/optparse.rb: --version takes an optional argument; "all" or
-	  a list of package names.
-
-Sun Aug 31 10:17:02 2003  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date/format.rb: yyyy/mm is not an acceptable format.
-
-	* lib/time.rb: follow above.
-
-Sat Aug 30 14:25:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_iter_break): should not call TAG_JUMP directly.
-
-Sat Aug 30 03:58:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
-
-	* eval.c (POP_TAG): no longer propagate retval.  retval is now set
-	  directly by localjump_destination().
-
-	* eval.c (localjump_destination): new function to cast
-	  return/break local jump.
-
-	* eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
-
-Fri Aug 29 22:35:00 2003  Shigeo Kobayashi <shigek@ruby-lang.org>
-
-	* bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
-	  then result will be the same as +,-,*,/ respectively.
-
-Fri Aug 29 17:30:15 2003  Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
-	* process.c: bug fix
-
-	* process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
-
-	* process.c: deny handling IDs during evaluating the block given to
-	  the Process::{UID,GID}.switch method
-
-	* ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
-
-	* ext/tcltklib/tcltklib.c : can create a interpreter without Tk
-
-	* ext/tcltklib/tcltklib.c : bug fix on handling exceptions
-
-	* ext/tcltklib/MANUAL.euc : modify
-
-	* ext/tk/lib/tk.rb : freeze some core modules
-
-	* ext/tk/lib/multi-tk.rb : more secure
-
-	* ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
-	  Tk's list
-
-	* ext/tk/lib/tk.rb: improve accessibility of TkVariable object
-
-	* ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
-	  ext/tk/lib/tktext.rb : fix bug of font handling
-
-	* ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
-
-Thu Aug 28 22:07:12 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_autoload_load): call const_missing if autoloading
-	  constant is not defined to allow hook.
-
-	* eval.c (rb_eval): use rb_const_get_from() instead of
-	  rb_const_get_at().
-
-	* eval.c (is_defined): forgot to check NODE_COLON3.
-
-Thu Aug 28 17:30:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_const_get_0): should check constants defined in
-	  included modules, if klass is Object. [ruby-talk:79302]
-
-	* numeric.c (check_uint): check should be done using UINT_MAX, not
-	  INT_MAX. this fix is submitted by Lyle Johnson
-	  <lyle@knology.net> in [ruby-core:01486]
-
-Thu Aug 28 05:02:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
-
-Thu Aug 28 02:37:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
-	  consistent with *a = [1], which set [[1]] to a.
-
-	* node.h: merge NODE_RESTARY to NODE_SPLAT.
-
-	* parse.y: rules simplified a bit by removing NODE_RESTARY.
-
-	* sample/test.rb: updated for new assignment behavior.
-
-Wed Aug 27 22:33:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (rb_bug): should not use other methods; this function is
-	  not for ordinary use.  [ruby-dev:21259]
-
-Wed Aug 27 15:07:57 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
-	  response. [ruby-list:38279]
-
-Wed Aug 27 05:10:15 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* win32/win32.c (map_errno): support winsock error.
-
-	* win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
-	  kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
-	  pass errno to map_errno().
-
-	* win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
-	  rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
-	  rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
-	  rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
-	  rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
-	  rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
-	  rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
-	  rb_w32_fclose, rb_w32_close): use map_errno().
-
-	* win32/win32.h: add winsock errors.
-
-Tue Aug 26 23:53:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
-	  frozen OpenStruct. [ruby-talk:80214]
-
-Tue Aug 26 20:03:50 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_tmpsrc): add the hook for source.
-	  [ruby-list:38122]
-
-Tue Aug 26 15:59:53 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* implicit.c (syck_type_id_to_taguri): corrected detection of
-	  x-private types.
-
-Sun Aug 24 01:02:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (file_expand_path): performance improvement.
-	  [ruby-talk:79748]
-
-Sat Aug 23 23:41:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
-	  apparent cases. [ruby-talk:79748]
-
-Sat Aug 23 18:56:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
-	  resize a string, rb_str_cat() disallows NULL.  [ruby-dev:21237]
-
-Sat Aug 23 16:48:41 2003  Keiju Ishitsuka <keiju@ishitsuka.com>
-
-	* lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
-
-Sat Aug 23 15:59:58 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
-	  EXEC_TAG() for retry.  [ruby-dev:21216]
-
-Sat Aug 23 02:32:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_yield_splat): should check if "values" is array.
-
-	* enum.c (each_with_index_i): typo.
-
-Fri Aug 22 17:07:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* enum.c (inject_i): use rb_yield_values.
-
-	* enum.c (each_with_index_i): ditto.
-
-	* eval.c (rb_yield_splat): new function to call "yield *values".
-
-	* string.c (rb_str_scan): use rb_yield_splat().
-
-Fri Aug 22 06:13:22 2003  why the lucky stiff <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: refactoring of the transfer method
-	  dispatch.  added yaml_org_handler for faster dispatch of
-	  transfers to base types.
-
-	* lib/yaml/rubytypes.rb: removed handling of builtins from
-	  Ruby library.
-
-	* ext/syck/token.c: quoted and block scalars are now implicit !str
-
-	* ext/syck/implicit.c: empty string detected as !null.
-
-Fri Aug 22 01:00:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (block_pass): improve passing current block.
-
-Fri Aug 22 00:13:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
-	  fixed, and VpNmlz() speed up.
-
-Wed Aug 20 16:44:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/socket.c (ruby_connect): many systems seem to have
-	  a problem in select() after EINPROGRESS.  [ruby-list:38080]
-
-Wed Aug 20 01:31:17 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.h: Parser definition problems on HP-UX.
-	  [ruby-talk:79389]
-
-	* ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
-
-	* ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
-
-	* ext/syck/rubyext.c: Tainting issues.
-
-Tue Aug 19 23:20:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
-
-	* ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
-
-Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
-
-	* lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
-
-	* lib/webrick/compat.rb (File::fnmatch): remove old migration code.
-
-	* lib/webrick/httpserver.rb (HTTPServer#run): ditto.
-
-	* lib/webrick/server.rb (GenericServer#listen): the body of this
-	  method is pull out as Utils::create_lisnteners.
-
-	* lib/webrick/utils.rb (Utils::create_lisnteners): new method.
-
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  unknown errors. and refine comments.
-
-	* ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
-	  socket if SSLSocket raises error.
-
-Tue Aug 19 11:19:33 2003  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* io.c (next_argv): should not call GetOpenFile() if rb_stdout is
-	  not a IO (T_FILE).
-
-Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
-	  a builtin.
-
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
-
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
-	  add a return to the tails of each line.
-
-	* ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
-
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
-
-	* ext/openssl/sample/echo_svr.rb: use SSLServer.
-
-	* ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
-
-Tue Aug 19 01:24:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
-	  headers are inconsistent at this macro.  [ruby-core:01432]
-
-	* ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
-
-	* ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
-	  winspool.h
-
-	* instruby.rb: make list at first instead of iterator.
-	  [ruby-talk:79347]
-
-Mon Aug 18 11:23:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): preserve raw order for **.
-
-Sun Aug 17 23:39:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
-
-Sun Aug 17 17:10:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
-	  method to specify if the underlying IO will be closed in
-	  SSLSocket#close.
-
-	* ext/openssl/lib/openssl/buffering.rb: add forwarders to
-	  setsockopt, getsockopt and fcntl.
-
-	* ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
-
-Sun Aug 17 11:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): should not force to remake Makefile when
-	  installation and so on.
-
-Sat Aug 16 23:58:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_symbol, w_object): get rid of warnings.
-
-	* re.c (rb_memsearch): ditto.
-
-	* time.c (time_dump): ditto.
-
-	* ext/extmk.rb (extmake): not continue making when extconf.rb
-	  failed.
-
-	* ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
-
-	* ext/openssl/ossl.h: remove version.h dependency.
-
-	* ext/openssl/ruby_missing.h: ditto.
-
-	* lib/mkmf.rb (pkg_config): use --libs output except with
-	  only-L for other options.  [ruby-list:38099]
-
-	* lib/mkmf.rb (create_makefile): separate rule for static
-	  library from shared object.
-
-	* win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
-	  define exec_prefix and libdir.
-
-Fri Aug 15 23:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
-	  method fixed.
-
-	* ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
-
-Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (HUGE_ST_INO): check whether struct stat.st_ino
-	  is larger than long.  [ruby-dev:21194]
-	  http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
-
-	* error.c (syserr_eqq): errno might exceed Fixnum limit.
-
-	* error.c (Init_Exception): moved base initialization from
-	  init_syserr().
-
-	* inits.c (rb_call_inits): postpone initializing errnos until
-	  Bignum is available.
-
-Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
-	  keyname() and so on be declared.
-
-	* ext/curses/curses.c (curses_resizeterm, window_resize):
-	  arguments conflicted with macros in term.h.
-
-	* ext/curses/curses.c (Curses module methods): ensure
-	  initialized.  [ruby-dev:21191]
-
-Fri Aug 15 02:08:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (id2ref): recycle check should be done by klass == 0.
-	  [ruby-core:01408]
-
-Fri Aug 15 01:34:23 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-
-	* ext/openssl/ossl_pkey.c: move generate_cb here
-
-	* ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
-
-	* ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
-
-	* ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
-
-Fri Aug 15 00:38:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
-
-	* ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
-
-	* ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
-
-Thu Aug 14 21:19:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (Init_Thread): Continuation#[] added.  [ruby-talk:79028]
-
-Thu Aug 14 20:03:34 2003  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (OLE_FREE): should not call
-	  ole_message_loop.
-
-	* ext/win32ole/win32ole.c (ole_event_free): ditto.
-
-	* ext/win32ole/win32ole.c (ole_initialize): stop calling
-	  OleUninitialize at exit.
-
-Thu Aug 14 11:27:37 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* gc.c (rb_data_object_alloc): check type of 1st argument.
-	  [ruby-dev:21192]
-
-Thu Aug 14 00:21:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
-
-	* parse.y (lhs): ditto.
-
-	* parse.y (yylex): should return tCOLON3 right after kCLASS.
-	  [ruby-talk:78918]
-
-	* error.c (exc_initialize): was converting argument to string too
-	  eagerly.  Only check was needed. [ruby-talk:78958]
-
-Wed Aug 13 23:31:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
-	  BigDecimal::limit removed.
-
-Wed Aug 13 19:21:34 2003  Christian Neukirchen  <chneukirchen@yahoo.de>
-
-	* lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
-	  to SSLSocket. [ruby-talk:78919]
-
-Wed Aug 13 18:13:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
-
-	* eval.c (proc_invoke): unpack return/break destination when block
-	  is already left.
-
-Wed Aug 13 15:58:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* object.c (rb_class_s_alloc): add function prototype to avoid VC++
-	  warning.
-
-Wed Aug 13 13:50:59 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/Win32API/Win32API.c (Win32API_initialize): should pass some
-	  class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
-
-Tue Aug 12 16:55:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in: static link libraries to LIBRUBY_SO with static linked
-	  ext.  [ruby-dev:21157]
-
-	* ext/extmk.rb (extmake): sort extension library initialization order.
-
-	* ext/extmk.rb (extmake): compact $extlibs.
-
-Tue Aug 12 02:48:56 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
-	  flag before calling getcontext(2).
-
-	* eval.c (struct thread): add member to save backing store on
-	  IA64. (ruby-bugs PR1086)
-
-	* eval.c (thread_mark): mark IA64 backing store region.
-
-	* eval.c (thread_free): free saved IA64 backing store.
-
-	* eval.c (rb_thread_save_context): save IA64 backing store as well.
-
-	* eval.c (rb_thread_restore_context): restore IA64 backing store.
-
-	* eval.c (THREAD_ALLOC): initialize IA64 members.
-
-Mon Aug 11 22:31:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-	* lib/debug.rb(debug_command): inspection command should inspect
-	  resulting value even if it's nil.  [ruby-dev:21180] by OMAE, jun
-	  <jun66j5@ybb.ne.jp>.
-
-	* lib/debug.rb(debug_command): incomplete regexp.
-
-Mon Aug 11 17:33:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call_super): do not use rb_block_given_p() for
-	  check. [ruby-talk:78656]
-
-	* eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
-
-Sun Aug 10 10:43:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
-	  from 1k to 16k bytes. [ruby-talk:78603]
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
-	  partial write to allow interruption in SSLSocket#write.
-
-Sun Aug 10 00:34:16 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
-	  for ccache.
-
-Sat Aug  9 10:36:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): do not dump generic instance variable when
-	  marshal_dump is defined.
-
-Sat Aug  9 00:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal.c: F style output(like 1234.56789) implemented
-	  to to_s method.
-	* ext/bigdecimal_??.html: F style output(like 1234.56789)
-	  implemented to to_s method.
-
-Fri Aug  8 12:33:17 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
-	  add the -aa option to WLDFLAGS.
-
-Fri Aug  8 11:29:26 2003  Koji Arai  <jca02266@nifty.ne.jp>
-
-	* marshal.c (w_object): should set `c_arg' at first.
-
-Fri Aug  8 03:22:28 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httputils.rb (FormData#list): should not take
-	  a side effect for the receiver.
-
-Thu Aug  7 14:40:37 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* cygwin/GNUmakefile: better --disbale-shared option support.
-
-	* cygwin/GNUmakefile: add forwarding DLL target for cygwin.
-
-Thu Aug  7 14:21:05 2003  Corinna Vinschen  <vinschen@redhat.com>
-
-	* configure.in: Fix Cygwin specific naming of libraries to
-	  be net distribution compliant. (ruby-bugs:PR#1077)
-	  cygwin-ruby18.dll -> cygruby18.dll
-
-Thu Aug  7 12:51:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_at_exit): should not be called without a block.
-	  block_given check added.
-
-Thu Aug  7 06:46:06 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): forgot to pop ruby_class.
-
-	* eval.c (rb_call0): update ruby_class as well as ruby_cref.
-	  (ruby-bugs-ja:PR#540)
-
-Thu Aug  7 04:52:50 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
-	  ruby_cref.  [ruby-talk:78141]
-
-Thu Aug  7 04:19:15 2003  Akinori MUSHA  <knu@iDaemons.org>
-
-	* gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
-	  Linux/ia64.  This makes gc.c compile but miniruby coredumps for
-	  the moment.
-
-Thu Aug  7 00:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
-
-	* ext/bigdecimal.c: Comparison results adjusted to Float's.
-	* ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
-
-Wed Aug  6 22:58:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/testcase.rb: Added equality checking.
-	* lib/test/unit/testsuite.rb: Added equality checking.
-	* lib/test/unit/assertions.rb: Fixed a warning.
-
-Wed Aug  6 17:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): pass LIBPATH to make ruby.  [ruby-dev:21137]
-
-	* ext/extmk.rb (extmake): set library name as source file name in
-	  Init_ext().  [ruby-dev:21137]
-
-	* lib/mkmf.rb (Logging::postpone): postpone logging messages after
-	  heading message as the result of the block.
-
-	* lib/mkmf.rb (macro_defined?): append newline to src unless ended
-	  with it.
-
-	* lib/mkmf.rb (have_library): treat nil function name as "main".
-	  (ruby-bugs:PR#1083)
-
-	* lib/mkmf.rb (pkg_config): should append additional libraries to
-	  $libs but not $LIBS.  [ruby-dev:21137]
-
-	* ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
-
-	* ext/digest/sha1/extconf.rb: have_library already appends library
-	  name.
-
-Wed Aug  6 17:23:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c: initialize /* OK */ variables by Qnil to stop warnings.
-
-Wed Aug  6 04:58:32 2003  NAKAMURA Usaku <usa@ruby-lang.org>
-
-	* ext/Setup*: add io/wait and openssl.
-
-Wed Aug  6 01:13:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
-
-	* eval.c (rb_f_autoload_p): ditto.
-
-	* class.c (rb_mod_init_copy): no longer implements independent
-	  clone and dup methods.  override "initialize_copy" instead.
-	  [ruby-core:01352]
-
-	* object.c (rb_class_s_alloc): define Class allocation function.
-	  this makes Classes to follow clone framework that uses
-	  initialize_copy.
-
-	* object.c (rb_class_initialize): separate instantiation and
-	  initialization.
-
-	* object.c (rb_obj_alloc): prohibit instantiation from
-	  uninitialized class.
-
-	* object.c (rb_class_superclass): check uninitialized class.
-
-	* array.c (rb_ary_fill): wrong index processing with block.  this
-	  fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
-
-	* marshal.c (w_object): should preserve generic ivar for nil,
-	  true, false, symbols, and fixnums.
-
-	* marshal.c (w_uclass): base_klass check should be done after
-	  rb_class_real().
-
-Wed Aug  6 01:18:50 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: update document.
-
-	* lib/net/pop.rb: ditto.
-
-	* lib/net/protocol.rb: ditto.
-
-Wed Aug  6 00:48:37 2003  Koji Arai  <jca02266@nifty.ne.jp>
-
-	* marshal.c (w_object): should recommend marshal_dump rather than
-	  _dump_data.
-
-Tue Aug  5 17:58:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/fileutils.rb (install): should preserve timestamp only.
-
-Tue Aug  5 17:31:59 2003  Ian Macdonald  <ian@caliban.org>
-
-	* lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
-	  simple typo.
-
-Tue Aug  5 15:47:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_load): should preserve current source file/line.
-
-Tue Aug  5 10:04:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (str_new4): ptr may refer null_str.
-
-Mon Aug  4 17:25:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* stable version 1.8.0 released.
-
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-add-log-time-format: (lambda ()
-  (let* ((time (current-time))
-	 (diff (+ (cadr time) 32400))
-	 (lo (% diff 65536))
-	 (hi  (+ (car time) (/ diff 65536))))
-  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-end:
diff --git a/GPL b/GPL
index 5b6e7c66c2..d159169d10 100644
--- a/GPL
+++ b/GPL
@@ -1,12 +1,12 @@
-		    GNU GENERAL PUBLIC LICENSE
-		       Version 2, June 1991
+                    GNU GENERAL PUBLIC LICENSE
+                       Version 2, June 1991
 
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
-                       59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
  Everyone is permitted to copy and distribute verbatim copies
  of this license document, but changing it is not allowed.
 
-			    Preamble
+                            Preamble
 
   The licenses for most software are designed to take away your
 freedom to share and change it.  By contrast, the GNU General Public
@@ -15,7 +15,7 @@ software--to make sure the software is free for all its users.  This
 General Public License applies to most of the Free Software
 Foundation's software and to any other program whose authors commit to
 using it.  (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.)  You can apply it to
+the GNU Lesser General Public License instead.)  You can apply it to
 your programs, too.
 
   When we speak of free software, we are referring to freedom, not
@@ -55,8 +55,8 @@ patent must be licensed for everyone's free use or not licensed at all.
 
   The precise terms and conditions for copying, distribution and
 modification follow.
-
-		    GNU GENERAL PUBLIC LICENSE
+
+                    GNU GENERAL PUBLIC LICENSE
    TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
 
   0. This License applies to any program or other work which contains
@@ -110,7 +110,7 @@ above, provided that you also meet all of these conditions:
     License.  (Exception: if the Program itself is interactive but
     does not normally print such an announcement, your work based on
     the Program is not required to print an announcement.)
-
+
 These requirements apply to the modified work as a whole.  If
 identifiable sections of that work are not derived from the Program,
 and can be reasonably considered independent and separate works in
@@ -168,7 +168,7 @@ access to copy from a designated place, then offering equivalent
 access to copy the source code from the same place counts as
 distribution of the source code, even though third parties are not
 compelled to copy the source along with the object code.
-
+
   4. You may not copy, modify, sublicense, or distribute the Program
 except as expressly provided under this License.  Any attempt
 otherwise to copy, modify, sublicense or distribute the Program is
@@ -225,7 +225,7 @@ impose that choice.
 
 This section is intended to make thoroughly clear what is believed to
 be a consequence of the rest of this License.
-
+
   8. If the distribution and/or use of the Program is restricted in
 certain countries either by patents or by copyrighted interfaces, the
 original copyright holder who places the Program under this License
@@ -255,7 +255,7 @@ make exceptions for this.  Our decision will be guided by the two goals
 of preserving the free status of all derivatives of our free software and
 of promoting the sharing and reuse of software generally.
 
-			    NO WARRANTY
+                            NO WARRANTY
 
   11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
 FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
@@ -277,9 +277,9 @@ YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
 PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
 POSSIBILITY OF SUCH DAMAGES.
 
-		     END OF TERMS AND CONDITIONS
-
-	    How to Apply These Terms to Your New Programs
+                     END OF TERMS AND CONDITIONS
+
+            How to Apply These Terms to Your New Programs
 
   If you develop a new program, and you want it to be of the greatest
 possible use to the public, the best way to achieve this is to make it
@@ -303,10 +303,9 @@ the "copyright" line and a pointer to where the full notice is found.
     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
     GNU General Public License for more details.
 
-    You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
-
+    You should have received a copy of the GNU General Public License along
+    with this program; if not, write to the Free Software Foundation, Inc.,
+    51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
 
 Also add information on how to contact you by electronic and paper mail.
 
@@ -336,5 +335,5 @@ necessary.  Here is a sample; alter the names:
 This General Public License does not permit incorporating your program into
 proprietary programs.  If your program is a subroutine library, you may
 consider it more useful to permit linking proprietary applications with the
-library.  If this is what you want to do, use the GNU Library General
+library.  If this is what you want to do, use the GNU Lesser General
 Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..35a8e75876
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,7 @@
+#
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
+# So all tests will cause failure.
+#
diff --git a/LEGAL b/LEGAL
index 121c5a7184..2777aa2c14 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,56 +1,331 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
 
 All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-oniggnu.h:
-oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regex.c:
-regexec.c:
-reggnu.c:
-regint.h:
-regparse.[ch]:
-ascii.c:
-euc_jp.c:
-sjis.c:
-utf8.c:
+[addr2line.c]
+
+  A part of this file is from FreeBSD.
+
+  >>>
+    Copyright (c) 1986, 1988, 1991, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    (c) UNIX System Laboratories, Inc.
+
+    All or some portions of this file are derived from material licensed
+    to the University of California by American Telephone and Telegraph
+    Co. or Unix System Laboratories, Inc. and are reproduced herein with
+    the permission of UNIX System Laboratories, Inc.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    4. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+  This file is licensed under the {MIT License}[rdoc-ref:@MIT+License].
+
+[coroutine]
+
+  Unless otherwise specified, these files are licensed under the
+  {MIT License}[rdoc-ref:@MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+  Onigmo (Oniguruma-mod) LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  Oniguruma LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  * https://github.com/k-takata/Onigmo/
+  * https://github.com/kkos/oniguruma
+  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+    When this software is partly used or it is distributed with Ruby,
+    this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
 
-Oniguruma  ----   (C) K.Kosako <kosako@sofnec.co.jp>
+  >>>
+    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
+                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-http://www.geocities.jp/kosako1/oniguruma/
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
 
-   When this software is partly used or it is distributed with Ruby, 
-   this of Ruby follows the license of Ruby.
+  >>>
+    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
 
-configure:
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+  These files have this explanatory texts.
+
+  >>>
+    This mapping data was created from files provided by Unicode, Inc.
+    (The Unicode Consortium). The files were used to create a product supporting
+    Unicode, as explicitly permitted in the files' copyright notices.
+    Please note that Unicode, Inc. never made any claims as to fitness of these
+    files for any particular purpose, and has ceased to publish the files many
+    years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    © 2015 Unicode®, Inc.
+
+    For terms of use, see http://www.unicode.org/terms_of_use.html
+
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    Copyright (C) 2006:: Project X0213, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+  >>>
+    Copyright (C) 2001-2005:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+  >>>
+    Copyright (C) 2001-2002:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+
+[configure]
 
   This file is free software.
 
-    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
 
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-config.guess:
-config.sub:
-parse.c:
+[tool/config.guess]
+[tool/config.sub]
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
 
-      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
-      Free Software Foundation, Inc.
+  >>>
+    Copyright 1992-2018:: Free Software Foundation, Inc.
 
     This file is free software; you can redistribute it and/or modify it
     under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
+    the Free Software Foundation; either version 3 of the License, or
     (at your option) any later version.
 
     This program is distributed in the hope that it will be useful, but
@@ -59,54 +334,165 @@ parse.c:
     General Public License for more details.
 
     You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+    along with this program; if not, see <https://www.gnu.org/licenses/>.
 
     As a special exception to the GNU General Public License, if you
     distribute this file as part of a program that contains a
     configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that program.
+    the same distribution terms that you use for the rest of that
+    program.  This Exception is an additional permission under section 7
+    of the GNU General Public License, version 3 ("GPLv3").
+
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
+
+  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+  distributed under the MIT License.
+
+  >>>
+    Copyright (c) Ryan Davis, seattle.rb
+
+    Permission is hereby granted, free of charge, to any person obtaining
+    a copy of this software and associated documentation files (the
+    'Software'), to deal in the Software without restriction, including
+    without limitation the rights to use, copy, modify, merge, publish,
+    distribute, sublicense, and/or sell copies of the Software, and to
+    permit persons to whom the Software is furnished to do so, subject to
+    the following conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+  These files are licensed under the GPL, but are incorporated into Ruby and
+  redistributed under the terms of the Ruby license, as permitted by the
+  exception to the GPL below.
+
+  >>>
+    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+    As a special exception, you may create a larger work that contains
+    part or all of the Bison parser skeleton and distribute that work
+    under terms of your choice, so long as that work isn't itself a
+    parser generator using the skeleton or a modified version thereof
+    as a parser skeleton.  Alternatively, if you modify or redistribute
+    the parser skeleton itself, you may (at your option) remove this
+    special exception, which will cause the skeleton and the resulting
+    Bison output files to be licensed under the GNU General Public
+    License without this special exception.
+
+    This special exception was added by the Free Software Foundation in
+    version 2.2 of Bison.
+
+[missing/dtoa.c]
+
+  This file is under these licenses.
 
-util.c (partly):
-win32/win32.[ch]:
+  >>>
+    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose without fee is hereby granted, provided that this entire notice
+    is included in all copies of any software which is or includes a copy
+    or modification of this software and in all copies of the supporting
+    documentation for such software.
+
+    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
+  >>>
+    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+                              All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
 
   You can apply the Artistic License to these files. (or GPL,
   alternatively)
 
-    Copyright (c) 1993, Intergraph Corporation
+  >>>
+    Copyright (c) 1993:: Intergraph Corporation
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-random.c
+[missing/mt19937.c]
 
   This file is under the new-style BSD license.
 
-    A C-program for MT19937, with initialization improved 2002/2/10.
+  >>>
+    A C-program for MT19937, with initialization improved 2002/2/10.::
     Coded by Takuji Nishimura and Makoto Matsumoto.
+
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
-    Before using, initialize the state by using init_genrand(seed) 
+    Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
-    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.                          
+    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+                                All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
     are met:
 
-      1. Redistributions of source code must retain the above copyright
-	 notice, this list of conditions and the following disclaimer.
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
 
-      2. Redistributions in binary form must reproduce the above copyright
-	 notice, this list of conditions and the following disclaimer in the
-	 documentation and/or other materials provided with the distribution.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
 
-      3. The names of its contributors may not be used to endorse or promote 
-	 products derived from this software without specific prior written 
-	 permission.
+    3. The names of its contributors may not be used to endorse or promote
+       products derived from this software without specific prior written
+       permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
     "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -125,72 +511,15 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
-st.[ch]:
-x68/*:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/mkdir.c:
-missing/strcasecmp.c:
-missing/strchr.c:
-missing/streror.c:
-missing/strftime.c:
-missing/strncasecmp.c:
-missing/strstr.c:
-missing/strtol.c:
-ext/digest/sha1/sha1.[ch]:
-
-  These files are all under public domain.
-
-missing/strtod.c:
-
-  This file will not be used on most platforms depending on how the
-  configure script results.  In any case you must not receive any fee
-  with the file itself.
-
-    Copyright (c) 1988-1993 The Regents of the University of California.
-    Copyright (c) 1994 Sun Microsystems, Inc.
-
-    Permission to use, copy, modify, and distribute this
-    software and its documentation for any purpose and without
-    fee is hereby granted, provided that the above copyright
-    notice appear in all copies.  The University of California
-    makes no representations about the suitability of this
-    software for any purpose.  It is provided "as is" without
-    express or implied warranty.
-
-missing/strtoul.c:
+  The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
 
-  This file will not be used on most platforms depending on how the
-  configure script results.  In any case you must not receive any fee
-  with the file itself.
+[missing/procstat_vm.c]
 
-    Copyright 1988 Regents of the University of California
-
-    Permission to use, copy, modify, and distribute this
-    software and its documentation for any purpose and without
-    fee is hereby granted, provided that the above copyright
-    notice appear in all copies.  The University of California
-    makes no representations about the suitability of this
-    software for any purpose.  It is provided "as is" without
-    express or implied warranty.
-
-missing/vsnprintf.c:
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  This file is under the new-style BSD license.
 
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
-
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
+  >>>
+    Copyright (c) 2007:: Robert N. M. Watson
+                         All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -200,18 +529,11 @@ missing/vsnprintf.c:
     2. Redistributions in binary form must reproduce the above copyright
        notice, this list of conditions and the following disclaimer in the
        documentation and/or other materials provided with the distribution.
-    3. All advertising materials mentioning features or use of this software
-       must display the following acknowledgement:
-         This product includes software developed by the University of
-         California, Berkeley and its contributors.
-    4. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
 
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
     ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
     IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
     FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
     DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
     OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
@@ -220,17 +542,100 @@ missing/vsnprintf.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
+    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+[vsnprintf.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+
+  >>>
+    Copyright (c) 1990, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
+
+  These files are all under public domain.
+
+[missing/crypt.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+
+  >>>
+    Copyright (c) 1989, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Tom Truscott.
+
+[missing/setproctitle.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
 
-ext/digest/md5/md5.[ch]:
+  >>>
+    Copyright 2003:: Damien Miller
+    Copyright (c) 1983, 1995-1997:: Eric P. Allman
+    Copyright (c) 1988, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+[missing/strlcat.c]
+[missing/strlcpy.c]
+
+  These files are under an ISC-style license.
+
+  >>>
+    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose with or without fee is hereby granted, provided that the above
+    copyright notice and this permission notice appear in all copies.
+
+    THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+    WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+    MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+    ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+    WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+    ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+    OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+
+[missing/langinfo.c]
+
+  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+  Ruby uses a modified version. The file contains the following
+  author/copyright notice:
+
+  >>>
+    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+    Permission to use, copy, modify, and distribute this software
+    for any purpose and without fee is hereby granted. The author
+    disclaims all warranties with regard to this software.
+
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
 
   These files are under the following license.  Ruby uses modified
   versions of them.
 
-    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
+  >>>
+    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
 
     This software is provided 'as-is', without any express or implied
     warranty.  In no event will the authors be held liable for any damages
@@ -251,34 +656,27 @@ ext/digest/md5/md5.[ch]:
     L. Peter Deutsch
     ghost@aladdin.com
 
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
 
   These files have the following copyright information, and by the
   author we are allowed to use it under the new-style BSD license.
 
-    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
+  >>>
+    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
               (Arranged for libc by Todd C. Miller)
-    DATE:     1 March 1996
+    DATE::    1 March 1996
 
-    Copyright (c) Katholieke Universiteit Leuven
+    Copyright (c):: Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-ext/digest/rmd160/rmd160hl.c:
-ext/digest/sha1/sha1hl.c:
-
-  These files are under the beer-ware license.
-
-    "THE BEER-WARE LICENSE" (Revision 42):
-    <phk@login.dkuug.dk> wrote this file.  As long as you retain this notice you
-    can do whatever you want with this stuff. If we meet some day, and you think
-    this stuff is worth it, you can buy me a beer in return.   Poul-Henning Kamp
-
-ext/digest/sha2/sha2.[ch]:
-ext/digest/sha2/sha2hl.c:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
 
   These files are under the new-style BSD license.
 
-    Copyright 2000 Aaron D. Gifford.  All rights reserved.
+  >>>
+    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -304,26 +702,71 @@ ext/digest/sha2/sha2hl.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/nkf/nkf1.7/nkf.c:
+[ext/json/vendor/fpconv.c]
+
+  This file is under the {Boost Software License}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/json/vendor/jeaiii-ltoa.h]
+
+  >>>
+    Copyright (c) 2024,2025 Enrico Thierbach - https://github.com/radiospiel
+    Copyright (c) 2022 James Edward Anhalt III - https://github.com/jeaiii/itoa
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[ext/json/vendor/ryu.h]
+  This file is adapted from the Ryu algorithm by Ulf Adams https://github.com/ulfjack/ryu.
+  It is dual-licensed under {Apache License 2.0}[rdoc-ref:@Apache+License+2.0] OR
+  {Boost Software License 1.0}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/psych]
+[test/psych]
 
-  This file is under the following license.  So to speak, it is
-  copyrighted semi-public-domain software.
+  The files under these directories are under the following license.
 
-    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program 
-       including copying, modifying, improving.
-       as long as you don't try to pretend that you wrote it.
-       i.e., the above copyright notice has to appear in all copies.
-       You don't have to ask before copying or publishing.
-       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+  >>>
+    Copyright 2009:: Aaron Patterson, et al.
 
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+    Permission is hereby granted, free of charge, to any person obtaining a copy of
+    this software and associated documentation files (the 'Software'), to deal in
+    the Software without restriction, including without limitation the rights to
+    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+    of the Software, and to permit persons to whom the Software is furnished to do
+    so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in all
+    copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+    SOFTWARE.
+
+[ext/pty/pty.c]
+
+  >>>
+    C) Copyright 1998:: by Akinori Ito.
+
+    This software may be redistributed freely for this purpose, in full
+    or in part, provided that this entire copyright notice is included
+    on any copies of this software and applications and derivations thereof.
+
+    This software is provided on an "as is" basis, without warranty of any
+    kind, either expressed or implied, as to any matter including, but not
+    limited to warranty of fitness of purpose, or merchantability, or
+    results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
 
   These files are under the new-style BSD license.
 
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+  >>>
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
     All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
@@ -350,17 +793,508 @@ ext/socket/getnameinfo.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
 
   You can apply the Artistic License to this file. (or GPL,
   alternatively)
 
-    (c) 1995 Microsoft Corporation. All rights reserved.
+  >>>
+    (c) 1995:: Microsoft Corporation. All rights reserved.
     Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
 
-    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
- 
+
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
+
+  The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+  The files under these directories are under the following license.
+
+  >>>
+    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+    Permission is hereby granted, free of charge, to any person
+    obtaining a copy of this software and associated documentation
+    files (the "Software"), to deal in the Software without
+    restriction, including without limitation the rights to use,
+    copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the
+    Software is furnished to do so, subject to the following
+    conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+    OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+    NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+    HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+    WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+    FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+    OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+  RubyGems is under the following license.
+
+  >>>
+    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+    Weirich and others.  You can redistribute it and/or modify it under
+    either the terms of the {MIT license}[rdoc-ref:@MIT+License], or the conditions
+    below:
+
+    1. You may make and give away verbatim copies of the source form of the
+       software without restriction, provided that you duplicate all of the
+       original copyright notices and associated disclaimers.
+
+    2. You may modify your copy of the software in any way, provided that
+       you do at least ONE of the following:
+
+       a. place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+          modifications to Usenet or an equivalent medium, or by allowing
+          the author to include your modifications in the software.
+
+       b. use the modified software only within your corporation or
+          organization.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    3. You may distribute the software in object code or executable
+       form, provided that you do at least ONE of the following:
+
+       a. distribute the executables and library files of the software,
+          together with instructions (in the manual page or equivalent)
+          on where to get the original distribution.
+
+       b. accompany the distribution with the machine-readable source of
+          the software.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    4. You may modify and include the part of the software into any other
+       software (possibly commercial).
+
+    5. The scripts and library files supplied as input to or produced as
+       output from the software do not automatically fall under the
+       copyright of the software, but belong to whomever generated them,
+       and may be sold commercially, and may be aggregated with this
+       software.
+
+    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+       PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
+
+  Bundler is under the following license.
+
+  >>>
+    Portions copyright (c) 2010:: Andre Arko
+    Portions copyright (c) 2009:: Engine Yard
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/thor]
+
+  Thor is under the following license.
+
+  >>>
+    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/rubygems/vendor/molinillo]
+
+  molinillo is under the following license.
+
+  >>>
+    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/pub_grub]
+
+  pub_grub is under the following license.
+
+  >>>
+    Copyright (c) 2018 John Hawthorn
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/connection_pool]
+
+  connection_pool is under the following license.
+
+  >>>
+    Copyright (c) 2011 Mike Perham
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/net-http-persistent]
+
+  net-http-persistent is under the following license.
+
+  >>>
+    Copyright (c) Eric Hodel, Aaron Patterson
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+  did_you_mean is under the following license.
+
+  >>>
+    Copyright (c) 2014-2016 Yuki Nishijima
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+  error_highlight is under the following license.
+
+  >>>
+    Copyright (c) 2021 Yusuke Endoh
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+  These files are very old copy of then-called "The Great Computer Language
+  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+  site has been lost.  Upstream diverged to delete several benchmarks listed
+  above.
+
+== MIT License
+>>>
+      Permission is hereby granted, free of charge, to any person obtaining
+      a copy of this software and associated documentation files (the
+      "Software"), to deal in the Software without restriction, including
+      without limitation the rights to use, copy, modify, merge, publish,
+      distribute, sublicense, and/or sell copies of the Software, and to
+      permit persons to whom the Software is furnished to do so, subject to
+      the following conditions:
+
+      The above copyright notice and this permission notice shall be
+      included in all copies or substantial portions of the Software.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+      Redistribution and use in source and binary forms, with or without
+      modification, are permitted provided that the following conditions
+      are met:
+      1. Redistributions of source code must retain the above copyright
+         notice, this list of conditions and the following disclaimer.
+      2. Redistributions in binary form must reproduce the above copyright
+         notice, this list of conditions and the following disclaimer in the
+         documentation and/or other materials provided with the distribution.
+      3. Neither the name of the University nor the names of its contributors
+         may be used to endorse or promote products derived from this software
+         without specific prior written permission.
+
+      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+      SUCH DAMAGE.
+
+      IMPORTANT NOTE::
+
+      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+      paragraph 3 above is now null and void.
+
+== Boost Software License 1.0
+
+>>>
+      Boost Software License - Version 1.0 - August 17th, 2003
+
+      Permission is hereby granted, free of charge, to any person or organization
+      obtaining a copy of the software and accompanying documentation covered by
+      this license (the "Software") to use, reproduce, display, distribute,
+      execute, and transmit the Software, and to prepare derivative works of the
+      Software, and to permit third-parties to whom the Software is furnished to
+      do so, all subject to the following:
+
+      The copyright notices in the Software and this entire statement, including
+      the above license grant, this restriction and the following disclaimer,
+      must be included in all copies of the Software, in whole or in part, and
+      all derivative works of the Software, unless such copies or derivative
+      works are solely in the form of machine-executable object code generated by
+      a source language processor.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+      IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+      FITNESS FOR A PARTICULAR PURPOSE, TITLE AND NON-INFRINGEMENT. IN NO EVENT
+      SHALL THE COPYRIGHT HOLDERS OR ANYONE DISTRIBUTING THE SOFTWARE BE LIABLE
+      FOR ANY DAMAGES OR OTHER LIABILITY, WHETHER IN CONTRACT, TORT OR OTHERWISE,
+      ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
+      DEALINGS IN THE SOFTWARE.
+
+== Apache License 2.0
+
+>>>
+      Apache License
+      Version 2.0, January 2004
+      http://www.apache.org/licenses/
+
+      TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
+
+      1. Definitions.
+
+         "License" shall mean the terms and conditions for use, reproduction,
+         and distribution as defined by Sections 1 through 9 of this document.
+
+         "Licensor" shall mean the copyright owner or entity authorized by
+         the copyright owner that is granting the License.
+
+         "Legal Entity" shall mean the union of the acting entity and all
+         other entities that control, are controlled by, or are under common
+         control with that entity. For the purposes of this definition,
+         "control" means (i) the power, direct or indirect, to cause the
+         direction or management of such entity, whether by contract or
+         otherwise, or (ii) ownership of fifty percent (50%) or more of the
+         outstanding shares, or (iii) beneficial ownership of such entity.
+
+         "You" (or "Your") shall mean an individual or Legal Entity
+         exercising permissions granted by this License.
+
+         "Source" form shall mean the preferred form for making modifications,
+         including but not limited to software source code, documentation
+         source, and configuration files.
+
+         "Object" form shall mean any form resulting from mechanical
+         transformation or translation of a Source form, including but
+         not limited to compiled object code, generated documentation,
+         and conversions to other media types.
+
+         "Work" shall mean the work of authorship, whether in Source or
+         Object form, made available under the License, as indicated by a
+         copyright notice that is included in or attached to the work
+         (an example is provided in the Appendix below).
+
+         "Derivative Works" shall mean any work, whether in Source or Object
+         form, that is based on (or derived from) the Work and for which the
+         editorial revisions, annotations, elaborations, or other modifications
+         represent, as a whole, an original work of authorship. For the purposes
+         of this License, Derivative Works shall not include works that remain
+         separable from, or merely link (or bind by name) to the interfaces of,
+         the Work and Derivative Works thereof.
+
+         "Contribution" shall mean any work of authorship, including
+         the original version of the Work and any modifications or additions
+         to that Work or Derivative Works thereof, that is intentionally
+         submitted to Licensor for inclusion in the Work by the copyright owner
+         or by an individual or Legal Entity authorized to submit on behalf of
+         the copyright owner. For the purposes of this definition, "submitted"
+         means any form of electronic, verbal, or written communication sent
+         to the Licensor or its representatives, including but not limited to
+         communication on electronic mailing lists, source code control systems,
+         and issue tracking systems that are managed by, or on behalf of, the
+         Licensor for the purpose of discussing and improving the Work, but
+         excluding communication that is conspicuously marked or otherwise
+         designated in writing by the copyright owner as "Not a Contribution."
+
+         "Contributor" shall mean Licensor and any individual or Legal Entity
+         on behalf of whom a Contribution has been received by Licensor and
+         subsequently incorporated within the Work.
+
+      2. Grant of Copyright License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         copyright license to reproduce, prepare Derivative Works of,
+         publicly display, publicly perform, sublicense, and distribute the
+         Work and such Derivative Works in Source or Object form.
+
+      3. Grant of Patent License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         (except as stated in this section) patent license to make, have made,
+         use, offer to sell, sell, import, and otherwise transfer the Work,
+         where such license applies only to those patent claims licensable
+         by such Contributor that are necessarily infringed by their
+         Contribution(s) alone or by combination of their Contribution(s)
+         with the Work to which such Contribution(s) was submitted. If You
+         institute patent litigation against any entity (including a
+         cross-claim or counterclaim in a lawsuit) alleging that the Work
+         or a Contribution incorporated within the Work constitutes direct
+         or contributory patent infringement, then any patent licenses
+         granted to You under this License for that Work shall terminate
+         as of the date such litigation is filed.
+
+      4. Redistribution. You may reproduce and distribute copies of the
+         Work or Derivative Works thereof in any medium, with or without
+         modifications, and in Source or Object form, provided that You
+         meet the following conditions:
+
+         a.  You must give any other recipients of the Work or
+             Derivative Works a copy of this License; and
+
+         b.  You must cause any modified files to carry prominent notices
+             stating that You changed the files; and
+
+         c.  You must retain, in the Source form of any Derivative Works
+             that You distribute, all copyright, patent, trademark, and
+             attribution notices from the Source form of the Work,
+             excluding those notices that do not pertain to any part of
+             the Derivative Works; and
+
+         d.  If the Work includes a "NOTICE" text file as part of its
+             distribution, then any Derivative Works that You distribute must
+             include a readable copy of the attribution notices contained
+             within such NOTICE file, excluding those notices that do not
+             pertain to any part of the Derivative Works, in at least one
+             of the following places: within a NOTICE text file distributed
+             as part of the Derivative Works; within the Source form or
+             documentation, if provided along with the Derivative Works; or,
+             within a display generated by the Derivative Works, if and
+             wherever such third-party notices normally appear. The contents
+             of the NOTICE file are for informational purposes only and
+             do not modify the License. You may add Your own attribution
+             notices within Derivative Works that You distribute, alongside
+             or as an addendum to the NOTICE text from the Work, provided
+             that such additional attribution notices cannot be construed
+             as modifying the License.
+
+         You may add Your own copyright statement to Your modifications and
+         may provide additional or different license terms and conditions
+         for use, reproduction, or distribution of Your modifications, or
+         for any such Derivative Works as a whole, provided Your use,
+         reproduction, and distribution of the Work otherwise complies with
+         the conditions stated in this License.
+
+      5. Submission of Contributions. Unless You explicitly state otherwise,
+         any Contribution intentionally submitted for inclusion in the Work
+         by You to the Licensor shall be under the terms and conditions of
+         this License, without any additional terms or conditions.
+         Notwithstanding the above, nothing herein shall supersede or modify
+         the terms of any separate license agreement you may have executed
+         with Licensor regarding such Contributions.
+
+      6. Trademarks. This License does not grant permission to use the trade
+         names, trademarks, service marks, or product names of the Licensor,
+         except as required for reasonable and customary use in describing the
+         origin of the Work and reproducing the content of the NOTICE file.
+
+      7. Disclaimer of Warranty. Unless required by applicable law or
+         agreed to in writing, Licensor provides the Work (and each
+         Contributor provides its Contributions) on an "AS IS" BASIS,
+         WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
+         implied, including, without limitation, any warranties or conditions
+         of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
+         PARTICULAR PURPOSE. You are solely responsible for determining the
+         appropriateness of using or redistributing the Work and assume any
+         risks associated with Your exercise of permissions under this License.
+
+      8. Limitation of Liability. In no event and under no legal theory,
+         whether in tort (including negligence), contract, or otherwise,
+         unless required by applicable law (such as deliberate and grossly
+         negligent acts) or agreed to in writing, shall any Contributor be
+         liable to You for damages, including any direct, indirect, special,
+         incidental, or consequential damages of any character arising as a
+         result of this License or out of the use or inability to use the
+         Work (including but not limited to damages for loss of goodwill,
+         work stoppage, computer failure or malfunction, or any and all
+         other commercial damages or losses), even if such Contributor
+         has been advised of the possibility of such damages.
+
+      9. Accepting Warranty or Additional Liability. While redistributing
+         the Work or Derivative Works thereof, You may choose to offer,
+         and charge a fee for, acceptance of support, warranty, indemnity,
+         or other liability obligations and/or rights consistent with this
+         License. However, in accepting such obligations, You may act only
+         on Your own behalf and on Your sole responsibility, not on behalf
+         of any other Contributor, and only if You agree to indemnify,
+         defend, and hold each Contributor harmless for any liability
+         incurred by, or claims asserted against, such Contributor by reason
+         of your accepting any such warranty or additional liability.
+
+      END OF TERMS AND CONDITIONS
+
+      APPENDIX: How to apply the Apache License to your work.
+
+      >>>
+         To apply the Apache License to your work, attach the following
+         boilerplate notice, with the fields enclosed by brackets "[]"
+         replaced with your own identifying information. (Don't include
+         the brackets!)  The text should be enclosed in the appropriate
+         comment syntax for the file format. We also recommend that a
+         file or class name and description of purpose be included on the
+         same "printed page" as the copyright notice for easier
+         identification within third-party archives.
+
+      Copyright [yyyy] [name of copyright owner]
+
+      Licensed under the Apache License, Version 2.0 (the "License");
+      you may not use this file except in compliance with the License.
+      You may obtain a copy of the License at
+
+          http://www.apache.org/licenses/LICENSE-2.0
+
+      Unless required by applicable law or agreed to in writing, software
+      distributed under the License is distributed on an "AS IS" BASIS,
+      WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+      See the License for the specific language governing permissions and
+      limitations under the License.
diff --git a/LGPL b/LGPL
deleted file mode 100644
index b1e3f5a263..0000000000
--- a/LGPL
+++ /dev/null
@@ -1,504 +0,0 @@
-		  GNU LESSER GENERAL PUBLIC LICENSE
-		       Version 2.1, February 1999
-
- Copyright (C) 1991, 1999 Free Software Foundation, Inc.
-     59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
-[This is the first released version of the Lesser GPL.  It also counts
- as the successor of the GNU Library Public License, version 2, hence
- the version number 2.1.]
-
-			    Preamble
-
-  The licenses for most software are designed to take away your
-freedom to share and change it.  By contrast, the GNU General Public
-Licenses are intended to guarantee your freedom to share and change
-free software--to make sure the software is free for all its users.
-
-  This license, the Lesser General Public License, applies to some
-specially designated software packages--typically libraries--of the
-Free Software Foundation and other authors who decide to use it.  You
-can use it too, but we suggest you first think carefully about whether
-this license or the ordinary General Public License is the better
-strategy to use in any particular case, based on the explanations below.
-
-  When we speak of free software, we are referring to freedom of use,
-not price.  Our General Public Licenses are designed to make sure that
-you have the freedom to distribute copies of free software (and charge
-for this service if you wish); that you receive source code or can get
-it if you want it; that you can change the software and use pieces of
-it in new free programs; and that you are informed that you can do
-these things.
-
-  To protect your rights, we need to make restrictions that forbid
-distributors to deny you these rights or to ask you to surrender these
-rights.  These restrictions translate to certain responsibilities for
-you if you distribute copies of the library or if you modify it.
-
-  For example, if you distribute copies of the library, whether gratis
-or for a fee, you must give the recipients all the rights that we gave
-you.  You must make sure that they, too, receive or can get the source
-code.  If you link other code with the library, you must provide
-complete object files to the recipients, so that they can relink them
-with the library after making changes to the library and recompiling
-it.  And you must show them these terms so they know their rights.
-
-  We protect your rights with a two-step method: (1) we copyright the
-library, and (2) we offer you this license, which gives you legal
-permission to copy, distribute and/or modify the library.
-
-  To protect each distributor, we want to make it very clear that
-there is no warranty for the free library.  Also, if the library is
-modified by someone else and passed on, the recipients should know
-that what they have is not the original version, so that the original
-author's reputation will not be affected by problems that might be
-introduced by others.
-
-  Finally, software patents pose a constant threat to the existence of
-any free program.  We wish to make sure that a company cannot
-effectively restrict the users of a free program by obtaining a
-restrictive license from a patent holder.  Therefore, we insist that
-any patent license obtained for a version of the library must be
-consistent with the full freedom of use specified in this license.
-
-  Most GNU software, including some libraries, is covered by the
-ordinary GNU General Public License.  This license, the GNU Lesser
-General Public License, applies to certain designated libraries, and
-is quite different from the ordinary General Public License.  We use
-this license for certain libraries in order to permit linking those
-libraries into non-free programs.
-
-  When a program is linked with a library, whether statically or using
-a shared library, the combination of the two is legally speaking a
-combined work, a derivative of the original library.  The ordinary
-General Public License therefore permits such linking only if the
-entire combination fits its criteria of freedom.  The Lesser General
-Public License permits more lax criteria for linking other code with
-the library.
-
-  We call this license the "Lesser" General Public License because it
-does Less to protect the user's freedom than the ordinary General
-Public License.  It also provides other free software developers Less
-of an advantage over competing non-free programs.  These disadvantages
-are the reason we use the ordinary General Public License for many
-libraries.  However, the Lesser license provides advantages in certain
-special circumstances.
-
-  For example, on rare occasions, there may be a special need to
-encourage the widest possible use of a certain library, so that it becomes
-a de-facto standard.  To achieve this, non-free programs must be
-allowed to use the library.  A more frequent case is that a free
-library does the same job as widely used non-free libraries.  In this
-case, there is little to gain by limiting the free library to free
-software only, so we use the Lesser General Public License.
-
-  In other cases, permission to use a particular library in non-free
-programs enables a greater number of people to use a large body of
-free software.  For example, permission to use the GNU C Library in
-non-free programs enables many more people to use the whole GNU
-operating system, as well as its variant, the GNU/Linux operating
-system.
-
-  Although the Lesser General Public License is Less protective of the
-users' freedom, it does ensure that the user of a program that is
-linked with the Library has the freedom and the wherewithal to run
-that program using a modified version of the Library.
-
-  The precise terms and conditions for copying, distribution and
-modification follow.  Pay close attention to the difference between a
-"work based on the library" and a "work that uses the library".  The
-former contains code derived from the library, whereas the latter must
-be combined with the library in order to run.
-
-		  GNU LESSER GENERAL PUBLIC LICENSE
-   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
-  0. This License Agreement applies to any software library or other
-program which contains a notice placed by the copyright holder or
-other authorized party saying it may be distributed under the terms of
-this Lesser General Public License (also called "this License").
-Each licensee is addressed as "you".
-
-  A "library" means a collection of software functions and/or data
-prepared so as to be conveniently linked with application programs
-(which use some of those functions and data) to form executables.
-
-  The "Library", below, refers to any such software library or work
-which has been distributed under these terms.  A "work based on the
-Library" means either the Library or any derivative work under
-copyright law: that is to say, a work containing the Library or a
-portion of it, either verbatim or with modifications and/or translated
-straightforwardly into another language.  (Hereinafter, translation is
-included without limitation in the term "modification".)
-
-  "Source code" for a work means the preferred form of the work for
-making modifications to it.  For a library, complete source code means
-all the source code for all modules it contains, plus any associated
-interface definition files, plus the scripts used to control compilation
-and installation of the library.
-
-  Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope.  The act of
-running a program using the Library is not restricted, and output from
-such a program is covered only if its contents constitute a work based
-on the Library (independent of the use of the Library in a tool for
-writing it).  Whether that is true depends on what the Library does
-and what the program that uses the Library does.
-  
-  1. You may copy and distribute verbatim copies of the Library's
-complete source code as you receive it, in any medium, provided that
-you conspicuously and appropriately publish on each copy an
-appropriate copyright notice and disclaimer of warranty; keep intact
-all the notices that refer to this License and to the absence of any
-warranty; and distribute a copy of this License along with the
-Library.
-
-  You may charge a fee for the physical act of transferring a copy,
-and you may at your option offer warranty protection in exchange for a
-fee.
-
-  2. You may modify your copy or copies of the Library or any portion
-of it, thus forming a work based on the Library, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
-    a) The modified work must itself be a software library.
-
-    b) You must cause the files modified to carry prominent notices
-    stating that you changed the files and the date of any change.
-
-    c) You must cause the whole of the work to be licensed at no
-    charge to all third parties under the terms of this License.
-
-    d) If a facility in the modified Library refers to a function or a
-    table of data to be supplied by an application program that uses
-    the facility, other than as an argument passed when the facility
-    is invoked, then you must make a good faith effort to ensure that,
-    in the event an application does not supply such function or
-    table, the facility still operates, and performs whatever part of
-    its purpose remains meaningful.
-
-    (For example, a function in a library to compute square roots has
-    a purpose that is entirely well-defined independent of the
-    application.  Therefore, Subsection 2d requires that any
-    application-supplied function or table used by this function must
-    be optional: if the application does not supply it, the square
-    root function must still compute square roots.)
-
-These requirements apply to the modified work as a whole.  If
-identifiable sections of that work are not derived from the Library,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works.  But when you
-distribute the same sections as part of a whole which is a work based
-on the Library, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote
-it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Library.
-
-In addition, mere aggregation of another work not based on the Library
-with the Library (or with a work based on the Library) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
-  3. You may opt to apply the terms of the ordinary GNU General Public
-License instead of this License to a given copy of the Library.  To do
-this, you must alter all the notices that refer to this License, so
-that they refer to the ordinary GNU General Public License, version 2,
-instead of to this License.  (If a newer version than version 2 of the
-ordinary GNU General Public License has appeared, then you can specify
-that version instead if you wish.)  Do not make any other change in
-these notices.
-
-  Once this change is made in a given copy, it is irreversible for
-that copy, so the ordinary GNU General Public License applies to all
-subsequent copies and derivative works made from that copy.
-
-  This option is useful when you wish to copy part of the code of
-the Library into a program that is not a library.
-
-  4. You may copy and distribute the Library (or a portion or
-derivative of it, under Section 2) in object code or executable form
-under the terms of Sections 1 and 2 above provided that you accompany
-it with the complete corresponding machine-readable source code, which
-must be distributed under the terms of Sections 1 and 2 above on a
-medium customarily used for software interchange.
-
-  If distribution of object code is made by offering access to copy
-from a designated place, then offering equivalent access to copy the
-source code from the same place satisfies the requirement to
-distribute the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
-  5. A program that contains no derivative of any portion of the
-Library, but is designed to work with the Library by being compiled or
-linked with it, is called a "work that uses the Library".  Such a
-work, in isolation, is not a derivative work of the Library, and
-therefore falls outside the scope of this License.
-
-  However, linking a "work that uses the Library" with the Library
-creates an executable that is a derivative of the Library (because it
-contains portions of the Library), rather than a "work that uses the
-library".  The executable is therefore covered by this License.
-Section 6 states terms for distribution of such executables.
-
-  When a "work that uses the Library" uses material from a header file
-that is part of the Library, the object code for the work may be a
-derivative work of the Library even though the source code is not.
-Whether this is true is especially significant if the work can be
-linked without the Library, or if the work is itself a library.  The
-threshold for this to be true is not precisely defined by law.
-
-  If such an object file uses only numerical parameters, data
-structure layouts and accessors, and small macros and small inline
-functions (ten lines or less in length), then the use of the object
-file is unrestricted, regardless of whether it is legally a derivative
-work.  (Executables containing this object code plus portions of the
-Library will still fall under Section 6.)
-
-  Otherwise, if the work is a derivative of the Library, you may
-distribute the object code for the work under the terms of Section 6.
-Any executables containing that work also fall under Section 6,
-whether or not they are linked directly with the Library itself.
-
-  6. As an exception to the Sections above, you may also combine or
-link a "work that uses the Library" with the Library to produce a
-work containing portions of the Library, and distribute that work
-under terms of your choice, provided that the terms permit
-modification of the work for the customer's own use and reverse
-engineering for debugging such modifications.
-
-  You must give prominent notice with each copy of the work that the
-Library is used in it and that the Library and its use are covered by
-this License.  You must supply a copy of this License.  If the work
-during execution displays copyright notices, you must include the
-copyright notice for the Library among them, as well as a reference
-directing the user to the copy of this License.  Also, you must do one
-of these things:
-
-    a) Accompany the work with the complete corresponding
-    machine-readable source code for the Library including whatever
-    changes were used in the work (which must be distributed under
-    Sections 1 and 2 above); and, if the work is an executable linked
-    with the Library, with the complete machine-readable "work that
-    uses the Library", as object code and/or source code, so that the
-    user can modify the Library and then relink to produce a modified
-    executable containing the modified Library.  (It is understood
-    that the user who changes the contents of definitions files in the
-    Library will not necessarily be able to recompile the application
-    to use the modified definitions.)
-
-    b) Use a suitable shared library mechanism for linking with the
-    Library.  A suitable mechanism is one that (1) uses at run time a
-    copy of the library already present on the user's computer system,
-    rather than copying library functions into the executable, and (2)
-    will operate properly with a modified version of the library, if
-    the user installs one, as long as the modified version is
-    interface-compatible with the version that the work was made with.
-
-    c) Accompany the work with a written offer, valid for at
-    least three years, to give the same user the materials
-    specified in Subsection 6a, above, for a charge no more
-    than the cost of performing this distribution.
-
-    d) If distribution of the work is made by offering access to copy
-    from a designated place, offer equivalent access to copy the above
-    specified materials from the same place.
-
-    e) Verify that the user has already received a copy of these
-    materials or that you have already sent this user a copy.
-
-  For an executable, the required form of the "work that uses the
-Library" must include any data and utility programs needed for
-reproducing the executable from it.  However, as a special exception,
-the materials to be distributed need not include anything that is
-normally distributed (in either source or binary form) with the major
-components (compiler, kernel, and so on) of the operating system on
-which the executable runs, unless that component itself accompanies
-the executable.
-
-  It may happen that this requirement contradicts the license
-restrictions of other proprietary libraries that do not normally
-accompany the operating system.  Such a contradiction means you cannot
-use both them and the Library together in an executable that you
-distribute.
-
-  7. You may place library facilities that are a work based on the
-Library side-by-side in a single library together with other library
-facilities not covered by this License, and distribute such a combined
-library, provided that the separate distribution of the work based on
-the Library and of the other library facilities is otherwise
-permitted, and provided that you do these two things:
-
-    a) Accompany the combined library with a copy of the same work
-    based on the Library, uncombined with any other library
-    facilities.  This must be distributed under the terms of the
-    Sections above.
-
-    b) Give prominent notice with the combined library of the fact
-    that part of it is a work based on the Library, and explaining
-    where to find the accompanying uncombined form of the same work.
-
-  8. You may not copy, modify, sublicense, link with, or distribute
-the Library except as expressly provided under this License.  Any
-attempt otherwise to copy, modify, sublicense, link with, or
-distribute the Library is void, and will automatically terminate your
-rights under this License.  However, parties who have received copies,
-or rights, from you under this License will not have their licenses
-terminated so long as such parties remain in full compliance.
-
-  9. You are not required to accept this License, since you have not
-signed it.  However, nothing else grants you permission to modify or
-distribute the Library or its derivative works.  These actions are
-prohibited by law if you do not accept this License.  Therefore, by
-modifying or distributing the Library (or any work based on the
-Library), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Library or works based on it.
-
-  10. Each time you redistribute the Library (or any work based on the
-Library), the recipient automatically receives a license from the
-original licensor to copy, distribute, link with or modify the Library
-subject to these terms and conditions.  You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties with
-this License.
-
-  11. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License.  If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Library at all.  For example, if a patent
-license would not permit royalty-free redistribution of the Library by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Library.
-
-If any portion of this section is held invalid or unenforceable under any
-particular circumstance, the balance of the section is intended to apply,
-and the section as a whole is intended to apply in other circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system which is
-implemented by public license practices.  Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
-  12. If the distribution and/or use of the Library is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Library under this License may add
-an explicit geographical distribution limitation excluding those countries,
-so that distribution is permitted only in or among countries not thus
-excluded.  In such case, this License incorporates the limitation as if
-written in the body of this License.
-
-  13. The Free Software Foundation may publish revised and/or new
-versions of the Lesser General Public License from time to time.
-Such new versions will be similar in spirit to the present version,
-but may differ in detail to address new problems or concerns.
-
-Each version is given a distinguishing version number.  If the Library
-specifies a version number of this License which applies to it and
-"any later version", you have the option of following the terms and
-conditions either of that version or of any later version published by
-the Free Software Foundation.  If the Library does not specify a
-license version number, you may choose any version ever published by
-the Free Software Foundation.
-
-  14. If you wish to incorporate parts of the Library into other free
-programs whose distribution conditions are incompatible with these,
-write to the author to ask for permission.  For software which is
-copyrighted by the Free Software Foundation, write to the Free
-Software Foundation; we sometimes make exceptions for this.  Our
-decision will be guided by the two goals of preserving the free status
-of all derivatives of our free software and of promoting the sharing
-and reuse of software generally.
-
-			    NO WARRANTY
-
-  15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
-WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
-EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
-OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
-KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE.  THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
-LIBRARY IS WITH YOU.  SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
-THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
-  16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
-WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
-AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
-FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
-CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
-LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
-RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
-FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
-SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
-DAMAGES.
-
-		     END OF TERMS AND CONDITIONS
-
-           How to Apply These Terms to Your New Libraries
-
-  If you develop a new library, and you want it to be of the greatest
-possible use to the public, we recommend making it free software that
-everyone can redistribute and change.  You can do so by permitting
-redistribution under these terms (or, alternatively, under the terms of the
-ordinary General Public License).
-
-  To apply these terms, attach the following notices to the library.  It is
-safest to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least the
-"copyright" line and a pointer to where the full notice is found.
-
-    <one line to give the library's name and a brief idea of what it does.>
-    Copyright (C) <year>  <name of author>
-
-    This library is free software; you can redistribute it and/or
-    modify it under the terms of the GNU Lesser General Public
-    License as published by the Free Software Foundation; either
-    version 2.1 of the License, or (at your option) any later version.
-
-    This library is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-    Lesser General Public License for more details.
-
-    You should have received a copy of the GNU Lesser General Public
-    License along with this library; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
-
-Also add information on how to contact you by electronic and paper mail.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the library, if
-necessary.  Here is a sample; alter the names:
-
-  Yoyodyne, Inc., hereby disclaims all copyright interest in the
-  library `Frob' (a library for tweaking knobs) written by James Random Hacker.
-
-  <signature of Ty Coon>, 1 April 1990
-  Ty Coon, President of Vice
-
-That's all there is to it!
-
-
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 685b879dfc..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,173 +0,0 @@
-SHELL = /bin/sh
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-VPATH = $(srcdir):$(srcdir)/missing
-
-CC = @CC@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-
-TESTUI = console
-TESTS =
-RDOCTARGET = @RDOCTARGET@
-
-EXTOUT = .ext
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-
-OUTFLAG = -o 
-CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
-CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = 
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS = 
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@
-RUNRUBY = @RUNRUBY@
-
-#### End of system configuration section. ####
-
-MAJOR=	@MAJOR@
-MINOR=	@MINOR@
-TEENY=	@TEENY@
-
-LIBRUBY_A     = @LIBRUBY_A@
-LIBRUBY_SO    = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY	      = @LIBRUBY@
-LIBRUBYARG    = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-
-PREP          = @PREP@
-ARCHFILE      = @ARCHFILE@
-SETUP         =
-EXTSTATIC     = @EXTSTATIC@
-
-RM            = rm -f
-NM            = @NM@
-AR            = @AR@
-ARFLAGS       = rcu
-RANLIB        = @RANLIB@
-
-OBJEXT        = @OBJEXT@
-
-EXTOBJS	      = 
-DLDOBJS	      = $(DMYEXT)
-
-MAINOBJ	      = main.$(OBJEXT)
-
-MANTYPE	      = @MANTYPE@
-
-#### End of variables
-
-all:
-
-.DEFAULT: all
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
-		@$(RM) $@
-		$(PURIFY) $(CC) $(MAINOBJ) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@ $(LDFLAGS) $(MAINLIBS)
-
-$(PROGRAM):
-		@$(RM) $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
-		@$(RM) $@
-		$(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
-		@-$(RANLIB) $@ 2> /dev/null || true
-
-$(LIBRUBY_SO):
-		$(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
-						  File.symlink "$(LIBRUBY_SO)", link}' \
-				$(LIBRUBY_ALIASES) || true
-
-fake.rb:	Makefile
-		@echo ' \
-		class Object; \
-		  CROSS_COMPILING = RUBY_PLATFORM; \
-		  remove_const :RUBY_PLATFORM; \
-		  remove_const :RUBY_VERSION; \
-		  RUBY_PLATFORM = "@arch@"; \
-		  RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
-		end; \
-		if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
-		  class File; \
-		    remove_const :ALT_SEPARATOR; \
-		    ALT_SEPARATOR = "\\"; \
-		  end; \
-		end; \
-		' > $@
-
-Makefile:	$(srcdir)/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/common.mk
-		MAKE=$(MAKE) $(SHELL) ./config.status
-		@{ \
-		    echo "all:; -@rm -f conftest.mk"; \
-		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
-		    echo ".force:"; \
-		} > conftest.mk || exit 1; \
-		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "Makefile updated, restart."; exit 1; }
-
-config.status:	$(srcdir)/configure
-		MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
-
-$(srcdir)/configure: $(srcdir)/configure.in
-		cd $(srcdir) && $(AUTOCONF)
-
-lex.c: keywords
-	@-$(RM) $@
-	gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
-	cp "$(srcdir)/$@" .
-
-.y.c:
-	$(YACC) $(YFLAGS) -o $@ $<
-
-.c.@OBJEXT@:
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
-
-clean-local::
-	@$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
-
-distclean-local::
-	@$(RM) ext/config.cache $(RBCONFIG)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..8699bc0bff
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,266 @@
+# NEWS for Ruby 4.1.0
+
+This document is a list of user-visible feature changes
+since the **4.0.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+* `Module#clone` and `Module#dup` no longer rewrite the lexical scope of
+  copied methods. Constants and class variables resolve through the
+  original class, consistent with inheritance and mixins.
+  [[Feature #21981]]
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Array
+
+    * `Array#pack` accepts a new format `R` and `r` for unpacking unsigned
+      and signed LEB128 encoded integers. [[Feature #21785]]
+    * `Array#pack` accepts a new format `^` that returns the current offset.
+      Useful when combined with variable width formats like LEB128. [[Feature #21796]]
+
+* ENV
+
+    * `ENV.fetch_values` is added. It returns an array of values for the
+      given names, raising `KeyError` for missing names unless a block is
+      given. [[Feature #21781]]
+
+* Kernel
+
+    * `Kernel#autoload_relative` and `Module#autoload_relative` are added.
+      These methods work like `autoload`, but resolve the file path relative
+      to the file where the method is called, similar to `require_relative`.
+      This makes it easier to autoload constants from files in the same
+      directory without hardcoding absolute paths or manipulating `$LOAD_PATH`.
+      [[Feature #15330]]
+
+* MatchData
+
+    * `MatchData#integer_at` is added.  It converts the matched substring to
+      integer and return the result.  [[Feature #21932]]
+
+* Regexp
+
+    * All instances of `Regexp` are now frozen, not just literals.
+      Subclasses of `Regexp` are not frozen for compatibility.
+      [[Feature #8948]]
+
+* Set
+
+    * A deprecated behavior, `Set#to_set`, `Range#to_set`, and
+      `Enumerable#to_set` accepting arguments, was removed.  [[Feature #21390]]
+
+## Stdlib updates
+
+### The following bundled gems are added.
+
+
+We only list stdlib changes that are notable feature changes.
+
+Other changes are listed in the following sections. We also listed release
+history from the previous bundled version that is Ruby 3.4.0 if it has GitHub
+releases.
+
+### The following bundled gems are promoted from default gems.
+
+* tsort 0.2.0
+* win32-registry 0.1.2
+
+### The following default gem is added.
+
+### The following default gems are updated.
+
+* RubyGems 4.1.0.dev
+  * 4.0.3 to [v4.0.4][RubyGems-v4.0.4], [v4.0.5][RubyGems-v4.0.5], [v4.0.6][RubyGems-v4.0.6], [v4.0.7][RubyGems-v4.0.7], [v4.0.8][RubyGems-v4.0.8], [v4.0.9][RubyGems-v4.0.9], [v4.0.10][RubyGems-v4.0.10], [v4.0.11][RubyGems-v4.0.11], [v4.0.12][RubyGems-v4.0.12]
+* bundler 4.1.0.dev
+  * 4.0.3 to [v4.0.4][bundler-v4.0.4], [v4.0.5][bundler-v4.0.5], [v4.0.6][bundler-v4.0.6], [v4.0.7][bundler-v4.0.7], [v4.0.8][bundler-v4.0.8], [v4.0.9][bundler-v4.0.9], [v4.0.10][bundler-v4.0.10], [v4.0.11][bundler-v4.0.11], [v4.0.12][bundler-v4.0.12]
+* erb 6.0.4
+  * 6.0.1 to [v6.0.1.1][erb-v6.0.1.1], [v6.0.2][erb-v6.0.2], [v6.0.3][erb-v6.0.3], [v6.0.4][erb-v6.0.4]
+* ipaddr 1.2.9
+  * 1.2.8 to [v1.2.9][ipaddr-v1.2.9]
+* json 2.19.7
+  * 2.18.0 to [v2.18.1][json-v2.18.1], [v2.19.0][json-v2.19.0], [v2.19.1][json-v2.19.1], [v2.19.2][json-v2.19.2], [v2.19.3][json-v2.19.3], [v2.19.4][json-v2.19.4], [v2.19.5][json-v2.19.5], [v2.19.6][json-v2.19.6], [v2.19.7][json-v2.19.7]
+* openssl 4.0.2
+  * 4.0.0 to [v4.0.1][openssl-v4.0.1], [v4.0.2][openssl-v4.0.2]
+* prism 1.9.0
+  * 1.7.0 to [v1.8.0][prism-v1.8.0], [v1.8.1][prism-v1.8.1], [v1.9.0][prism-v1.9.0]
+* psych 5.4.0
+* resolv 0.7.1
+  * 0.7.0 to [v0.7.1][resolv-v0.7.1]
+* stringio 3.2.1.dev
+* strscan 3.1.9.dev
+  * 3.1.6 to [v3.1.7][strscan-v3.1.7], [v3.1.8][strscan-v3.1.8]
+* syntax_suggest 3.0.0
+* timeout 0.6.1
+  * 0.6.0 to [v0.6.1][timeout-v0.6.1]
+* zlib 3.2.3
+  * 3.2.2 to [v3.2.3][zlib-v3.2.3]
+
+### The following bundled gems are updated.
+
+* minitest 6.0.6
+* rake 13.4.2
+  * 13.3.1 to [v13.4.0][rake-v13.4.0], [v13.4.1][rake-v13.4.1], [v13.4.2][rake-v13.4.2]
+* test-unit 3.7.7
+  * 3.7.5 to [3.7.6][test-unit-3.7.6], [3.7.7][test-unit-3.7.7]
+* net-imap 0.6.4
+  * 0.6.2 to [v0.6.3][net-imap-v0.6.3], [v0.6.4][net-imap-v0.6.4]
+* rbs 4.0.2
+  * 3.10.0 to [v3.10.1][rbs-v3.10.1], [v3.10.2][rbs-v3.10.2], [v3.10.3][rbs-v3.10.3], [v3.10.4][rbs-v3.10.4], [v4.0.0.dev.5][rbs-v4.0.0.dev.5], [v4.0.0][rbs-v4.0.0], [v4.0.2][rbs-v4.0.2]
+* typeprof 0.32.0
+* mutex_m 0.3.0
+* bigdecimal 4.1.2
+  * 4.0.1 to [v4.1.0][bigdecimal-v4.1.0], [v4.1.1][bigdecimal-v4.1.1], [v4.1.2][bigdecimal-v4.1.2]
+* resolv-replace 0.2.0
+  * 0.1.1 to [v0.2.0][resolv-replace-v0.2.0]
+* syslog 0.4.0
+  * 0.3.0 to [v0.4.0][syslog-v0.4.0]
+* repl_type_completor 0.1.15
+  * 0.1.12 to [v0.1.13][repl_type_completor-v0.1.13], [v0.1.14][repl_type_completor-v0.1.14], [v0.1.15][repl_type_completor-v0.1.15]
+* pstore 0.2.1
+  * 0.2.0 to [v0.2.1][pstore-v0.2.1]
+* rdoc 7.2.0
+  * 7.0.3 to [v7.0.4][rdoc-v7.0.4], [v7.1.0][rdoc-v7.1.0], [v7.2.0][rdoc-v7.2.0]
+* win32ole 1.9.3
+  * 1.9.2 to [v1.9.3][win32ole-v1.9.3]
+* irb 1.18.0
+  * 1.16.0 to [v1.17.0][irb-v1.17.0], [v1.18.0][irb-v1.18.0]
+
+### RubyGems and Bundler
+
+Ruby 4.0 bundled RubyGems and Bundler version 4. see the following links for details.
+
+## Supported platforms
+
+## Compatibility issues
+
+## Stdlib compatibility issues
+
+## C API updates
+
+### Embedded TypedData
+
+* The `RUBY_TYPED_EMBEDDABLE` flag is now public and documented and can be used by C extensions.
+  It allows allocating C structs directly into Ruby object slots, which reduces pointer chasing,
+  and in some case memory usage.
+  See the C extension documentation for details. [[Feature #21853]]
+
+* Added new C23 inspired allocator functions, that takes the previous memory size.
+  This allow the Ruby GC to better keep track of memory usage, improving its heuristics.
+  It also improves the performance of system allocators that support C23 `free_sized`.
+
+  However, it is important to note that passing an incorrect size to these function is undefined
+  behavior and may result in crashes or memory leaks.
+
+  - `ruby_xfree_sized(void *ptr, size_t size)`
+  - `ruby_xrealloc_sized(void *ptr, size_t newsiz, size_t oldsiz)`
+  - `ruby_xrealloc2_sized(void *ptr, size_t newelems, size_t newsiz, size_t oldelems)`
+
+  [[Feature #21861]]
+
+### Removed APIs
+
+The following APIs, which have been deprecated for many years, are removed.
+[[Feature #21768]]
+
+* old postponed job functions,
+* untyped data object type/functions,
+* old APIs to allocate a data object,
+* taintedness/trustedness enums/macros,
+* `rb_gc_force_recycle` function,
+* `rb_iterate` function,
+* and some functions and constants for internal use.
+
+## Implementation improvements
+
+### Ractor
+
+A lot of work has gone into making Ractors more stable, performant, and usable. These improvements bring Ractor implementation closer to leaving experimental status.
+
+## JIT
+
+[Feature #8948]: https://bugs.ruby-lang.org/issues/8948
+[Feature #15330]: https://bugs.ruby-lang.org/issues/15330
+[Feature #21390]: https://bugs.ruby-lang.org/issues/21390
+[Feature #21768]: https://bugs.ruby-lang.org/issues/21768
+[Feature #21785]: https://bugs.ruby-lang.org/issues/21785
+[Feature #21796]: https://bugs.ruby-lang.org/issues/21796
+[Feature #21853]: https://bugs.ruby-lang.org/issues/21853
+[Feature #21861]: https://bugs.ruby-lang.org/issues/21861
+[Feature #21932]: https://bugs.ruby-lang.org/issues/21932
+[Feature #21981]: https://bugs.ruby-lang.org/issues/21981
+[RubyGems-v4.0.4]: https://github.com/rubygems/rubygems/releases/tag/v4.0.4
+[RubyGems-v4.0.5]: https://github.com/rubygems/rubygems/releases/tag/v4.0.5
+[RubyGems-v4.0.6]: https://github.com/rubygems/rubygems/releases/tag/v4.0.6
+[RubyGems-v4.0.7]: https://github.com/rubygems/rubygems/releases/tag/v4.0.7
+[RubyGems-v4.0.8]: https://github.com/rubygems/rubygems/releases/tag/v4.0.8
+[RubyGems-v4.0.9]: https://github.com/rubygems/rubygems/releases/tag/v4.0.9
+[RubyGems-v4.0.10]: https://github.com/rubygems/rubygems/releases/tag/v4.0.10
+[RubyGems-v4.0.11]: https://github.com/rubygems/rubygems/releases/tag/v4.0.11
+[RubyGems-v4.0.12]: https://github.com/rubygems/rubygems/releases/tag/v4.0.12
+[bundler-v4.0.4]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.4
+[bundler-v4.0.5]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.5
+[bundler-v4.0.6]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.6
+[bundler-v4.0.7]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.7
+[bundler-v4.0.8]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.8
+[bundler-v4.0.9]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.9
+[bundler-v4.0.10]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.10
+[bundler-v4.0.11]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.11
+[bundler-v4.0.12]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.12
+[erb-v6.0.1.1]: https://github.com/ruby/erb/releases/tag/v6.0.1.1
+[erb-v6.0.2]: https://github.com/ruby/erb/releases/tag/v6.0.2
+[erb-v6.0.3]: https://github.com/ruby/erb/releases/tag/v6.0.3
+[erb-v6.0.4]: https://github.com/ruby/erb/releases/tag/v6.0.4
+[ipaddr-v1.2.9]: https://github.com/ruby/ipaddr/releases/tag/v1.2.9
+[json-v2.18.1]: https://github.com/ruby/json/releases/tag/v2.18.1
+[json-v2.19.0]: https://github.com/ruby/json/releases/tag/v2.19.0
+[json-v2.19.1]: https://github.com/ruby/json/releases/tag/v2.19.1
+[json-v2.19.2]: https://github.com/ruby/json/releases/tag/v2.19.2
+[json-v2.19.3]: https://github.com/ruby/json/releases/tag/v2.19.3
+[json-v2.19.4]: https://github.com/ruby/json/releases/tag/v2.19.4
+[json-v2.19.5]: https://github.com/ruby/json/releases/tag/v2.19.5
+[json-v2.19.6]: https://github.com/ruby/json/releases/tag/v2.19.6
+[json-v2.19.7]: https://github.com/ruby/json/releases/tag/v2.19.7
+[openssl-v4.0.1]: https://github.com/ruby/openssl/releases/tag/v4.0.1
+[openssl-v4.0.2]: https://github.com/ruby/openssl/releases/tag/v4.0.2
+[prism-v1.8.0]: https://github.com/ruby/prism/releases/tag/v1.8.0
+[prism-v1.8.1]: https://github.com/ruby/prism/releases/tag/v1.8.1
+[prism-v1.9.0]: https://github.com/ruby/prism/releases/tag/v1.9.0
+[resolv-v0.7.1]: https://github.com/ruby/resolv/releases/tag/v0.7.1
+[strscan-v3.1.7]: https://github.com/ruby/strscan/releases/tag/v3.1.7
+[strscan-v3.1.8]: https://github.com/ruby/strscan/releases/tag/v3.1.8
+[timeout-v0.6.1]: https://github.com/ruby/timeout/releases/tag/v0.6.1
+[zlib-v3.2.3]: https://github.com/ruby/zlib/releases/tag/v3.2.3
+[rake-v13.4.0]: https://github.com/ruby/rake/releases/tag/v13.4.0
+[rake-v13.4.1]: https://github.com/ruby/rake/releases/tag/v13.4.1
+[rake-v13.4.2]: https://github.com/ruby/rake/releases/tag/v13.4.2
+[test-unit-3.7.6]: https://github.com/test-unit/test-unit/releases/tag/3.7.6
+[test-unit-3.7.7]: https://github.com/test-unit/test-unit/releases/tag/3.7.7
+[net-imap-v0.6.3]: https://github.com/ruby/net-imap/releases/tag/v0.6.3
+[net-imap-v0.6.4]: https://github.com/ruby/net-imap/releases/tag/v0.6.4
+[rbs-v3.10.1]: https://github.com/ruby/rbs/releases/tag/v3.10.1
+[rbs-v3.10.2]: https://github.com/ruby/rbs/releases/tag/v3.10.2
+[rbs-v3.10.3]: https://github.com/ruby/rbs/releases/tag/v3.10.3
+[rbs-v3.10.4]: https://github.com/ruby/rbs/releases/tag/v3.10.4
+[rbs-v4.0.0.dev.5]: https://github.com/ruby/rbs/releases/tag/v4.0.0.dev.5
+[rbs-v4.0.0]: https://github.com/ruby/rbs/releases/tag/v4.0.0
+[rbs-v4.0.2]: https://github.com/ruby/rbs/releases/tag/v4.0.2
+[bigdecimal-v4.1.0]: https://github.com/ruby/bigdecimal/releases/tag/v4.1.0
+[bigdecimal-v4.1.1]: https://github.com/ruby/bigdecimal/releases/tag/v4.1.1
+[bigdecimal-v4.1.2]: https://github.com/ruby/bigdecimal/releases/tag/v4.1.2
+[resolv-replace-v0.2.0]: https://github.com/ruby/resolv-replace/releases/tag/v0.2.0
+[syslog-v0.4.0]: https://github.com/ruby/syslog/releases/tag/v0.4.0
+[repl_type_completor-v0.1.13]: https://github.com/ruby/repl_type_completor/releases/tag/v0.1.13
+[repl_type_completor-v0.1.14]: https://github.com/ruby/repl_type_completor/releases/tag/v0.1.14
+[repl_type_completor-v0.1.15]: https://github.com/ruby/repl_type_completor/releases/tag/v0.1.15
+[pstore-v0.2.1]: https://github.com/ruby/pstore/releases/tag/v0.2.1
+[rdoc-v7.0.4]: https://github.com/ruby/rdoc/releases/tag/v7.0.4
+[rdoc-v7.1.0]: https://github.com/ruby/rdoc/releases/tag/v7.1.0
+[rdoc-v7.2.0]: https://github.com/ruby/rdoc/releases/tag/v7.2.0
+[win32ole-v1.9.3]: https://github.com/ruby/win32ole/releases/tag/v1.9.3
+[irb-v1.17.0]: https://github.com/ruby/irb/releases/tag/v1.17.0
+[irb-v1.18.0]: https://github.com/ruby/irb/releases/tag/v1.18.0
diff --git a/README b/README
deleted file mode 100644
index bde22dff78..0000000000
--- a/README
+++ /dev/null
@@ -1,106 +0,0 @@
-* What's Ruby
-
-Ruby is the interpreted scripting language for quick and
-easy object-oriented programming.  It has many features to
-process text files and to do system management tasks (as in
-Perl).  It is simple, straight-forward, and extensible.
-
-
-* Features of Ruby
-
-  + Simple Syntax
-  + *Normal* Object-Oriented features(ex. class, method calls)
-  + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
-  + Operator Overloading
-  + Exception Handling
-  + Iterators and Closures
-  + Garbage Collection
-  + Dynamic Loading of Object files(on some architecture)
-  + Highly Portable(works on many UNIX machines, and on DOS,
-    Windows, Mac, BeOS etc.)
-
-
-* How to get Ruby
-
-The Ruby distribution can be found on:
-
-  ftp://ftp.ruby-lang.org/pub/ruby/
-
-You can get it by anonymous CVS.  How to check out is:
-
-  $ cvs -d :pserver:anonymous@cvs.ruby-lang.org:/src login
-  (Logging in to anonymous@cvs.ruby-lang.org)
-  CVS password: anonymous
-  $ cvs -z4 -d :pserver:anonymous@cvs.ruby-lang.org:/src checkout ruby
-
-
-* Ruby home-page
-
-The URL of the Ruby home-page is:
-
-   http://www.ruby-lang.org/
-
-
-* Mailing list
-
-There is a mailing list to talk about Ruby.
-To subscribe this list, please send the following phrase
-
-	subscribe YourFirstName YourFamilyName
-e.g.
-        subscribe Joseph Smith
-
-in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
-
-
-* How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-  1. If ./configure does not exist or is older than configure.in,
-     run autoconf to (re)generate configure.
-
-  2. Run ./configure, which will generate config.h and Makefile.
-
-  3. Edit defines.h if you need.  Probably this step will not need.
-
-  4. Remove comment mark(#) before the module names from ext/Setup (or
-     add module names if not present), if you want to link modules
-     statically.
-
-     If you don't want to compile non static extension modules
-     (probably on architectures which does not allow dynamic loading),
-     remove comment mark from the line "#option nodynamic" in
-     ext/Setup.
-
-  5. Run make.
-
-  6. Optionally, run 'make test' to check whether the compiled Ruby
-     interpreter works well.  If you see the message "test succeeded",
-     your ruby works as it should (hopefully).
-
-  7. Run 'make install'
-
-     You may have to be a super user to install ruby.
-
-If you fail to compile ruby, please send the detailed error report with
-the error log and machine/OS type, to help others.
-
-
-* Copying
-
-See the file COPYING.
-
-
-* The Author
-
-Feel free to send comments and bug reports to the author.  Here is the 
-author's latest mail address:
-
-  matz@netlab.jp
-
--------------------------------------------------------
-created at: Thu Aug  3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.EXT b/README.EXT
deleted file mode 100644
index e5c4203832..0000000000
--- a/README.EXT
+++ /dev/null
@@ -1,1051 +0,0 @@
-.\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
-
-This document explains how to make extension libraries for Ruby.
-
-1. Basic knowledge
-
-In C, variables have types and data do not have types.  In contrast,
-Ruby variables do not have a static type, and data themselves have
-types, so data will need to be converted between the languages.
-
-Data in Ruby are represented by C type `VALUE'.  Each VALUE data has
-its data-type.
-
-To retrieve C data from a VALUE, you need to:
-
- (1) Identify the VALUE's data type
- (2) Convert the VALUE into C data
-
-Converting to the wrong data type may cause serious problems.
-
-
-1.1 Data-types
-
-The Ruby interpreter has the following data types:
-
-	T_NIL		nil
-	T_OBJECT	ordinary object
-	T_CLASS		class
-	T_MODULE	module
-	T_FLOAT		floating point number
-	T_STRING	string
-	T_REGEXP	regular expression
-	T_ARRAY		array
-	T_FIXNUM	Fixnum(31bit integer)
-	T_HASH		associative array
-	T_STRUCT	(Ruby) structure
-	T_BIGNUM	multi precision integer
-	T_FILE		IO
-	T_TRUE		true
-	T_FALSE		false
-	T_DATA		data
-	T_SYMBOL        symbol
-
-In addition, there are several other types used internally:
-
-	T_ICLASS
-	T_MATCH
-	T_UNDEF
-	T_VARMAP
-	T_SCOPE
-	T_NODE
-
-Most of the types are represented by C structures.
-
-1.2 Check Data Type of the VALUE
-
-The macro TYPE() defined in ruby.h shows the data type of the VALUE.
-TYPE() returns the constant number T_XXXX described above.  To handle
-data types, your code will look something like this:
-
-  switch (TYPE(obj)) {
-    case T_FIXNUM:
-      /* process Fixnum */
-      break;
-    case T_STRING:
-      /* process String */
-      break;
-    case T_ARRAY:
-      /* process Array */
-      break;
-    default:
-      /* raise exception */
-      rb_raise(rb_eTypeError, "not valid value");
-      break;
-  }
-
-There is the data-type check function
-
-  void Check_Type(VALUE value, int type)
-
-which raises an exception if the VALUE does not have the type specified.
-
-There are also faster check macros for fixnums and nil.
-
-  FIXNUM_P(obj)
-  NIL_P(obj)
-
-1.3 Convert VALUE into C data
-
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
-respectively.  They are singletons for the data type.
-
-The T_FIXNUM data is a 31bit length fixed integer (63bit length on
-some machines), which can be convert to a C integer by using the
-FIX2INT() macro.  There is also NUM2INT() which converts any Ruby
-numbers into C integers.  The NUM2INT() macro includes a type check, so
-an exception will be raised if the conversion failed.  NUM2DBL() can
-be used to retrieve the double float value in same way.
-
-To get char* from a VALUE, version 1.7 recommend to use new macros
-StringValue() and StringValuePtr().  StringValue(var) replaces var's
-value to the result of "var.to_str()".  StringValuePtr(var) does same
-replacement and returns char* representation of var.  These macros
-will skip the replacement if var is a String.  Notice that the macros
-requires to take only lvalue as their argument, to change the value
-of var in the replacement. 
-
-In version 1.6 or earlier, STR2CSTR() was used to do same thing
-but now it is obsoleted in version 1.7 because of STR2CSTR() has
-a risk of dangling pointer problem in to_str() impliclit conversion.
-
-Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has corresponding structure
-can be cast to retrieve the pointer to the struct.  The casting macro
-will be of the form RXXXX for each data type; for instance, RARRAY(obj). 
-See "ruby.h".
-
-For example, `RSTRING(str)->len' is the way to get the size of the
-Ruby String object.  The allocated region can be accessed by
-`RSTRING(str)->ptr'.  For arrays, use `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
-
-Notice: Do not change the value of the structure directly, unless you
-are responsible for the result.  This ends up being the cause of interesting
-bugs.
-
-1.4 Convert C data into VALUE
-
-To convert C data to Ruby values:
-
-  * FIXNUM
-
-    left shift 1 bit, and turn on LSB.
-
-  * Other pointer values
-
-    cast to VALUE.
-
-You can determine whether a VALUE is pointer or not by checking its LSB.  
-
-Notice Ruby does not allow arbitrary pointer values to be a VALUE.  They
-should be pointers to the structures which Ruby knows about.  The known
-structures are defined in <ruby.h>.
-
-To convert C numbers to Ruby values, use these macros.
-
-  INT2FIX()	for integers within 31bits.
-  INT2NUM()	for arbitrary sized integer.
-
-INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
-range, but is a bit slower.
-
-1.5 Manipulating Ruby data
-
-As I already mentioned, it is not recommended to modify an object's internal
-structure.  To manipulate objects, use the functions supplied by the Ruby
-interpreter. Some (not all) of the useful functions are listed below:
-
- String functions
-
-  rb_str_new(const char *ptr, long len)
-
-    Creates a new Ruby string.
-
-  rb_str_new2(const char *ptr)
-
-    Creates a new Ruby string from a C string.  This is equivalent to
-    rb_str_new(ptr, strlen(ptr)).
-
-  rb_tainted_str_new(const char *ptr, long len)
-
-    Creates a new tainted Ruby string.  Strings from external data
-    sources should be tainted.
-
-  rb_tainted_str_new2(const char *ptr)
-
-    Creates a new tainted Ruby string from a C string.
-
-  rb_str_cat(VALUE str, const char *ptr, long len)
-
-    Appends len bytes of data from ptr to the Ruby string.
-
- Array functions
-
-  rb_ary_new()
-
-    Creates an array with no elements.
-
-  rb_ary_new2(long len)
-
-    Creates an array with no elements, allocating internal buffer
-    for len elements.
-
-  rb_ary_new3(long n, ...)
-
-    Creates an n-element array from the arguments.
-
-  rb_ary_new4(long n, VALUE *elts)
-
-    Creates an n-element array from a C array.
-
-  rb_ary_push(VALUE ary, VALUE val)
-  rb_ary_pop(VALUE ary)
-  rb_ary_shift(VALUE ary)
-  rb_ary_unshift(VALUE ary, VALUE val)
-
-    Array operations.  The first argument to each functions must be an 
-    array.  They may dump core if other types given.
-
-2. Extending Ruby with C
-
-2.1 Addding new features to Ruby
-
-You can add new features (classes, methods, etc.) to the Ruby
-interpreter.  Ruby provides APIs for defining the following things:
-
- * Classes, Modules
- * Methods, Singleton Methods
- * Constants
-
-2.1.1 Class/module definition
-
-To define a class or module, use the functions below:
-
-  VALUE rb_define_class(const char *name, VALUE super)
-  VALUE rb_define_module(const char *name)
-
-These functions return the newly created class or module.  You may
-want to save this reference into a variable to use later.
-
-To define nested classes or modules, use the functions below:
-
-  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
-  VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 Method/singleton method definition
-
-To define methods or singleton methods, use these functions:
-
-  void rb_define_method(VALUE klass, const char *name, 
-		        VALUE (*func)(), int argc)
-
-  void rb_define_singleton_method(VALUE object, const char *name, 
-			          VALUE (*func)(), int argc)
-
-The `argc' represents the number of the arguments to the C function,
-which must be less than 17.  But I believe you don't need that much. :-)
-
-If `argc' is negative, it specifies the calling sequence, not number of
-the arguments.  
-
-If argc is -1, the function will be called as:
-
-  VALUE func(int argc, VALUE *argv, VALUE obj)
-
-where argc is the actual number of arguments, argv is the C array of
-the arguments, and obj is the receiver.
-
-If argc is -2, the arguments are passed in a Ruby array. The function
-will be called like:
-
-  VALUE func(VALUE obj, VALUE args)
-
-where obj is the receiver, and args is the Ruby array containing
-actual arguments.
-
-There are two more functions to define methods.  One is to define
-private methods:
-
-  void rb_define_private_method(VALUE klass, const char *name, 
-			        VALUE (*func)(), int argc)
-
-The other is to define module functions, which are private AND singleton
-methods of the module.  For example, sqrt is the module function
-defined in Math module.  It can be call in the form like:
-
-  Math.sqrt(4)
-
-or
-
-  include Math
-  sqrt(4)
-
-To define module functions, use:
-
-  void rb_define_module_function(VALUE module, const char *name, 
-				 VALUE (*func)(), int argc)
-
-Oh, in addition, function-like methods, which are private methods defined
-in the Kernel module, can be defined using:
-
-  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-To define alias to the method,
-
-  void rb_define_alias(VALUE module, const char* new, const char* old);
-
-2.1.3 Constant definition
-
-We have 2 functions to define constants:
-
-  void rb_define_const(VALUE klass, const char *name, VALUE val)
-  void rb_define_global_const(const char *name, VALUE val)
-
-The former is to define a constant under specified class/module.  The
-latter is to define a global constant.
-
-2.2 Use Ruby features from C
-
-There are several ways to invoke Ruby's features from C code.
-
-2.2.1 Evaluate Ruby Programs in a String
-
-The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program.  This function will do the job.
-
-  VALUE rb_eval_string(const char *str)
-
-Evaluation is done under the current context, thus current local variables
-of the innermost method (which is defined by Ruby) can be accessed.
-
-2.2.2 ID or Symbol
-
-You can invoke methods directly, without parsing the string.  First I
-need to explain about symbols (whose data type is ID).  ID is the
-integer number to represent Ruby's identifiers such as variable names.
-It can be accessed from Ruby in the form:
-
- :Identifier
-
-You can get the symbol value from a string within C code by using
-
-  rb_intern(const char *name)
-
-2.2.3 Invoke Ruby method from C
-
-To invoke methods directly, you can use the function below
-
-  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-This function invokes a method on the recv, with the method name
-specified by the symbol mid.
-
-2.2.4 Accessing the variables and constants
-
-You can access class variables and instance variables using access
-functions.  Also, global variables can be shared between both environments.
-There's no way to access Ruby's local variables.
-
-The functions to access/modify instance variables are below:
-
-  VALUE rb_ivar_get(VALUE obj, ID id)
-  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id must be the symbol, which can be retrieved by rb_intern().
-
-To access the constants of the class/module:
-
-  VALUE rb_const_get(VALUE obj, ID id)
-
-See 2.1.3 for defining new constant.
-
-3. Information sharing between Ruby and C
-
-3.1 Ruby constants that C can be accessed from C
-
-The following Ruby constants can be referred from C.
-
-  Qtrue
-  Qfalse
-
-Boolean values.  Qfalse is false in C also (i.e. 0).
-
-  Qnil
-
-Ruby nil in C scope.
-
-3.2 Global variables shared between C and Ruby
-
-Information can be shared between the two environments using shared global
-variables.  To define them, you can use functions listed below:
-
-  void rb_define_variable(const char *name, VALUE *var)
-
-This function defines the variable which is shared by both environments.
-The value of the global variable pointed to by `var' can be accessed
-through Ruby's global variable named `name'.
-
-You can define read-only (from Ruby, of course) variables using the
-function below.
-
-  void rb_define_readonly_variable(const char *name, VALUE *var)
-
-You can defined hooked variables.  The accessor functions (getter and
-setter) are called on access to the hooked variables.
-
-  void rb_define_hooked_variable(constchar *name, VALUE *var,
-				 VALUE (*getter)(), void (*setter)())
-
-If you need to supply either setter or getter, just supply 0 for the
-hook you don't need.  If both hooks are 0, rb_define_hooked_variable()
-works just like rb_define_variable().
-
-  void rb_define_virtual_variable(const char *name,
-				  VALUE (*getter)(), void (*setter)())
-
-This function defines a Ruby global variable without a corresponding C
-variable.  The value of the variable will be set/get only by hooks.
-
-The prototypes of the getter and setter functions are as follows:
-
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 Encapsulate C data into Ruby object
-
-To wrap and objectify a C pointer as a Ruby object (so called
-DATA), use Data_Wrap_Struct().
-
-  Data_Wrap_Struct(klass, mark, free, ptr)
-
-Data_Wrap_Struct() returns a created DATA object.  The klass argument
-is the class for the DATA object.  The mark argument is the function
-to mark Ruby objects pointed by this data.  The free argument is the
-function to free the pointer allocation.  If this is -1, the pointer
-will be just freed.  The functions mark and free will be called from
-garbage collector.
-
-You can allocate and wrap the structure in one step.
-
-  Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro returns an allocated Data object, wrapping the pointer to
-the structure, which is also allocated.  This macro works like:
-
-  (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-
-Arguments klass, mark, and free work like their counterparts in
-Data_Wrap_Struct().  A pointer to the allocated structure will be
-assigned to sval, which should be a pointer of the type specified.
-
-To retrieve the C pointer from the Data object, use the macro
-Data_Get_Struct().
-
-  Data_Get_Struct(obj, type, sval)
-
-A pointer to the structure will be assigned to the variable sval.
-
-See the example below for details. 
-
-4. Example - Creating dbm extension
-
-OK, here's the example of making an extension library.  This is the
-extension to access DBMs.  The full source is included in the ext/
-directory in the Ruby's source tree.
-
-(1) make the directory
-
-  % mkdir ext/dbm
-
-Make a directory for the extension library under ext directory.
-
-(2) design the library
-
-You need to design the library features, before making it.
-
-(3) write C code.
-
-You need to write C code for your extension library.  If your library
-has only one source file, choosing ``LIBRARY.c'' as a file name is
-preferred.  On the other hand, in case your library has multiple source
-files, avoid choosing ``LIBRARY.c'' for a file name.  It may conflict
-with an intermediate file ``LIBRARY.o'' on some platforms.
-
-Ruby will execute the initializing function named ``Init_LIBRARY'' in
-the library.  For example, ``Init_dbm()'' will be executed when loading
-the library.
-
-Here's the example of an initializing function.
-
---
-Init_dbm()
-{
-    /* define DBM class */
-    cDBM = rb_define_class("DBM", rb_cObject);
-    /* DBM includes Enumerate module */
-    rb_include_module(cDBM, rb_mEnumerable);
-
-    /* DBM has class method open(): arguments are received as C array */
-    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
-    /* DBM instance method close(): no args */
-    rb_define_method(cDBM, "close", fdbm_close, 0);
-    /* DBM instance method []: 1 argument */
-    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-		:
-
-    /* ID for a instance variable to store DBM data */
-    id_dbm = rb_intern("dbm");
-}
---
-
-The dbm extension wraps the dbm struct in the C environment using 
-Data_Make_Struct.
-
---
-struct dbmdata {
-    int  di_size;
-    DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-This code wraps the dbmdata structure into a Ruby object.  We avoid wrapping
-DBM* directly, because we want to cache size information.
-
-To retrieve the dbmdata structure from a Ruby object, we define the
-following macro:
-
---
-#define GetDBM(obj, dbmp) {\
-    Data_Get_Struct(obj, struct dbmdata, dbmp);\
-    if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-This sort of complicated macro does the retrieving and close checking for
-the DBM.
-
-There are three kinds of way to receive method arguments.  First,
-methods with a fixed number of arguments receive arguments like this:
-
---
-static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
-{
-	:
-}
---
-
-The first argument of the C function is the self, the rest are the
-arguments to the method.
-
-Second, methods with an arbitrary number of arguments receive
-arguments like this:
-
---
-static VALUE
-fdbm_s_open(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
-{
-	:
-    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
-	mode = 0666;		/* default value */
-    }
-	:
-}
---
-
-The first argument is the number of method arguments, the second
-argument is the C array of the method arguments, and the third
-argument is the receiver of the method.
-
-You can use the function rb_scan_args() to check and retrieve the
-arguments.  For example, "11" means that the method requires at least one
-argument, and at most receives two arguments.
-
-Methods with an arbitrary number of arguments can receive arguments
-by Ruby's array, like this:
-
---
-static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
-{
-	:
-}
---
-
-The first argument is the receiver, the second one is the Ruby array
-which contains the arguments to the method.
-
-** Notice
-
-GC should know about global variables which refer to Ruby's objects, but
-are not exported to the Ruby world.  You need to protect them by
-
-  void rb_global_variable(VALUE *var)
-
-(4) prepare extconf.rb
-
-If the file named extconf.rb exists, it will be executed to generate
-Makefile.
-
-extconf.rb is the file for check compilation conditions etc.  You
-need to put
-
-  require 'mkmf'
-
-at the top of the file.  You can use the functions below to check
-various conditions.
-
-  have_library(lib, func): check whether library containing function exists.
-  have_func(func, header): check whether function exists
-  have_header(header): check whether header file exists
-  create_makefile(target): generate Makefile
-
-The value of the variables below will affect the Makefile.
-
-  $CFLAGS: included in CFLAGS make variable (such as -I)
-  $LDFLAGS: included in LDFLAGS make variable (such as -L)
-
-If a compilation condition is not fulfilled, you should not call
-``create_makefile''.  The Makefile will not generated, compilation will
-not be done.
-
-(5) prepare depend (optional)
-
-If the file named depend exists, Makefile will include that file to
-check dependencies.  You can make this file by invoking
-
-  % gcc -MM *.c > depend
-
-It's no harm.  Prepare it.
-
-(6) generate Makefile
-
-Try generating the Makefile by:
-
-  ruby extconf.rb
-
-You don't need this step if you put the extension library under the ext
-directory of the ruby source tree.  In that case, compilation of the
-interpreter will do this step for you.
-
-(7) make
-
-Type
-
-  make
-
-to compile your extension.  You don't need this step either if you have
-put extension library under the ext directory of the ruby source tree.
-
-(8) debug
-
-You may need to rb_debug the extension.  Extensions can be linked
-statically by the adding directory name in the ext/Setup file so that
-you can inspect the extension with the debugger.
-
-(9) done, now you have the extension library
-
-You can do anything you want with your library.  The author of Ruby
-will not claim any restrictions on your code depending on the Ruby API.
-Feel free to use, modify, distribute or sell your program.
-
-Appendix A. Ruby source files overview
-
-ruby language core
-
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
-  parse.y
-  variable.c
-
-utility functions
-
-  dln.c
-  regex.c
-  st.c
-  util.c
-
-ruby interpreter implementation
-
-  dmyext.c
-  inits.c
-  main.c
-  ruby.c
-  version.c
-
-class library
-
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  prec.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
-
-Appendix B. Ruby extension API reference
-
-** Types
-
- VALUE
-
-The type for the Ruby object.  Actual structures are defined in ruby.h,
-such as struct RString, etc.  To refer the values in structures, use
-casting macros like RSTRING(obj).
-
-** Variables and constants
-
- Qnil
-
-const: nil object
-
- Qtrue
-
-const: true object(default true value)
-
- Qfalse
-
-const: false object
-
-** C pointer wrapping
-
- Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
-Wrap a C pointer into a Ruby object.  If object has references to other
-Ruby objects, they should be marked by using the mark function during
-the GC process.  Otherwise, mark should be 0.  When this object is no
-longer referred by anywhere, the pointer will be discarded by free
-function.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro allocates memory using malloc(), assigns it to the variable
-sval, and returns the DATA encapsulating the pointer to memory region.
-
- Data_Get_Struct(data, type, sval)
-
-This macro retrieves the pointer value from DATA, and assigns it to
-the variable sval. 
-
-** Checking data types
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** Data type conversion
-
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
-NUM2DBL(value)
-rb_float_new(f)
-STR2CSTR(value)
-rb_str_new2(s)
-
-** defining class/module
-
- VALUE rb_define_class(const char *name, VALUE super)
-
-Defines a new Ruby class as a subclass of super.
-
- VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
-Creates a new Ruby class as a subclass of super, under the module's
-namespace.
-
- VALUE rb_define_module(const char *name)
-
-Defines a new Ruby module.
-
- VALUE rb_define_module_under(VALUE module, const char *name)
-
-Defines a new Ruby module under the module's namespace.
-
- void rb_include_module(VALUE klass, VALUE module)
-
-Includes module into class.  If class already includes it, just
-ignored.
-
- void rb_extend_object(VALUE object, VALUE module)
-
-Extend the object with the module's attributes.
-
-** Defining Global Variables
-
- void rb_define_variable(const char *name, VALUE *var)
-
-Defines a global variable which is shared between C and Ruby.  If name
-contains a character which is not allowed to be part of the symbol,
-it can't be seen from Ruby programs.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-Defines a read-only global variable.  Works just like
-rb_define_variable(), except defined variable is read-only.
-
- void rb_define_virtual_variable(const char *name,
-				 VALUE (*getter)(), VALUE (*setter)())
-
-Defines a virtual variable, whose behavior is defined by a pair of C
-functions.  The getter function is called when the variable is
-referred.  The setter function is called when the value is set to the
-variable.  The prototype for getter/setter functions are:
-
-	VALUE getter(ID id)
-	void setter(VALUE val, ID id)
-
-The getter function must return the value for the access.
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
-				VALUE (*getter)(), VALUE (*setter)())
-
-Defines hooked variable.  It's a virtual variable with a C variable.  
-The getter is called as
-
-	VALUE getter(ID id, VALUE *var)
-
-returning a new value.  The setter is called as
-
-	void setter(VALUE val, ID id, VALUE *var)
-
-GC requires C global variables which hold Ruby values to be marked.
-
- void rb_global_variable(VALUE *var)
-
-Tells GC to protect these variables.
-
-** Constant Definition
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
-
-Defines a new constant under the class/module.
-
- void rb_define_global_const(const char *name, VALUE val)
-
-Defines a global constant.  This is just the same as
-
-     rb_define_const(cKernal, name, val)
-
-** Method Definition
-
- rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a method for the class.  func is the function pointer.  argc
-is the number of arguments.  if argc is -1, the function will receive
-3 arguments: argc, argv, and self.  if argc is -2, the function will
-receive 2 arguments, self and args, where args is a Ruby array of
-the method arguments.
-
- rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a private method for the class.  Arguments are same as
-rb_define_method().
-
- rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a singleton method.  Arguments are same as rb_define_method().
-
- rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
-Retrieve argument from argc, argv.  The fmt is the format string for
-the arguments, such as "12" for 1 non-optional argument, 2 optional
-arguments.  If `*' appears at the end of fmt, it means the rest of
-the arguments are assigned to the corresponding variable, packed in
-an array.
-
-** Invoking Ruby method
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-Invokes a method.  To retrieve mid from a method name, use rb_intern().
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-Invokes a method, passing arguments by an array of values.
-
- VALUE rb_eval_string(const char *str)
-
-Compiles and executes the string as a Ruby program.
-
- ID rb_intern(const char *name)
-
-Returns ID corresponding to the name.
-
- char *rb_id2name(ID id)
-
-Returns the name corresponding ID.
-
- char *rb_class2name(VALUE klass)
-
-Returns the name of the class.
-
- int rb_respond_to(VALUE object, ID id)
-
-Returns true if the object responds to the message specified by id.
-
-** Instance Variables
-
- VALUE rb_iv_get(VALUE obj, const char *name)
-
-Retrieve the value of the instance variable.  If the name is not
-prefixed by `@', that variable shall be inaccessible from Ruby.
-
- VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
-Sets the value of the instance variable.
-
-** Control Structure
-
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, supplying func2 as the block.  func1 will be
-called with the argument arg1.  func2 receives the value from yield as
-the first argument, arg2 as the second argument.
- 
- VALUE rb_yield(VALUE val)
-
-Evaluates the block with value val.
-
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, with arg1 as the argument.  If an exception
-occurs during func1, it calls func2 with arg2 as the argument.  The
-return value of rb_rescue() is the return value from func1 if no
-exception occurs, from func2 otherwise.
-
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
-
-Calls the function func1 with arg1 as the argument, then calls func2
-with arg2 if execution terminated.  The return value from
-rb_ensure() is that of func1.
-
-** Exceptions and Errors
-
- void rb_warn(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format.
-
- void rb_warning(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format, if
-$VERBOSE is true.
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
-Raises RuntimeError.  The fmt is a format string just like printf().
-
- void rb_raise(VALUE exception, const char *fmt, ...)
-
-Raises a class exception.  The fmt is a format string just like printf().
-
- void rb_fatal(const char *fmt, ...)
-
-Raises a fatal error, terminates the interpreter.  No exception handling
-will be done for fatal errors, but ensure blocks will be executed.
-
- void rb_bug(const char *fmt, ...)
-
-Terminates the interpreter immediately.  This function should be
-called under the situation caused by the bug in the interpreter.  No
-exception handling nor ensure execution will be done.
-
-** Initialize and Starts the Interpreter
-
-The embedding API functions are below (not needed for extension libraries):
-
- void ruby_init()
-
-Initializes the interpreter.
-
- void ruby_options(int argc, char **argv)
-
-Process command line arguments for the interpreter.
-
- void ruby_run()
-
-Starts execution of the interpreter.
-
- void ruby_script(char *name)
-
-Specifies the name of the script ($0).
-
-Appendix C. Functions Available in extconf.rb
-
-These functions are available in extconf.rb:
-
- have_library(lib, func)
-
-Checks whether the library exists, containing the specified function.
-Returns true if the library exists.
-
- find_library(lib, func, path...)
-
-Checks whether a library which contains the specified function exists in
-path.  Returns true if the library exists.
-
- have_func(func, header)
-
-Checks whether func exists with header.  Returns true if the function
-exists.  To check functions in an additional library, you need to
-check that library first using have_library().
-
- have_header(header)
-
-Checks whether header exists.  Returns true if the header file exists.
-
- create_makefile(target)
-
-Generates the Makefile for the extension library.  If you don't invoke
-this method, the compilation will not be done.
-
- with_config(withval[, default=nil])
-
-Parses the command line options and returns the value specified by
---with-<withval>.
-
- dir_config(target[, default_dir])
- dir_config(target[, default_include, default_lib])
-
-Parses the command line options and adds the directories specified by
---with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
-to $CFLAGS and/or $LDFLAGS.  --with-<target>-dir=/path is equivalent to
---with-<target>-include=/path/include --with-<target>-lib=/path/lib.
-Returns an array of the added directories ([include_dir, lib_dir]).
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
diff --git a/README.EXT.ja b/README.EXT.ja
deleted file mode 100644
index 7a4cb5df2a..0000000000
--- a/README.EXT.ja
+++ /dev/null
@@ -1,1172 +0,0 @@
-.\" README.EXT.ja -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
-
-Ruby¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Îºî¤êÊý¤òÀâÌÀ¤·¤Þ¤¹¡¥
-
-1¡¥´ðÁÃÃμ±
-
-C¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤¢¤ê¡¤¥Ç¡¼¥¿¤Ë¤Ï·¿¤¬¤¢¤ê¤Þ¤»¤ó¡¥¤Ç¤¹¤«¤é¡¤¤¿
-¤È¤¨¤Ð¥Ý¥¤¥ó¥¿¤òint¤ÎÊÑ¿ô¤ËÂåÆþ¤¹¤ë¤È¡¤¤½¤ÎÃͤÏÀ°¿ô¤È¤·¤Æ¼è
-¤ê°·¤ï¤ì¤Þ¤¹¡¥µÕ¤ËRuby¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤Ê¤¯¡¤¥Ç¡¼¥¿¤Ë·¿¤¬¤¢¤ê¤Þ
-¤¹¡¥¤³¤Î°ã¤¤¤Î¤¿¤á¡¤C¤ÈRuby¤ÏÁê¸ß¤ËÊÑ´¹¤·¤Ê¤±¤ì¤Ð¡¤¤ª¸ß¤¤¤Î
-¥Ç¡¼¥¿¤ò¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤»¤ó¡¥
-
-Ruby¤Î¥Ç¡¼¥¿¤ÏVALUE¤È¤¤¤¦C¤Î·¿¤Çɽ¸½¤µ¤ì¤Þ¤¹¡¥VALUE·¿¤Î¥Ç¡¼
-¥¿¤Ï¤½¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¼«Ê¬¤ÇÃΤäƤ¤¤Þ¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤È
-¤¤¤¦¤Î¤Ï¥Ç¡¼¥¿(¥ª¥Ö¥¸¥§¥¯¥È)¤Î¼ÂºÝ¤Î¹½Â¤¤ò°ÕÌ£¤·¤Æ¤¤¤Æ¡¤Ruby
-¤Î¥¯¥é¥¹¤È¤Ï¤Þ¤¿°ã¤Ã¤¿¤â¤Î¤Ç¤¹¡¥
-
-VALUE¤«¤éC¤Ë¤È¤Ã¤Æ°ÕÌ£¤Î¤¢¤ë¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á¤Ë¤Ï
-
- (1) VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤òÃΤë
- (2) VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¤ÎξÊý¤¬É¬ÍפǤ¹¡¥(1)¤ò˺¤ì¤ë¤È´Ö°ã¤Ã¤¿¥Ç¡¼¥¿¤ÎÊÑ´¹¤¬¹Ô¤ï¤ì
-¤Æ¡¤ºÇ°­¥×¥í¥°¥é¥à¤¬core dump¤·¤Þ¤¹¡¥
-
-1.1 ¥Ç¡¼¥¿¥¿¥¤¥×
-
-Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
-	T_NIL		nil
-	T_OBJECT	Ä̾ï¤Î¥ª¥Ö¥¸¥§¥¯¥È
-	T_CLASS		¥¯¥é¥¹
-	T_MODULE	¥â¥¸¥å¡¼¥ë
-	T_FLOAT		ÉâÆ°¾®¿ôÅÀ¿ô
-	T_STRING	ʸ»úÎó
-	T_REGEXP	Àµµ¬É½¸½
-	T_ARRAY		ÇÛÎó
-	T_FIXNUM	Fixnum(31bitĹÀ°¿ô)
-	T_HASH		Ï¢ÁÛÇÛÎó
-	T_STRUCT	(Ruby¤Î)¹½Â¤ÂÎ
-	T_BIGNUM	¿ÇÜĹÀ°¿ô
-	T_FILE		Æþ½ÐÎÏ
-	T_TRUE		¿¿
-	T_FALSE		µ¶
-	T_DATA		¥Ç¡¼¥¿
-	T_SYMBOL	¥·¥ó¥Ü¥ë
-
-¤½¤Î¾¤ËÆâÉô¤ÇÍøÍѤµ¤ì¤Æ¤¤¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
-	T_ICLASS
-	T_MATCH
-	T_UNDEF
-	T_VARMAP
-	T_SCOPE
-	T_NODE
-
-¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-1.2 VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤¹¤ë
-
-ruby.h¤Ç¤ÏTYPE()¤È¤¤¤¦¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤VALUE¤Î¥Ç¡¼¥¿
-¥¿¥¤¥×¤òÃΤ뤳¤È¤¬½ÐÍè¤Þ¤¹¡¥TYPE()¥Þ¥¯¥í¤Ï¾å¤Ç¾Ò²ð¤·¤¿T_XXXX
-¤Î·Á¼°¤ÎÄê¿ô¤òÊÖ¤·¤Þ¤¹¡¥VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Ë±þ¤¸¤Æ½èÍý¤¹¤ë
-¾ì¹ç¤Ë¤Ï¡¤TYPE()¤ÎÃͤÇʬ´ô¤¹¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-  switch (TYPE(obj)) {
-    case T_FIXNUM:
-      /* FIXNUM¤Î½èÍý */
-      break;
-    case T_STRING:
-      /* ʸ»úÎó¤Î½èÍý */
-      break;
-    case T_ARRAY:
-      /* ÇÛÎó¤Î½èÍý */
-      break;
-    default:
-      /* Îã³°¤òȯÀ¸¤µ¤»¤ë */
-      rb_raise(rb_eTypeError, "not valid value");
-      break;
-  }
-
-¤½¤ì¤È¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤·¤Æ¡¤Àµ¤·¤¯¤Ê¤±¤ì¤ÐÎã³°¤òȯÀ¸¤¹
-¤ë´Ø¿ô¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-  void Check_Type(VALUE value, int type)
-
-¤³¤Î´Ø¿ô¤Ïvalue¤¬type¤Ç̵¤±¤ì¤Ð¡¤Îã³°¤òȯÀ¸¤µ¤»¤Þ¤¹¡¥°ú¿ô¤È
-¤·¤ÆÍ¿¤¨¤é¤ì¤¿VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤¬Àµ¤·¤¤¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹
-¤ë¤¿¤á¤Ë¤Ï¡¤¤³¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-  FIXNUM_P(obj)
-  NIL_P(obj)
-
-1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
-¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
-¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
-¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
-¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
-¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
-¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
-ȯÀ¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò
-¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡£
-
-char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¢version 1.6 °ÊÁ°¤Ç¤Ï¡ÖSTR2CSTR()¡×¤È
-¤¤¤¦¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤·¤¿¤¬¡¢¤³¤ì¤Ï to_str() ¤Ë¤è¤ë°ÅÌÛ¤Î
-·¿ÊÑ´¹·ë²Ì¤¬ GC ¤µ¤ì¤ë²ÄǽÀ­¤¬¤¢¤ë¤¿¤á¡¢version 1.7 °Ê¹ß¤Ç¤Ï
-obsolete ¤È¤Ê¤ê¡¢Âå¤ï¤ê¤Ë StringValue() ¤È StringValuePtr()
-¤ò»È¤¦»ö¤ò¿ä¾©¤·¤Æ¤¤¤Þ¤¹¡£StringValue(var) ¤Ï var ¤¬ String
- ¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¢¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì¤Ë
-ÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¢StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤òÃÖ¤­´¹¤¨
-¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡£var ¤Î
-ÆâÍƤòľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¢var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬
-¤¢¤ê¤Þ¤¹¡£
-
-¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
-¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
-¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
-
-¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
-¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
-¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
-
-ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
-»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
-
-Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
-¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
-¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(ary)->len¡×¡¤
-¡ÖRARRAY(ary)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
-¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
-¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍƤÎÀ°¹çÀ­¤¬
-¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-1.4 C¤Î¥Ç¡¼¥¿¤òVALUE¤ËÊÑ´¹¤¹¤ë
-
-VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
-
-  * FIXNUM¤Î¾ì¹ç
-
-    1bitº¸¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
-
-  * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
-
-    ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
-
-¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
-¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
-¤¤¤ë)¡¥
-
-¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
-¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
-ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
-¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
-¤Î¤â¤Î)¤À¤±¤Ç¤¹¡¥
-
-FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
-¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
-¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
-
-  INT2FIX()	¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
-  INT2NUM()	Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
-
-INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
-¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
-
-1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë
-
-ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍƤι¹¿·¤ò
-¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
-Ruby¤¬ÍÑ°Õ¤·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
-
-¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
-¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
-
- ʸ»úÎó¤ËÂФ¹¤ë´Ø¿ô
-
-  rb_str_new(const char *ptr, long len)
-
-    ¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
-  rb_str_new2(const char *ptr)
-
-    C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
-    rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
-  rb_tainted_str_new(const char *ptr, long len)
-
-    ±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤줿¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥³°Éô
-    ¤«¤é¤Î¥Ç¡¼¥¿¤Ë´ð¤Å¤¯Ê¸»úÎó¤Ë¤Ï±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤ì¤ë¤Ù¤­
-    ¤Ç¤¢¤ë¡¥
-
-  rb_tainted_str_new2(const char *ptr)
-
-    C¤Îʸ»úÎ󤫤é±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤줿Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
-  rb_str_cat(VALUE str, const char *ptr, long len)
-
-    Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
-
- ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
-
-  rb_ary_new()
-
-    Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
-  rb_ary_new2(long len)
-
-    Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥lenÍ×ÁÇʬ¤ÎÎΰè¤ò¤¢¤é¤«¤¸¤á³ä¤ê
-    Åö¤Æ¤Æ¤ª¤¯¡¥
-
-  rb_ary_new3(long n, ...)
-
-    °ú¿ô¤Ç»ØÄꤷ¤¿nÍ×ÁǤò´Þ¤àÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
-  rb_ary_new4(long n, VALUE *elts)
-
-    ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
-  rb_ary_push(VALUE ary, VALUE val)
-  rb_ary_pop(VALUE ary)
-  rb_ary_shift(VALUE ary)
-  rb_ary_unshift(VALUE ary, VALUE val)
-
-    Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
-    ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
-
-2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
-
-¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
-½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
-¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
-²ð¤·¤Þ¤¹¡¥
-
-2.1 Ruby¤Ëµ¡Ç½¤òÄɲ乤ë
-
-Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
-¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲ乤ë´Ø¿ô¤¬
-Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
- * ¥á¥½¥Ã¥É¡¤Æðۥ᥽¥Ã¥É¤Ê¤É
- * Äê¿ô
-
-¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
-
-2.1.1 ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-  VALUE rb_define_class(const char *name, VALUE super)
-  VALUE rb_define_module(const char *name)
-
-¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
-¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
-¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤ò¾¤Î¥¯¥é¥¹¤ÎÆâÉô¤Ë¥Í¥¹¥È¤·¤ÆÄêµÁ¤¹¤ë»þ¤Ë
-¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
-  VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 ¥á¥½¥Ã¥É/Æðۥ᥽¥Ã¥ÉÄêµÁ
-
-¥á¥½¥Ã¥É¤äÆðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-  void rb_define_method(VALUE klass, const char *name, 
-		        VALUE (*func)(), int argc)
-
-  void rb_define_singleton_method(VALUE object, const char *name, 
-			          VALUE (*func)(), int argc)
-
-
-Ç°¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆðۥ᥽¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
-¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
-¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆðۥ᥽¥Ã¥É¤¬»È¤ï¤ì
-¤Þ¤¹¡¥
-
-¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
-·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬0°Ê¾å¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°Õ
-Ì£¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½
-¤ó¤Ê¤Ë)¡¥¼ÂºÝ¤Î´Ø¿ô¤Ë¤ÏÀèƬ¤Î°ú¿ô¤È¤·¤Æself¤¬Í¿¤¨¤é¤ì¤Þ¤¹¤Î
-¤Ç¡¤»ØÄꤷ¤¿¿ô¤è¤ê1¿¤¤°ú¿ô¤ò»ý¤Ä¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
-¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
-
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
-¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
-
-  void rb_define_private_method(VALUE klass, const char *name, 
-				VALUE (*func)(), int argc)
-
-private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
-¥É¤Ç¤¹¡¥
-
-¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
-¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆðۥ᥽¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
-¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
-¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
-
-  Math.sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â
-
-  include Math
-  sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
-Ä̤ê¤Ç¤¹¡¥
-
-  void rb_define_module_function(VALUE module, const char *name, 
-		                 VALUE (*func)(), int argc)
-
-´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivate method)¤òÄêµÁ¤¹¤ë¤¿
-¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
-  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-
-¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
-
-  void rb_define_alias(VALUE module, const char* new, const char* old);
-
-2.1.3 Äê¿ôÄêµÁ
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
-¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
-
-  void rb_define_const(VALUE klass, const char *name, VALUE val)
-  void rb_define_global_const(const char *name, VALUE val)
-
-Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
-¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
-
-2.2 Ruby¤Îµ¡Ç½¤òC¤«¤é¸Æ¤Ó½Ð¤¹
-
-´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
-»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
-¤Þ¤¹¡¥
-
-# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
-# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
-
-¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
-
-2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
-
-C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
-Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë°Ê²¼¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
-  VALUE rb_eval_string(const char *str)
-
-¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
-¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
-
-2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
-¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
-»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
-
-ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
-
- :¼±ÊÌ»Ò
-
-¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
-
-  rb_intern(const char *name)
-
-¤ò»È¤¤¤Þ¤¹¡¥Ruby¤«¤é°ú¿ô¤È¤·¤ÆÍ¿¤¨¤é¤ì¤¿¥·¥ó¥Ü¥ë(¤Þ¤¿¤Ïʸ»ú
-Îó)¤òID¤ËÊÑ´¹¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-  rb_to_id(VALUE symbol)
-
-2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
-¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
-¤·¤Þ¤¹¡¥¤½¤Î¾¤Ë°ú¿ô¤Î»ØÄê¤Î»ÅÊý¤¬°ã¤¦°Ê²¼¤Î´Ø¿ô¤â¤¢¤ê¤Þ¤¹¡¥
-
-  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-  VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-apply¤Ë¤Ï°ú¿ô¤È¤·¤ÆRuby¤ÎÇÛÎó¤òÍ¿¤¨¤Þ¤¹¡¥
-
-2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
-
-C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤Äê¿ô¡¤¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ
-¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»¥¹¤Ç¤­
-¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
-
-¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
-¤ê¤Ç¤¹¡¥
-
-  VALUE rb_ivar_get(VALUE obj, ID id)
-  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-  VALUE rb_const_get(VALUE obj, ID id)
-
-Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
-¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-3¡¥Ruby¤ÈC¤È¤Î¾ðÊó¶¦Í­
-
-C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
-
-3.1 C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
-
-°Ê²¼¤ÎRuby¤ÎÄê¿ô¤ÏC¤Î¥ì¥Ù¥ë¤«¤é»²¾È¤Ç¤­¤Þ¤¹¡¥
-
-  Qtrue
-  Qfalse
-
-    ¿¿µ¶ÃÍ¡¥Qfalse¤ÏC¸À¸ì¤Ç¤âµ¶¤È¤ß¤Ê¤µ¤ì¤Þ¤¹(¤Ä¤Þ¤ê0)¡¥
-
-  Qnil
-
-    C¸À¸ì¤«¤é¸«¤¿¡Önil¡×¡¥
-
-3.2 C¤ÈRuby¤Ç¶¦Í­¤µ¤ì¤ëÂç°èÊÑ¿ô
-
-C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
-ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
-¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
-
-  void rb_define_variable(const char *name, VALUE *var)
-
-¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
-`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
-¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
-
-¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
-ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
-
-  void rb_define_readonly_variable(const char *name, VALUE *var)
-
-¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
-¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
-Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
-  void rb_define_hooked_variable(const char *name, VALUE *var,
-				 VALUE (*getter)(), void (*setter)())
-
-¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
-¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
-¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
-setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-
-¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
-  void rb_define_virtual_variable(const char *name,
-				  VALUE (*getter)(), void (*setter)())
-
-¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
-getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
-
-getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
-
-C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
-¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
-²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
-  Data_Wrap_Struct(klass, mark, free, ptr)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-klass¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
-¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
-»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
-
-free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
-´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥¤³¤ì¤¬-1¤Î¾ì¹ç¤Ï¡¤Ã±
-½ã¤Ë³«Êü¤µ¤ì¤Þ¤¹¡¥
-
-C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
-¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-  Data_Make_Struct(klass, type, mark, free, sval)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-klass, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
-¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
-¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
-¤Þ¤¹¡¥
-
-  Data_Get_Struct(obj, type, sval)
-
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
-
-¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
-ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-4¡¥ÎãÂê - dbm¥Ñ¥Ã¥±¡¼¥¸¤òºî¤ë
-
-¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
-Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥é¥¤¥Ö¥é¥ê¤òÎã¤Ë
-¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
-
-(1) ¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë
-
-  % mkdir ext/dbm
-
-Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
-¤ë¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤·¤¿¡¥Ruby¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¾ì¹ç¤Ë
-¤ÏRuby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥
-¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤Ë
-Áª¤ó¤Ç¹½¤¤¤Þ¤»¤ó¡¥
-
-(2) À߷פ¹¤ë
-
-¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
-·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
-¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
-¤·¤Þ¤¹¡¥
-
-(3) C¥³¡¼¥É¤ò½ñ¤¯
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥êËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
-¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
-¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤È¤¤¤¦¥Õ¥¡
-¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
-¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥é¥¤¥Ö¥é¥ê̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×Æͤ¹¤ë¤«¤é¤Ç¤¹¡¥
-
-Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
-¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤Î¾ì¹ç¡ÖInit_dbm¡×
-¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
-ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
-
---
-Init_dbm()
-{
-    /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
-    cDBM = rb_define_class("DBM", rb_cObject);
-    /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
-    rb_include_module(cDBM, rb_mEnumerable);
-
-    /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
-    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
-    /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
-    rb_define_method(cDBM, "close", fdbm_close, 0);
-    /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
-    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-		:
-
-    /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
-    id_dbm = rb_intern("dbm");
-}
---
-
-DBM¥é¥¤¥Ö¥é¥ê¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
-¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-
-dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-struct dbmdata {
-    int  di_size;
-    DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
-¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
-¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
-¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-#define GetDBM(obj, dbmp) {\
-    Data_Get_Struct(obj, struct dbmdata, dbmp);\
-    if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
-¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
-¤ë¤À¤±¤Ç¤¹¡¥
-
-DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
-°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
-¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
-fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
-{
-	:
-}
---
-
-°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
-¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
-
-°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
-¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
-¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
-¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_s_open(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
-{
-	:
-    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
-	mode = 0666;		/* default value */
-    }
-	:
-}
---
-
-¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
-¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
-¤¨¤é¤ì¤Þ¤¹¡¥
-
-¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
-½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
-¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
-¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
-¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
-¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
-¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
-ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
-¤¦¤Ç¤¹¡¥
-
---
-static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
-{
-	:
-}
---
-
-Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥
-
-** Ãí°Õ»ö¹à
-
-Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
-C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
-¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
-
-  void rb_global_variable(VALUE *var)
-
-(4) extconf.rb¤òÍÑ°Õ¤¹¤ë
-
-Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
-¤Þ¤¹¡¥extconf.rb¤Ï¥é¥¤¥Ö¥é¥ê¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã
-¥¯¤Ê¤É¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥¤Þ¤º¡¤
-
-  require 'mkmf'
-
-¤òextconf.rb¤ÎÀèƬ¤ËÃÖ¤­¤Þ¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø
-¿ô¤ò»È¤¦¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
-
-  have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
-  have_func(func, header): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
-  have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
-  create_makefile(target): Makefile¤ÎÀ¸À®
-
-°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
-
-  $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤Ê¤É)
-  $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
-
-¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤º¡¤¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó
-¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤ÏÀ¸
-À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
-
-(5) depend¤òÍÑ°Õ¤¹¤ë
-
-¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
-Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-
-  % gcc -MM *.c > depend
-
-¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤Æ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
-
-(6) Makefile¤òÀ¸À®¤¹¤ë
-
-Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
-
-  ruby extconf.rb
-
-¤È¤·¤Þ¤¹¡¥extconf.rb¤Ë require 'mkmf' ¤Î¹Ô¤¬¤Ê¤¤¾ì¹ç¤Ë¤Ï¥¨¥é¡¼
-¤Ë¤Ê¤ê¤Þ¤¹¤Î¤Ç¡¤°ú¿ô¤òÄɲä·¤Æ
-
-  ruby -r mkmf extconf.rb
-
-¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍÑ°Õ¤·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
-¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
-
-(7) make¤¹¤ë
-
-ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤òÀ¸À®¤¹¤ë¾ì¹ç¤Ë¤Ï¤½¤Î¾ì¤Çmake¤·¤Æ¤¯¤À¤µ
-¤¤¡¥É¬ÍפǤ¢¤ì¤Ð make install ¤Ç¥¤¥ó¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-ext°Ê²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òÍÑ°Õ¤·¤¿¾ì¹ç¤Ï¡¤Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç
-make¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤É¬Íפˤè¤Ã¤Æ¤Ï¤½¤Î¥â
-¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®¤¬É¬Íפʻþ¤Ï¤Þ
-¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïmake install¤ÇRuby¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î
-²¼¤Ë¥³¥Ô¡¼¤µ¤ì¤Þ¤¹¡¥¤â¤·³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤È¶¨Ä´¤·¤Æ»È¤¦Ruby¤Çµ­
-½Ò¤µ¤ì¤¿¥×¥í¥°¥é¥à¤¬¤¢¤ê¡¤Ruby¥é¥¤¥Ö¥é¥ê¤ËÃÖ¤­¤¿¤¤¾ì¹ç¤Ë¤Ï¡¤
-³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤Î²¼¤Ë lib ¤È¤¤¤¦¥Ç¥£¥ì¥¯¥È¥ê
-¤òºî¤ê¡¤¤½¤³¤Ë ³ÈÄ¥»Ò .rb ¤Î¥Õ¥¡¥¤¥ë¤òÃÖ¤¤¤Æ¤ª¤±¤ÐƱ»þ¤Ë¥¤¥ó
-¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-(8) ¥Ç¥Ð¥Ã¥°
-
-¤Þ¤¢¡¤¥Ç¥Ð¥Ã¥°¤·¤Ê¤¤¤ÈÆ°¤«¤Ê¤¤¤Ç¤·¤ç¤¦¤Í¡¥ext/Setup¤Ë¥Ç¥£¥ì
-¥¯¥È¥ê̾¤ò½ñ¤¯¤ÈÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¤Î¤Ç¥Ç¥Ð¥Ã¥¬¤¬»È¤¨¤ë¤è¤¦¤Ë¤Ê
-¤ê¤Þ¤¹¡¥¤½¤Îʬ¥³¥ó¥Ñ¥¤¥ë¤¬ÃÙ¤¯¤Ê¤ê¤Þ¤¹¤±¤É¡¥
-
-(9) ¤Ç¤­¤¢¤¬¤ê
-
-¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
-»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
-¼çÄ¥¤·¤Þ¤»¤ó¡¥
-
-Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
-
-Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
-¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
-¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
-»×¤¤¤Þ¤¹¡¥
-
-Ruby¸À¸ì¤Î¥³¥¢
-
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
-  parse.y
-  variable.c
-
-¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
-
-  dln.c
-  regex.c
-  st.c
-  util.c
-
-Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
-
-  dmyext.c
-  inits.c
-  main.c
-  ruby.c
-  version.c
-
-¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
-
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  prec.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
-
-Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
-
-C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-** ·¿
-
-VALUE
-
-  Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
-  ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
-  ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
-  ̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤ë¡¥
-
-** ÊÑ¿ô¡¦Äê¿ô
-
-Qnil
-
-  Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
-
-Qtrue
-
-  Äê¿ô: true¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
-
-Qfalse
-
-  Äê¿ô: false¥ª¥Ö¥¸¥§¥¯¥È
-
-** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
-
-Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
-  C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
-  ¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
-  ´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
-  ¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
-  ¤¬¤¢¤ë¡¥
-
-Data_Make_Struct(klass, type, mark, free, sval)
-
-  type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
-  ¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
-
-Data_Get_Struct(data, type, sval)
-
-  data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
-
-** ·¿¥Á¥§¥Ã¥¯
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** ·¿ÊÑ´¹
-
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
-NUM2DBL(value)
-rb_float_new(f)
-STR2CSTR(value)
-rb_str_new2(s)
-
-** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-VALUE rb_define_class(const char *name, VALUE super)
-
-  super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
-  super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤Î
-  Äê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_module(const char *name)
-
-  ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_module_under(VALUE module, const char *name)
-
-  ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
-void rb_include_module(VALUE klass, VALUE module)
-
-  ¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯
-  ¥ë¡¼¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
-
-void rb_extend_object(VALUE object, VALUE module)
-
-  ¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
-
-** Âç°èÊÑ¿ôÄêµÁ
-
-void rb_define_variable(const char *name, VALUE *var)
-
-  Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç
-  »Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±ÊÌ»Ò
-  ¤È¤·¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é
-  ¥à¤«¤é¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
-
-void rb_define_readonly_variable(const char *name, VALUE *var)
-
-  Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥
-  read only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
-
-void rb_define_virtual_variable(const char *name,
-				VALUE (*getter)(), void (*setter)())
-
-  ´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿
-  »þ¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì
-  ¤ë¡¥
-
-void rb_define_hooked_variable(const char *name, VALUE *var,
-			       VALUE (*getter)(), void (*setter)())
-
-  ´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô
-  ¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ï
-  setter¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò
-  »ØÄꤷ¤Ê¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
-
-void rb_global_variable(VALUE *var)
-
-  GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö
-  ¥¸¥§¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
-
-** Äê¿ô
-
-void rb_define_const(VALUE klass, const char *name, VALUE val)
-
-  Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
-void rb_define_global_const(const char *name, VALUE val)
-
-  Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
-     rb_define_const(rb_cObject, name, val)
-
-  ¤ÈƱ¤¸°ÕÌ£¡¥
-
-** ¥á¥½¥Ã¥ÉÄêµÁ
-
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-  ¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ, 
-  ´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2
-  °ú¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ, 
-  Âè1°ú¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È
-  ¤¤¤¦·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
- 
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-  private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
-rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-  Æðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
-rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
-  argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô, 
-  Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú
-  ¿ô»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Ä
-  ǽ¤Ç¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê
-  ¹ß¤ÏÊÑ¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥
-  Éղðú¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬
-  ÂåÆþ¤µ¤ì¤ë¡¥
-
-** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
-
-VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-  ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò
-  »È¤¦¡¥
-
-VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-  ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc, argv·Á¼°¤ÇÅϤ¹¡¥
-
-VALUE rb_eval_string(const char *str)
-
-  ʸ»úÎó¤òRuby¥¹¥¯¥ê¥×¥È¤È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
-
-ID rb_intern(const char *name)
-
-  ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
-
-char *rb_id2name(ID id)
-
-  ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
-
-char *rb_class2name(VALUE klass)
-
-  ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï, 
-  ÁÄÀè¤òÁ̤äÆ̾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
-
-int rb_respond_to(VALUE obj, ID id)
-
-  obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡£
-
-** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
-
-VALUE rb_iv_get(VALUE obj, const char *name)
-
-  obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó
-  ¥¹ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó
-  ¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥Äê¿ô¤ÏÂçʸ»ú¤Î̾Á°¤ò»ý¤Ä¥¯¥é¥¹(¤Þ¤¿¤Ï
-  ¥â¥¸¥å¡¼¥ë)¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤È¤·¤Æ¼ÂÁõ¤µ¤ì¤Æ¤¤¤ë¡¥
-
-VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
-  obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
-
-** À©¸æ¹½Â¤
-
-VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
-  func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥ 
-  func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
-  ¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
- 
-VALUE rb_yield(VALUE val)
-
-  val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
-
-VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
-  ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸
-  ¤·¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸
-  ¤·¤Ê¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá
-  ¤êÃͤǤ¢¤ë¡¥
-
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
-
-  ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬
-  ȯÀ¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1
-  ¤ÎÌá¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
-
-** Îã³°¡¦¥¨¥é¡¼
-
-void rb_warning(const char *fmt, ...)
-
-  rb_verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ï
-  printf()¤ÈƱ¤¸¡¥
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
-  RuntimeErrorÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
-
-void rb_raise(VALUE exception, const char *fmt, ...)
-
-  exception¤Ç»ØÄꤷ¤¿Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥fmt°Ê²¼¤Î°ú¿ô¤Ï
-  printf()¤ÈƱ¤¸¡¥
-
-void rb_fatal(const char *fmt, ...)
-
-  Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
-  ¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë
-  ¼Â¹Ô¤µ¤ì¤ë)¡¥
-
-void rb_bug(const char *fmt, ...)
-
-  ¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤
-  ¾õ¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥
-  Îã³°½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
-
-** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
-
-Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
-¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë¤ÏɬÍפʤ¤¡¥
-
-void ruby_init()
-
-  Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
-
-void ruby_options(int argc, char **argv)
-
-  Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î¥³¥Þ¥ó¥É¥é¥¤¥ó°ú¿ô¤Î½èÍý¤ò¹Ô¤Ê¤¦¡¥
-
-void ruby_run()
-
-  Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
-
-void ruby_script(char *name)
-
-  Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
-
-
-Appendix C. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
-
-extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
-²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-have_library(lib, func)
-
-  ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥
-  ¥é¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤true¤òÊÖ¤¹¡¥
-
-find_library(lib, func, path...)
-
-  ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò -Lpath ¤òÄɲÃ
-  ¤·¤Ê¤¬¤é¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é¥¤¥Ö¥é¥ê¤¬¸«ÉÕ¤«¤Ã¤¿»þ¡¤true¤òÊÖ¤¹¡¥
-
-have_func(func, header)
-
-  ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã
-  ¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
-  ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
-  »ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_header(header)
-
-  ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹
-  ¤ë»þtrue¤òÊÖ¤¹¡¥
-
-create_makefile(target)
-
-  ³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì
-  ¤Ð¤½¤Î¥é¥¤¥Ö¥é¥ê¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾
-  ¤òɽ¤¹¡¥
-
-with_config(withval[, default=nil])
-
-  ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃͤòÆÀ¤ë¡¥
-
-dir_config(target[, default_dir])
-dir_config(target[, default_include, default_lib])
-
-  ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<target>-dir, --with-<target>-include,
-  --with-<target>-lib¤Î¤¤¤º¤ì¤«¤Ç»ØÄꤵ¤ì¤ë¥Ç¥£¥ì¥¯¥È¥ê¤ò
-  $CFLAGS ¤ä $LDFLAGS ¤ËÄɲ乤롥--with-<target>-dir=/path¤Ï
-  --with-<target>-include=/path/include --with-<target>-lib=/path/lib
-  ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì¥¯¥È¥ê¤Î
-  ÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
diff --git a/README.ja b/README.ja
deleted file mode 100644
index fc502dd440..0000000000
--- a/README.ja
+++ /dev/null
@@ -1,153 +0,0 @@
-* Ruby¤È¤Ï
-
-Ruby¤Ï¥·¥ó¥×¥ë¤«¤Ä¶¯ÎϤʥª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¹¡¥
-Ruby¤ÏºÇ½é¤«¤é½ã¿è¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤È¤·¤ÆÀ߷פµ¤ì¤Æ¤¤¤Þ
-¤¹¤«¤é¡¤¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥×¥í¥°¥é¥ß¥ó¥°¤ò¼ê·Ú¤Ë¹Ô¤¦»ö¤¬½ÐÍè¤Þ
-¤¹¡¥¤â¤Á¤í¤óÄ̾ï¤Î¼ê³¤­·¿¤Î¥×¥í¥°¥é¥ß¥ó¥°¤â²Äǽ¤Ç¤¹¡¥
-
-Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
-¤Ç¤¹¡¥¤µ¤é¤Ë¥·¥ó¥×¥ë¤Êʸˡ¤È¡¤Îã³°½èÍý¤ä¥¤¥Æ¥ì¡¼¥¿¤Ê¤É¤Îµ¡¹½
-¤Ë¤è¤Ã¤Æ¡¤¤è¤êʬ¤«¤ê¤ä¤¹¤¤¥×¥í¥°¥é¥ß¥ó¥°¤¬½ÐÍè¤Þ¤¹¡¥
-
-
-* Ruby¤ÎÆÃĹ
-
-  + ¥·¥ó¥×¥ë¤Êʸˡ
-  + ÉáÄ̤Υª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(¥¯¥é¥¹¡¤¥á¥½¥Ã¥É¥³¡¼¥ë¤Ê¤É)
-  + Æüì¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(Mixin, Æðۥ᥽¥Ã¥É¤Ê¤É)
-  + ±é»»»Ò¥ª¡¼¥Ð¡¼¥í¡¼¥É
-  + Îã³°½èÍýµ¡Ç½
-  + ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
-  + ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
-  + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
-  + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤ÇÆ°¤¯¤À¤±¤Ç¤Ê¤¯¡¤DOS¤äWindows¡¤
-    Mac¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âÆ°¤¯
-
-
-* Æþ¼êË¡
-
-** ftp¤Ç
-
-°Ê²¼¤Î¾ì½ê¤Ë¤ª¤¤¤Æ¤¢¤ê¤Þ¤¹¡¥
-
-  ftp://ftp.ruby-lang.org/pub/ruby/
-
-** CVS¤Ç
-
-  $ cvs -d :pserver:anonymous@cvs.ruby-lang.org:/src login
-  (Logging in to anonymous@cvs.ruby-lang.org)
-  CVS password: anonymous
-  $ cvs -z4 -d :pserver:anonymous@cvs.ruby-lang.org:src checkout ruby
-
-
-* ¥Û¡¼¥à¥Ú¡¼¥¸
-
-Ruby¤Î¥Û¡¼¥à¥Ú¡¼¥¸¤ÎURL¤Ï
-
-   http://www.ruby-lang.org/
-
-¤Ç¤¹¡¥
-
-
-* ¥á¡¼¥ê¥ó¥°¥ê¥¹¥È
-
-Ruby¤Î¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤¬¤¢¤ê¤Þ¤¹¡£»²²Ã´õ˾¤ÎÊý¤Ï
-
-   ruby-list-ctl@ruby-lang.org
-
-¤Þ¤ÇËÜʸ¤Ë
-
-   subscribe YourFirstName YourFamilyName
-   
-¤È½ñ¤¤¤ÆÁ÷¤Ã¤Æ²¼¤µ¤¤¡£ 
-
-Ruby³«È¯¼Ô¸þ¤±¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£¤³¤Á¤é¤Ç¤Ïruby¤Î¥Ð
-¥°¡¢¾­Íè¤Î»ÅÍͳÈÄ¥¤Ê¤É¼ÂÁõ¾å¤ÎÌäÂê¤Ë¤Ä¤¤¤ÆµÄÏÀ¤µ¤ì¤Æ¤¤¤Þ¤¹¡£
-»²²Ã´õ˾¤ÎÊý¤Ï
-
-   ruby-dev-ctl@ruby-lang.org
-
-¤Þ¤Çruby-list¤ÈƱÍͤÎÊýË¡¤Ç¥á¡¼¥ë¤·¤Æ¤¯¤À¤µ¤¤¡£ 
-
-Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
-¿ô³Ø´Ø·¸¤ÎÏÃÂê¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-math¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
-±Ñ¸ì¤ÇÏ䷹礦ruby-talk¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£»²²ÃÊýË¡
-¤Ï¤É¤ì¤âƱ¤¸¤Ç¤¹¡£ 
-
-
-* ¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
-
-°Ê²¼¤Î¼ê½ç¤Ç¹Ô¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-  1. ¤â¤·configure¥Õ¥¡¥¤¥ë¤¬¸«¤Ä¤«¤é¤Ê¤¤¡¢¤â¤·¤¯¤Ï
-     configure.in¤è¤ê¸Å¤¤¤è¤¦¤Ê¤é¡¢autoconf¤ò¼Â¹Ô¤·¤Æ
-     ¿·¤·¤¯configure¤òÀ¸À®¤¹¤ë
-
-  2. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
-
-  3. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
-
-     ¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
-
-  4. (ɬÍפʤé¤Ð)ext/Setup¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò
-     »ØÄꤹ¤ë
-
-     ext/Setup¤Ëµ­½Ò¤·¤¿¥â¥¸¥å¡¼¥ë¤ÏÀÅŪ¤Ë¥ê¥ó¥¯¤µ¤ì¤Þ¤¹¡¥
-
-     ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥°¤ò¥µ¥Ý¡¼¥È¤·¤Æ¤¤¤Ê¤¤¥¢¡¼¥­¥Æ¥¯
-     ¥Á¥ã¤Ç¤ÏSetup¤Î1¹ÔÌܤΡÖoption nodynamic¡×¤È¤¤¤¦¹Ô¤Î¥³
-     ¥á¥ó¥È¤ò³°¤¹É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤Þ¤¿¡¤¤³¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ç
-     ³ÈÄ¥¥â¥¸¥å¡¼¥ë¤òÍøÍѤ¹¤ë¤¿¤á¤Ë¤Ï¡¤¤¢¤é¤«¤¸¤áÀÅŪ¤Ë¥ê¥ó
-     ¥¯¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
-  5. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
-
-  6. make test¤Ç¥Æ¥¹¥È¤ò¹Ô¤¦¡¥
-
-     ¡Ötest succeeded¡×¤Èɽ¼¨¤µ¤ì¤ì¤ÐÀ®¸ù¤Ç¤¹¡¥¤¿¤À¤·¥Æ¥¹¥È
-     ¤ËÀ®¸ù¤·¤Æ¤â´°àú¤À¤ÈÊݾڤµ¤ì¤Æ¤¤¤ëÌõ¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥
-
-  7. make install
-
-     root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
-
-¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
-¥·¥ó¡¤OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¯
-¤À¤µ¤ë¤È¾¤ÎÊý¤Î¤¿¤á¤Ë¤â¤Ê¤ê¤Þ¤¹¡¥
-
-
-* °Ü¿¢
-
-UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
-¤¹¤¬¡¤»×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤)¡¤ºî¼Ô¤Ë¤½¤Î
-¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
-
-¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
-¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
-³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
-¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆäËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
-¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
-¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
-¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
-³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
-
-# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
-
-¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
-¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
-¤ì¤Þ¤»¤ó¡¥
-
-
-* ÇÛÉÛ¾ò·ï
-
-COPYING.ja¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡£
-
-
-* Ãø¼Ô
-
-¥³¥á¥ó¥È¡¤¥Ð¥°¥ì¥Ý¡¼¥È¤½¤Î¾¤Ï matz@netlab.jp ¤Þ¤Ç¡¥
--------------------------------------------------------
-created at: Thu Aug  3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..9bbc3a83a5
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,176 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+[English](rdoc-ref:README.md)
+
+# Ruby��
+
+Ruby�シンプル��強力�オブジェクト指�スクリプト言語��． Ruby�純粋�オブジェクト指�言語���設計�れ��る��，
+オブジェクト指�プログラミングを手軽�行�事�出���．も��ん普通�手続�型�プログラミングも�能��．
+
+Ruby�テキスト処�関係�能力���優れ，Perl����ら�強力��．�ら�シンプル�文法�，
+例外処�やイテレータ���機構�よ��，より分�りや��プログラミング�出���．
+
+## Ruby�特長
+
+*   シンプル�文法
+*   普通�オブジェクト指�機能(クラス，メソッドコール��)
+*   特殊�オブジェクト指�機能(Mixin，特異メソッド��)
+*   演算�オー�ーロード
+*   例外処�機能
+*   イテレータ�クロージャ
+*   ガーベージコレクタ
+*   ダイナミックローディング (アーキテク�ャ�よる)
+*   移�性�高�．多��Unix-like/POSIX互�プラットフォーム上�動������，Windows， macOS，
+    Haiku���上�も動� cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+
+
+## 入手法
+
+サードパーティーツールを使��方法を�むRuby�インストール方法�一覧�
+
+https://www.ruby-lang.org/ja/downloads/
+
+を�照������．
+
+### Git
+
+ミラーをGitHub�公開�����． 以下�コマンド�リ�ジトリを�得����．
+
+```console
+$ git clone https://github.com/ruby/ruby.git
+```
+
+他�ブラン��一覧�次�コマンド�見られ��．
+
+```console
+$ git ls-remote https://github.com/ruby/ruby.git
+```
+
+Rubyリ�ジトリ�本��master� https://git.ruby-lang.org/ruby.git ��り��．
+コミッタ���らを使���．
+
+## ホームページ
+
+Ruby�ホームページ�URL�
+
+https://www.ruby-lang.org/
+
+��．
+
+## メーリングリスト
+
+Ruby�メーリングリスト��り��．�加希望�方� [ruby-list-request@ml.ruby-lang.org] ��件��
+
+    join
+
+�書�����下��．
+
+Ruby開発者��メーリングリストも�り��．��ら��ruby��グ，将��仕様拡張��実装上��題����議論�れ����．
+�加希望�方� [ruby-dev-request@ml.ruby-lang.org] ��ruby-list��様�方法�メール������．
+
+Ruby拡張モジュール����話���ruby-extメーリングリスト�数学関係�話題����話���ruby-mathメーリングリスト�
+英語�ruby����話���ruby-talkメーリングリストも�り��．�加方法��れも����．
+
+[ruby-list-request@ml.ruby-lang.org]: mailto:ruby-list-request@ml.ruby-lang.org?subject=join
+[ruby-dev-request@ml.ruby-lang.org]: mailto:ruby-dev-request@ml.ruby-lang.org?subject=join
+
+## コンパイル・インストール
+
+以下�手順�行������．
+
+1.  (Gitリ�ジトリ�ら�得��ソースをビルド�る場�) `./autogen.sh` を実行��新�� `configure` を生��る
+
+2.  `configure` を実行�� `Makefile` ��を生��る
+
+    環境�よ���デフォルト�Cコンパイラ用オプション�付���． `configure` オプション� `optflags=..`
+    `warnflags=..` 等�上書�����．
+
+3.  (必��ら�)`include/ruby/defines.h` を編集�る
+
+    多分，必�無������．
+
+4.  (必��ら�)`ext/Setup` ��的�リンク�る拡張モジュールを指定�る
+
+    `ext/Setup` �記述��モジュール��的�リンク�れ��．
+
+    ダイナミックローディングをサ�ート�����アーキテク�ャ�� `Setup` �1行目�「`option nodynamic`����行�コ
+    メントを外�必���り��．
+    ��，��アーキテク�ャ�拡張モジュールを利用�る����，�ら����的�リンクを����必���り��．
+
+5.  `make` を実行��コンパイル�る
+
+6.  `make check`�テストを行�．
+
+    「`check succeeded`��表示�れれ��功��．���テスト��功��も完璧���証�れ��る訳���り��ん．
+
+7.  `make install`
+
+    以下�ディレクトリを作��，���ファイルをインストー ル���．
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    Ruby�API�ージョン�'*x.y.z*'��れ�，`${MAJOR}`�
+    '*x*'�，`${MINOR}`�'*y*'，`${TEENY}`�'*z*'��．
+
+    **注�**: API�ージョン� `teeny` �，Rubyプログラム��ージョン��異�る����り��．
+
+    `root` �作業�る必���る�も�れ��ん．
+
+
+も�，コンパイル時�エラー�発生��場���エラー�ログ�マシン，OS�種類を�む��る��詳��レ�ートを作者����下�る�他�方����も�り��．
+
+## 移�
+
+UNIX��れ� `configure` ���ん��差異を�����れる�����，���見�������場�(�る事�多�)，作者���
+��を報告�れ�，解決��る�能性��り��．
+
+アーキテク�ャ�も��も�存�る��GC部��．Ruby�GC�対象
+�アーキテク�ャ�`setjmp()`���`getcontext()`�よ��全��レジスタを `jmp_buf` や `ucontext_t`
+�格��る���， `jmp_buf` や `ucontext_t` �スタック�32bitアラインメント�れ��る��を仮定
+�����．特��者��立���場��対応��常�困難��ょ�． 後者�解決�比較的簡��， `gc.c` �スタックをマーク���る
+部分�アラインメント��イト数���ら��マーク�るコードを追加�る���済���．`defined(__mc68000__)`�括られ��
+る部分を�考�������．
+
+レジスタウィンドウを��CPU��，レジスタウィンドウをスタック�フラッシュ�るアセンブラコードを追加�る必���る�も�れ��ん．
+
+## �布�件
+
+[COPYING.ja](https://docs.ruby-lang.org/en/master/COPYING_ja.html) ファイルを�照������．
+
+## フィード�ック
+
+Ruby�関�る質�� [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
+[stackoverflow] ���Webサイト�投稿������．
+
+�グ報告� https://bugs.ruby-lang.org ���付�����．
+
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
+
+## 著者
+
+Ruby�オリジナル版�，1995年���も�ゆ�����よ��設計・開発�れ���．
+
+<mailto:matz@ruby-lang.org>
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..02435b419e
--- /dev/null
+++ b/README.md
@@ -0,0 +1,96 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+[日本語](rdoc-ref:README.ja.md)
+
+# What is Ruby?
+
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
+
+## Features of Ruby
+
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+  well as Windows, macOS, etc.) cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+
+## How to get Ruby
+
+For a complete list of ways to install Ruby, including using third-party tools
+like rvm, see:
+
+https://www.ruby-lang.org/en/downloads/
+
+You can download release packages and the snapshot of the repository. If you want to
+download whole versions of Ruby, please visit https://www.ruby-lang.org/en/downloads/releases/.
+
+### Download with Git
+
+The mirror of the Ruby source tree can be checked out with the following command:
+
+    $ git clone https://github.com/ruby/ruby.git
+
+There are some other branches under development. Try the following command
+to see the list of branches:
+
+    $ git ls-remote https://github.com/ruby/ruby.git
+
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
+
+## How to build
+
+See [Building Ruby](https://docs.ruby-lang.org/en/master/contributing/building_ruby_md.html)
+
+## Ruby home page
+
+https://www.ruby-lang.org/
+
+## Documentation
+
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
+
+## Mailing list
+
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
+
+    join
+
+in the mail subject (not body) to the address [ruby-talk-request@ml.ruby-lang.org].
+
+[ruby-talk-request@ml.ruby-lang.org]: mailto:ruby-talk-request@ml.ruby-lang.org?subject=join
+
+## Copying
+
+See the file [COPYING](rdoc-ref:COPYING).
+
+## Feedback
+
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
+
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
+
+## Contributing
+
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
+
+<matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index 7e5ef523a8..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,124 +0,0 @@
-Language Spec.
-
-- Class#allocate - basicNew
-- class Foo::Bar<Baz .. end, module Boo::Bar .. end
-- raise exception by `` error
-- a +1 to be a+1, not a(+1).
-- clarify evaluation order of operator argument (=~, .., ...)
-- :symbol => value hash in the form of {symbol: value, ...} ??
-* operator !! for rescue. ???
-* objectify characters
-* ../... outside condition invokes operator method too.
-* ... inside condition turns off just before right condition.???
-* package or access control for global variables??
-* named arguments like foo(nation:="german") or foo(nation: "german").
-* method to retrieve argument information (needs new C API)
-* multiple return values, yield values.  maybe incompatible ???
-* cascading method invocation ???
-* def Class#method .. end ??
-* def Foo::Bar::baz() .. end ??
-* I18N (or M17N) script/string/regexp
-* discourage use of symbol variables (e.g. $/, etc.) in manual
-* discourage use of Perlish features by giving warnings.
-* non confusing in-block local variable (is it possible?)
-  + remove scope by block
-  + variables appears within block may have independent values.
-* Regexp: make /o thread safe.
-* decide whether begin with rescue or ensure make do..while loop.
-* unify == and eql? again
-* to_i returns nil if str contains no digit.
-* jar like combined library package. -> RubyGems?
-* method combination, e.g. before, after, around, etc.
-* .. or something like defadvice in Emacs.
-* property - for methods, or for objects in general.
-* "in" modifier, to annotate, or to encourage assertion.
-* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
-* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
-* warn/error "bare word" method, like "foo",  you should type "foo()"
-
-Hacking Interpreter
-
-- generational GC
-* non-blocking open (e.g. for named pipe) for thread
-* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
-* objectify interpreters ???
-* remove rb_eval() recursions
-* syntax tree -> bytecode ???
-* scrambled script, or script filter
-* setuid ruby
-* performance tune for in-block (dynamic) local variables.
-* give warnings to assign magic variables.
-* export rb_io_{addstr,printf,puts,print}
-* autoload should work with threads [ruby-talk:4589]
-* remove stdio dependency from IOs.
-* warn for inconsistent local variable usage (lv m and method m at the same time). 
-* MicroRuby
-* Built-in Interactive Ruby.
-* Parser API
-* trap every method invocation, which can be enabled by e.g. trap_call :method.
-* unify Errno exceptions of same errno, or new exception comparison scheme.
-* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
-* Thread#max_stack_size attribute (possible??)
-
-Standard Libraries
-
-- Module#define_method which takes a name and a body (block, proc or method).
-- Enume#inject
-- Array#fetch
-- IO::for_fd
-- Process::waitall [ruby-talk:4557]
-- Process::Status
-- File::lchown, File::lchmod; xxx - still need work for non existing platforms
-- move Time::times to Process.
-- Enumerable#sort_by for Schwartzian transformation
-- fork_and_kill_other_threads.
-- signal list (Signal::trap, Signal::list).
-- move NameError under StandardError.
-- Integer#to_s(base)
-- Hash::new{default}
-- hash etc. should handle self referenceing array/hash
-- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
-- use Mersenne Twister RNG for random.
-- deprecate Array#indexes, and Array#indices.
-- remove dependency on MAXPATHLEN.
-- String#scanf(?)
-* Object#fmt(?)
-* Time::strptime
-* Integer[num], Float[num];  Fixnum[num]?
-* method to retrieve non-number trailer for to_i/to_f.
-* Stream or Port, abstract superclass of IO ?
-* String#{pred,prev}, String#downto
-* optional stepsize argument for succ()
-* Ruby module -- Ruby::Version, Ruby::Interpreter
-* introduce Boolean class; super of TrueClass, FalseClass
-* synchronized method - synchronized{...}, synchronized :foo, :bar
-* Array#&, Array#| to allow duplication. ???
-* way to specify immortal (fork endurance) thread;
-* or raise ForkException to every thread but fork caller.
-* new user-defined marshal scheme. _dump(dumper), _load(restorer)
-* library to load per-user profile seeking .ruby_profile or ruby.ini file.
-* warning framework (warn, warning for Ruby level)
-* marshal should not depend on sprintf (works bad with locale).
-* ternary arg pow: a.pow(b,c) == a**b%c
-* new caller(), e.g. call_stack; needs better name.
-* pointer share mechanism similar to one in String for Array.
-* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
-* save both "feature names" and "normalized path" in $"
-* implement Mutex_m (or MutexMixin) using Mutex.
-
-Extension Libraries
-
-* ptk.rb pTk wrapper that is compatible to tk.rb
-* Berkeley DB extension
-* BitVector
-* thread-safe fcgi
-
-Ruby Libraries
-
-- urllib.rb, nttplib.rb, etc.
-* format like perl's
-
-Tools
-
-* freeze or undump to bundle everything
-* bundle using zlib
diff --git a/install-sh b/aclocal.m4
index e69de29bb2..e69de29bb2 100644
--- a/install-sh
+++ b/aclocal.m4
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..19a6a425c1
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,2721 @@
+/**********************************************************************
+
+  addr2line.c -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#if defined(__clang__) && defined(__has_warning)
+#if __has_warning("-Wgnu-empty-initializer")
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#endif
+#if __has_warning("-Wgcc-compat")
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
+#include "ruby/missing.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
+
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdint.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+/* Make alloca work the best possible way.  */
+#ifdef __GNUC__
+# ifndef alloca
+#  define alloca __builtin_alloca
+# endif
+#else
+# ifdef HAVE_ALLOCA_H
+#  include <alloca.h>
+# else
+#  ifdef _AIX
+#pragma alloca
+#  else
+#   ifndef alloca                /* predefined by HP cc +Olibcalls */
+void *alloca();
+#   endif
+#  endif /* AIX */
+# endif        /* HAVE_ALLOCA_H */
+# ifndef UNREACHABLE
+#  define UNREACHABLE __builtin_unreachable()
+# endif
+# ifndef UNREACHABLE_RETURN
+#  define UNREACHABLE_RETURN(_) __builtin_unreachable()
+# endif
+#endif /* __GNUC__ */
+
+#ifndef UNREACHABLE
+# define UNREACHABLE abort()
+#endif
+#ifndef UNREACHABLE_RETURN
+# define UNREACHABLE_RETURN(_) return (abort(), (_))
+#endif
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
+
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+#  include <elf_abi.h>
+# else
+#  include <elf.h>
+# endif
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+#  define ElfW(x) Elf64##_##x
+# else
+#  define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+#  define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+#  define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+#  include <zlib.h>
+#  define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
+#ifndef PATH_MAX
+#define PATH_MAX 4096
+#endif
+
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+
+#define kprintf(...) fprintf(errout, "" __VA_ARGS__)
+
+typedef struct line_info {
+    const char *dirname;
+    const char *filename;
+    const char *path; /* object path */
+    int line;
+
+    uintptr_t base_addr;
+    uintptr_t saddr;
+    const char *sname; /* function name */
+
+    struct line_info *next;
+} line_info_t;
+
+struct dwarf_section {
+    char *ptr;
+    size_t size;
+    uint64_t flags;
+};
+
+typedef struct obj_info {
+    const char *path; /* object path */
+    char *mapped;
+    size_t mapped_size;
+    void *uncompressed;
+    uintptr_t base_addr;
+    uintptr_t vmaddr;
+    struct dwarf_section debug_abbrev;
+    struct dwarf_section debug_info;
+    struct dwarf_section debug_line;
+    struct dwarf_section debug_ranges;
+    struct dwarf_section debug_str_offsets;
+    struct dwarf_section debug_addr;
+    struct dwarf_section debug_rnglists;
+    struct dwarf_section debug_str;
+    struct dwarf_section debug_line_str;
+    struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+    struct dwarf_section *ary[] = {
+        &obj->debug_abbrev,
+        &obj->debug_info,
+        &obj->debug_line,
+        &obj->debug_ranges,
+        &obj->debug_str_offsets,
+        &obj->debug_addr,
+        &obj->debug_rnglists,
+        &obj->debug_str,
+        &obj->debug_line_str
+    };
+    if (n < 0 || DWARF_SECTION_COUNT <= n) {
+        UNREACHABLE_RETURN(0);
+    }
+    return ary[n];
+}
+
+struct debug_section_definition {
+    const char *name;
+    struct dwarf_section *dwarf;
+};
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX + 1];
+
+static unsigned long
+uleb128(const char **p)
+{
+    unsigned long r = 0;
+    int s = 0;
+    for (;;) {
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            r += (unsigned long)b << s;
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
+    }
+    return r;
+}
+
+static long
+sleb128(const char **p)
+{
+    long r = 0;
+    int s = 0;
+    for (;;) {
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            if (b & 0x40) {
+                r -= (0x80 - b) << s;
+            }
+            else {
+                r += (b & 0x3f) << s;
+            }
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
+    }
+    return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, const char *p, FILE *errout)
+{
+    if (!dir--) {
+        return "";
+    }
+    while (dir--) {
+        while (*p) p++;
+        p++;
+        if (!*p) {
+            kprintf("Unexpected directory number %lu in %s\n",
+                    dir, binary_filename);
+            return "";
+        }
+    }
+    return p;
+}
+
+static const char *parse_ver5_debug_line_header(
+    const char *p, int idx, uint8_t format,
+    obj_info_t *obj, const char **out_path,
+    uint64_t *out_directory_index, FILE *errout);
+
+static void
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories,
+              const char *filenames, line_info_t *line, obj_info_t *obj, FILE *errout)
+{
+    int i;
+    const char *p = filenames;
+    const char *filename;
+    unsigned long dir;
+    if (version >= 5) {
+        const char *path;
+        uint64_t directory_index = -1;
+        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index, errout);
+        line->filename = path;
+        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL, errout);
+        line->dirname = path;
+    }
+    else {
+        for (i = 1; i <= file; i++) {
+            filename = p;
+            if (!*p) {
+#ifndef __APPLE__
+                /* Need to output binary file name? */
+                kprintf("Unexpected file number %d in %s at %tx\n",
+                        file, binary_filename, filenames - obj->mapped);
+#endif
+                return;
+            }
+            while (*p) p++;
+            p++;
+            dir = uleb128(&p);
+            /* last modified. */
+            uleb128(&p);
+            /* size of the file. */
+            uleb128(&p);
+
+            if (i == file) {
+                line->filename = filename;
+                line->dirname = get_nth_dirname(dir, include_directories, errout);
+            }
+        }
+    }
+}
+
+static void
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+          uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
+          obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    int i;
+    addr += obj->base_addr - obj->vmaddr;
+    for (i = offset; i < num_traces; i++) {
+        uintptr_t a = (uintptr_t)traces[i];
+        /* We assume one line code doesn't result >100 bytes of native code.
+       We may want more reliable way eventually... */
+        if (addr < a && a < addr + 100) {
+            fill_filename(file, format, version, include_directories, filenames, &lines[i], obj, errout);
+            lines[i].line = line;
+        }
+    }
+}
+
+struct LineNumberProgramHeader {
+    uint64_t unit_length;
+    uint16_t version;
+    uint8_t format; /* 4 or 8 */
+    uint64_t header_length;
+    uint8_t minimum_instruction_length;
+    uint8_t maximum_operations_per_instruction;
+    uint8_t default_is_stmt;
+    int8_t line_base;
+    uint8_t line_range;
+    uint8_t opcode_base;
+    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+    const char *include_directories;
+    const char *filenames;
+    const char *cu_start;
+    const char *cu_end;
+};
+
+static int
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header, FILE *errout)
+{
+    const char *p = *pp;
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    header->cu_end = p + header->unit_length;
+
+    header->version = *(uint16_t *)p;
+    p += sizeof(uint16_t);
+    if (header->version > 5) return -1;
+
+    if (header->version >= 5) {
+        /* address_size = *(uint8_t *)p++; */
+        /* segment_selector_size = *(uint8_t *)p++; */
+        p += 2;
+    }
+
+    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+    p += header->format;
+    header->cu_start = p + header->header_length;
+
+    header->minimum_instruction_length = *(uint8_t *)p++;
+
+    if (header->version >= 4) {
+        /* maximum_operations_per_instruction = *(uint8_t *)p; */
+        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+        p++;
+    }
+
+    header->default_is_stmt = *(uint8_t *)p++;
+    header->line_base = *(int8_t *)p++;
+    header->line_range = *(uint8_t *)p++;
+    header->opcode_base = *(uint8_t *)p++;
+    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+    p += header->opcode_base - 1;
+
+    if (header->version >= 5) {
+        header->include_directories = p;
+        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL, errout);
+        header->filenames = p;
+    }
+    else {
+        header->include_directories = p;
+
+        /* temporary measure for compress-debug-sections */
+        if (p >= header->cu_end) return -1;
+
+        /* skip include directories */
+        while (*p) {
+            p = memchr(p, '\0', header->cu_end - p);
+            if (!p) return -1;
+            p++;
+        }
+        p++;
+
+        header->filenames = p;
+    }
+
+    *pp = header->cu_start;
+
+    return 0;
+}
+
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+                obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    const char *p = (const char *)*debug_line;
+    struct LineNumberProgramHeader header;
+
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
+
+    if (parse_debug_line_header(obj, &p, &header, errout))
+        return -1;
+    is_stmt = header.default_is_stmt;
+
+#define FILL_LINE()                                                 \
+    do {                                                            \
+        fill_line(num_traces, traces, addr, file, line,             \
+                  header.format,                                    \
+                  header.version,                                   \
+                  header.include_directories,                       \
+                  header.filenames,                                 \
+                  obj, lines, offset, errout);                      \
+        /*basic_block = prologue_end = epilogue_begin = 0;*/        \
+    } while (0)
+
+    while (p < header.cu_end) {
+        unsigned long a;
+        unsigned char op = *p++;
+        switch (op) {
+        case DW_LNS_copy:
+            FILL_LINE();
+            break;
+        case DW_LNS_advance_pc:
+            a = uleb128(&p) * header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_advance_line: {
+            long a = sleb128(&p);
+            line += a;
+            break;
+        }
+        case DW_LNS_set_file:
+            file = (unsigned int)uleb128(&p);
+            break;
+        case DW_LNS_set_column:
+            /*column = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case DW_LNS_negate_stmt:
+            is_stmt = !is_stmt;
+            break;
+        case DW_LNS_set_basic_block:
+            /*basic_block = 1; */
+            break;
+        case DW_LNS_const_add_pc:
+            a = ((255UL - header.opcode_base) / header.line_range) *
+                header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_fixed_advance_pc:
+            a = *(uint16_t *)p;
+            p += sizeof(uint16_t);
+            addr += a;
+            break;
+        case DW_LNS_set_prologue_end:
+            /* prologue_end = 1; */
+            break;
+        case DW_LNS_set_epilogue_begin:
+            /* epilogue_begin = 1; */
+            break;
+        case DW_LNS_set_isa:
+            /* isa = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case 0:
+            a = uleb128(&p);
+            op = *p++;
+            switch (op) {
+            case DW_LNE_end_sequence:
+                /* end_sequence = 1; */
+                FILL_LINE();
+                addr = 0;
+                file = 1;
+                line = 1;
+                /* column = 0; */
+                is_stmt = header.default_is_stmt;
+                /* end_sequence = 0; */
+                /* isa = 0; */
+                break;
+            case DW_LNE_set_address:
+                addr = *(unsigned long *)p;
+                p += sizeof(unsigned long);
+                break;
+            case DW_LNE_define_file:
+                kprintf("Unsupported operation in %s\n",
+                        binary_filename);
+                break;
+            case DW_LNE_set_discriminator:
+                /* TODO:currently ignore */
+                uleb128(&p);
+                break;
+            default:
+                kprintf("Unknown extended opcode: %d in %s\n",
+                        op, binary_filename);
+            }
+            break;
+        default: {
+            uint8_t adjusted_opcode = op - header.opcode_base;
+            uint8_t operation_advance = adjusted_opcode / header.line_range;
+            /* NOTE: this code doesn't support VLIW */
+            addr += operation_advance * header.minimum_instruction_length;
+            line += header.line_base + (adjusted_opcode % header.line_range);
+            FILL_LINE();
+        }
+        }
+    }
+    *debug_line = (char *)p;
+    return 0;
+}
+
+static int
+parse_debug_line(int num_traces, void **traces,
+                 const char *debug_line, unsigned long size,
+                 obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    const char *debug_line_end = debug_line + size;
+    while (debug_line < debug_line_end) {
+        if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset, errout))
+            return -1;
+    }
+    if (debug_line != debug_line_end) {
+        kprintf("Unexpected size of .debug_line in %s\n",
+                binary_filename);
+    }
+    return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout);
+
+static void
+append_obj(obj_info_t **objp)
+{
+    obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+    if (*objp) (*objp)->next = newobj;
+    *objp = newobj;
+}
+
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ *   - /usr/bin/ruby.debug
+ *   - /usr/bin/.debug/ruby.debug
+ *   - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
+static void
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
+                 obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t len;
+
+    p = strrchr(binary_filename, '/');
+    if (!p) {
+        return;
+    }
+    p[1] = '\0';
+
+    len = strlen(binary_filename);
+    if (len >= PATH_MAX - global_debug_dir_len)
+        len = PATH_MAX - global_debug_dir_len - 1;
+    memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    len += global_debug_dir_len;
+    strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+                          obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+    static const char debug_suffix[] = ".debug";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t i;
+
+    if (PATH_MAX < global_debug_dir_len + build_id_size * 2 + sizeof(debug_suffix)) return;
+
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    p = binary_filename + global_debug_dir_len;
+    for (i = 0; i < build_id_size; i++) {
+        static const char tbl[] = "0123456789abcdef";
+        unsigned char n = build_id[i];
+        *p++ = tbl[n / 16];
+        *p++ = tbl[n % 16];
+        if (i == 0) *p++ = '/';
+    }
+    memcpy(p, debug_suffix, sizeof(debug_suffix));
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+#endif
+
+enum
+{
+    DW_TAG_compile_unit = 0x11,
+    DW_TAG_inlined_subroutine = 0x1d,
+    DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+    DW_AT_sibling = 0x01,
+    DW_AT_location = 0x02,
+    DW_AT_name = 0x03,
+    /* Reserved 0x04 */
+    /* Reserved 0x05 */
+    /* Reserved 0x06 */
+    /* Reserved 0x07 */
+    /* Reserved 0x08 */
+    DW_AT_ordering = 0x09,
+    /* Reserved 0x0a */
+    DW_AT_byte_size = 0x0b,
+    /* Reserved 0x0c */
+    DW_AT_bit_size = 0x0d,
+    /* Reserved 0x0e */
+    /* Reserved 0x0f */
+    DW_AT_stmt_list = 0x10,
+    DW_AT_low_pc = 0x11,
+    DW_AT_high_pc = 0x12,
+    DW_AT_language = 0x13,
+    /* Reserved 0x14 */
+    DW_AT_discr = 0x15,
+    DW_AT_discr_value = 0x16,
+    DW_AT_visibility = 0x17,
+    DW_AT_import = 0x18,
+    DW_AT_string_length = 0x19,
+    DW_AT_common_reference = 0x1a,
+    DW_AT_comp_dir = 0x1b,
+    DW_AT_const_value = 0x1c,
+    DW_AT_containing_type = 0x1d,
+    DW_AT_default_value = 0x1e,
+    /* Reserved 0x1f */
+    DW_AT_inline = 0x20,
+    DW_AT_is_optional = 0x21,
+    DW_AT_lower_bound = 0x22,
+    /* Reserved 0x23 */
+    /* Reserved 0x24 */
+    DW_AT_producer = 0x25,
+    /* Reserved 0x26 */
+    DW_AT_prototyped = 0x27,
+    /* Reserved 0x28 */
+    /* Reserved 0x29 */
+    DW_AT_return_addr = 0x2a,
+    /* Reserved 0x2b */
+    DW_AT_start_scope = 0x2c,
+    /* Reserved 0x2d */
+    DW_AT_bit_stride = 0x2e,
+    DW_AT_upper_bound = 0x2f,
+    /* Reserved 0x30 */
+    DW_AT_abstract_origin = 0x31,
+    DW_AT_accessibility = 0x32,
+    DW_AT_address_class = 0x33,
+    DW_AT_artificial = 0x34,
+    DW_AT_base_types = 0x35,
+    DW_AT_calling_convention = 0x36,
+    DW_AT_count = 0x37,
+    DW_AT_data_member_location = 0x38,
+    DW_AT_decl_column = 0x39,
+    DW_AT_decl_file = 0x3a,
+    DW_AT_decl_line = 0x3b,
+    DW_AT_declaration = 0x3c,
+    DW_AT_discr_list = 0x3d,
+    DW_AT_encoding = 0x3e,
+    DW_AT_external = 0x3f,
+    DW_AT_frame_base = 0x40,
+    DW_AT_friend = 0x41,
+    DW_AT_identifier_case = 0x42,
+    /* Reserved 0x43 */
+    DW_AT_namelist_item = 0x44,
+    DW_AT_priority = 0x45,
+    DW_AT_segment = 0x46,
+    DW_AT_specification = 0x47,
+    DW_AT_static_link = 0x48,
+    DW_AT_type = 0x49,
+    DW_AT_use_location = 0x4a,
+    DW_AT_variable_parameter = 0x4b,
+    DW_AT_virtuality = 0x4c,
+    DW_AT_vtable_elem_location = 0x4d,
+    DW_AT_allocated = 0x4e,
+    DW_AT_associated = 0x4f,
+    DW_AT_data_location = 0x50,
+    DW_AT_byte_stride = 0x51,
+    DW_AT_entry_pc = 0x52,
+    DW_AT_use_UTF8 = 0x53,
+    DW_AT_extension = 0x54,
+    DW_AT_ranges = 0x55,
+    DW_AT_trampoline = 0x56,
+    DW_AT_call_column = 0x57,
+    DW_AT_call_file = 0x58,
+    DW_AT_call_line = 0x59,
+    DW_AT_description = 0x5a,
+    DW_AT_binary_scale = 0x5b,
+    DW_AT_decimal_scale = 0x5c,
+    DW_AT_small = 0x5d,
+    DW_AT_decimal_sign = 0x5e,
+    DW_AT_digit_count = 0x5f,
+    DW_AT_picture_string = 0x60,
+    DW_AT_mutable = 0x61,
+    DW_AT_threads_scaled = 0x62,
+    DW_AT_explicit = 0x63,
+    DW_AT_object_pointer = 0x64,
+    DW_AT_endianity = 0x65,
+    DW_AT_elemental = 0x66,
+    DW_AT_pure = 0x67,
+    DW_AT_recursive = 0x68,
+    DW_AT_signature = 0x69,
+    DW_AT_main_subprogram = 0x6a,
+    DW_AT_data_bit_offset = 0x6b,
+    DW_AT_const_expr = 0x6c,
+    DW_AT_enum_class = 0x6d,
+    DW_AT_linkage_name = 0x6e,
+    DW_AT_string_length_bit_size = 0x6f,
+    DW_AT_string_length_byte_size = 0x70,
+    DW_AT_rank = 0x71,
+    DW_AT_str_offsets_base = 0x72,
+    DW_AT_addr_base = 0x73,
+    DW_AT_rnglists_base = 0x74,
+    /* Reserved 0x75 */
+    DW_AT_dwo_name = 0x76,
+    DW_AT_reference = 0x77,
+    DW_AT_rvalue_reference = 0x78,
+    DW_AT_macros = 0x79,
+    DW_AT_call_all_calls = 0x7a,
+    DW_AT_call_all_source_calls = 0x7b,
+    DW_AT_call_all_tail_calls = 0x7c,
+    DW_AT_call_return_pc = 0x7d,
+    DW_AT_call_value = 0x7e,
+    DW_AT_call_origin = 0x7f,
+    DW_AT_call_parameter = 0x80,
+    DW_AT_call_pc = 0x81,
+    DW_AT_call_tail_call = 0x82,
+    DW_AT_call_target = 0x83,
+    DW_AT_call_target_clobbered = 0x84,
+    DW_AT_call_data_location = 0x85,
+    DW_AT_call_data_value = 0x86,
+    DW_AT_noreturn = 0x87,
+    DW_AT_alignment = 0x88,
+    DW_AT_export_symbols = 0x89,
+    DW_AT_deleted = 0x8a,
+    DW_AT_defaulted = 0x8b,
+    DW_AT_loclists_base = 0x8c,
+    DW_AT_lo_user = 0x2000,
+    DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+    DW_FORM_addr = 0x01,
+    /* Reserved 0x02 */
+    DW_FORM_block2 = 0x03,
+    DW_FORM_block4 = 0x04,
+    DW_FORM_data2 = 0x05,
+    DW_FORM_data4 = 0x06,
+    DW_FORM_data8 = 0x07,
+    DW_FORM_string = 0x08,
+    DW_FORM_block = 0x09,
+    DW_FORM_block1 = 0x0a,
+    DW_FORM_data1 = 0x0b,
+    DW_FORM_flag = 0x0c,
+    DW_FORM_sdata = 0x0d,
+    DW_FORM_strp = 0x0e,
+    DW_FORM_udata = 0x0f,
+    DW_FORM_ref_addr = 0x10,
+    DW_FORM_ref1 = 0x11,
+    DW_FORM_ref2 = 0x12,
+    DW_FORM_ref4 = 0x13,
+    DW_FORM_ref8 = 0x14,
+    DW_FORM_ref_udata = 0x15,
+    DW_FORM_indirect = 0x16,
+    DW_FORM_sec_offset = 0x17,
+    DW_FORM_exprloc = 0x18,
+    DW_FORM_flag_present = 0x19,
+    DW_FORM_strx = 0x1a,
+    DW_FORM_addrx = 0x1b,
+    DW_FORM_ref_sup4 = 0x1c,
+    DW_FORM_strp_sup = 0x1d,
+    DW_FORM_data16 = 0x1e,
+    DW_FORM_line_strp = 0x1f,
+    DW_FORM_ref_sig8 = 0x20,
+    DW_FORM_implicit_const = 0x21,
+    DW_FORM_loclistx = 0x22,
+    DW_FORM_rnglistx = 0x23,
+    DW_FORM_ref_sup8 = 0x24,
+    DW_FORM_strx1 = 0x25,
+    DW_FORM_strx2 = 0x26,
+    DW_FORM_strx3 = 0x27,
+    DW_FORM_strx4 = 0x28,
+    DW_FORM_addrx1 = 0x29,
+    DW_FORM_addrx2 = 0x2a,
+    DW_FORM_addrx3 = 0x2b,
+    DW_FORM_addrx4 = 0x2c,
+
+    /* GNU extensions for referring to .gnu_debugaltlink dwz-compressed info */
+    DW_FORM_GNU_ref_alt = 0x1f20,
+    DW_FORM_GNU_strp_alt = 0x1f21
+};
+
+/* Range list entry encodings */
+enum {
+    DW_RLE_end_of_list = 0x00,
+    DW_RLE_base_addressx = 0x01,
+    DW_RLE_startx_endx = 0x02,
+    DW_RLE_startx_length = 0x03,
+    DW_RLE_offset_pair = 0x04,
+    DW_RLE_base_address = 0x05,
+    DW_RLE_start_end = 0x06,
+    DW_RLE_start_length = 0x07
+};
+
+enum {
+    VAL_none = 0,
+    VAL_cstr = 1,
+    VAL_data = 2,
+    VAL_uint = 3,
+    VAL_int = 4,
+    VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+    obj_info_t *obj;
+    const char *file;
+    uint8_t current_version;
+    const char *current_cu;
+    uint64_t current_low_pc;
+    uint64_t current_str_offsets_base;
+    uint64_t current_addr_base;
+    uint64_t current_rnglists_base;
+    const char *debug_line_cu_end;
+    uint8_t debug_line_format;
+    uint16_t debug_line_version;
+    const char *debug_line_files;
+    const char *debug_line_directories;
+    const char *p;
+    const char *cu_end;
+    const char *pend;
+    const char *q0;
+    const char *q;
+    int format; // 4 or 8
+    uint8_t address_size;
+    int level;
+    const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+    ptrdiff_t pos;
+    int tag;
+    int has_children;
+} DIE;
+
+typedef struct {
+    union {
+        const char *ptr;
+        uint64_t uint64;
+        int64_t int64;
+        uint64_t addr_idx;
+    } as;
+    uint64_t off;
+    uint64_t at;
+    uint64_t form;
+    size_t size;
+    int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 1);
+    return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 2);
+    return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 3);
+    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 4);
+    return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + 8);
+    return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+    return get_uint64(p);
+#else
+    return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+    if (reader->format == 4) {
+        return read_uint32(&reader->p);
+    } else { /* 64 bit */
+        return read_uint64(&reader->p);
+    }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+    return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+    return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+    reader->file = obj->mapped;
+    reader->obj = obj;
+    reader->p = obj->debug_info.ptr;
+    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+    reader->debug_line_cu_end = obj->debug_line.ptr;
+    reader->current_low_pc = 0;
+    reader->current_str_offsets_base = 0;
+    reader->current_addr_base = 0;
+    reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+    for (;;) {
+        uint64_t at = uleb128(p);
+        uint64_t form = uleb128(p);
+        if (!at && !form) break;
+        switch (form) {
+          default:
+            break;
+          case DW_FORM_implicit_const:
+            sleb128(p);
+            break;
+        }
+    }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+    uint64_t prev = 0;
+    const char *p = reader->q0;
+    for (;;) {
+        uint64_t abbrev_number = uleb128(&p);
+        if (abbrev_number <= prev) break;
+        if (abbrev_number < ABBREV_TABLE_SIZE) {
+            reader->abbrev_table[abbrev_number] = p;
+        }
+        prev = abbrev_number;
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader, FILE *errout)
+{
+    const char *p;
+    struct LineNumberProgramHeader header;
+
+    p = (const char *)reader->debug_line_cu_end;
+    if (parse_debug_line_header(reader->obj, &p, &header, errout))
+        return -1;
+
+    reader->debug_line_cu_end = (char *)header.cu_end;
+    reader->debug_line_format = header.format;
+    reader->debug_line_version = header.version;
+    reader->debug_line_directories = (char *)header.include_directories;
+    reader->debug_line_files = (char *)header.filenames;
+
+    return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.addr_idx = n;
+    v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.uint64 = n;
+    v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+    v->as.int64 = n;
+    v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->off = 0;
+    v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+    v->as.ptr = s;
+    v->off = off;
+    v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+    if (v->as.ptr) {
+        return v->as.ptr + v->off;
+    } else {
+        return NULL;
+    }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+    uint64_t off;
+    if (reader->format == 4) {
+        off = ((uint32_t *)p)[idx];
+    }
+    else {
+        off = ((uint64_t *)p)[idx];
+    }
+    return reader->obj->debug_str.ptr + off;
+}
+
+static bool
+debug_info_reader_read_addr_value_member(DebugInfoReader *reader, DebugInfoValue *v, int size)
+{
+    if (size == 4) {
+        set_uint_value(v, read_uint32(&reader->p));
+    } else if (size == 8) {
+        set_uint_value(v, read_uint64(&reader->p));
+    } else {
+        return false;
+    }
+    return true;
+}
+
+#define debug_info_reader_read_addr_value(reader, v, mem) \
+    if (!debug_info_reader_read_addr_value_member((reader), (v), (reader)->mem)) { \
+        kprintf("unknown " #mem ":%d", (reader)->mem); \
+        return false; \
+    }
+
+
+static bool
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v, FILE *errout)
+{
+    switch (form) {
+      case DW_FORM_addr:
+        debug_info_reader_read_addr_value(reader, v, address_size);
+        break;
+      case DW_FORM_block2:
+        v->size = read_uint16(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block4:
+        v->size = read_uint32(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_data4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_data8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_string:
+        v->size = strlen(reader->p);
+        set_cstr_value(v, reader->p);
+        reader->p += v->size + 1;
+        break;
+      case DW_FORM_block:
+        v->size = uleb128(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block1:
+        v->size = read_uint8(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_flag:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_sdata:
+        set_int_value(v, read_sleb128(reader));
+        break;
+      case DW_FORM_strp:
+        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_udata:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_addr:
+        if (reader->current_version <= 2) {
+            // DWARF Version 2 specifies that references have
+            // the same size as an address on the target system
+            debug_info_reader_read_addr_value(reader, v, address_size);
+        } else {
+            debug_info_reader_read_addr_value(reader, v, format);
+        }
+        break;
+      case DW_FORM_ref1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_ref2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_ref4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_ref8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_ref_udata:
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_indirect:
+        /* TODO: read the referred value */
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_sec_offset:
+        set_uint_value(v, read_uint(reader)); /* offset */
+        /* addrptr: debug_addr */
+        /* lineptr: debug_line */
+        /* loclist: debug_loclists */
+        /* loclistptr: debug_loclists */
+        /* macptr: debug_macro */
+        /* rnglist: debug_rnglists */
+        /* rnglistptr: debug_rnglists */
+        /* stroffsetsptr: debug_str_offsets */
+        break;
+      case DW_FORM_exprloc:
+        v->size = (size_t)read_uleb128(reader);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_flag_present:
+        set_uint_value(v, 1);
+        break;
+      case DW_FORM_strx:
+        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+        break;
+      case DW_FORM_addrx:
+        set_addr_idx_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_ref_sup4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_strp_sup:
+        set_uint_value(v, read_uint(reader));
+        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+        break;
+      case DW_FORM_data16:
+        v->size = 16;
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_line_strp:
+        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_ref_sig8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_implicit_const:
+        set_int_value(v, sleb128(&reader->q));
+        break;
+      case DW_FORM_loclistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_rnglistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_sup8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_strx1:
+        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+        break;
+      case DW_FORM_strx2:
+        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+        break;
+      case DW_FORM_strx3:
+        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+        break;
+      case DW_FORM_strx4:
+        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+        break;
+      case DW_FORM_addrx1:
+        set_addr_idx_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_addrx2:
+        set_addr_idx_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_addrx3:
+        set_addr_idx_value(v, read_uint24(&reader->p));
+        break;
+      case DW_FORM_addrx4:
+        set_addr_idx_value(v, read_uint32(&reader->p));
+        break;
+      /* we have no support for actually reading the real values of these refs out
+       * of the .gnu_debugaltlink dwz-compressed debuginfo at the moment, but "read"
+       * them anyway so that we advance the reader by the right amount. */
+      case DW_FORM_GNU_ref_alt:
+      case DW_FORM_GNU_strp_alt:
+        read_uint(reader);
+        set_uint_value(v, 0);
+        break;
+      case 0:
+        goto fail;
+        break;
+    }
+    return true;
+
+  fail:
+    kprintf("%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+    return false;
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number, FILE *errout)
+{
+    const char *p;
+    if (abbrev_number < ABBREV_TABLE_SIZE) {
+        return reader->abbrev_table[abbrev_number];
+    }
+    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+    /* skip 255th record */
+    uleb128(&p); /* tag */
+    p++; /* has_children */
+    di_skip_die_attributes(&p);
+    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+        if (n == 0) {
+            kprintf("%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+            return NULL;
+        }
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+    return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n, FILE *errout)
+{
+    size_t i;
+    kprintf("     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
+    for (i=0; i < n; i++){
+        switch (i & 15) {
+          case 0:
+            kprintf("%02" PRIdSIZE ": %02X ", i/16, p[i]);
+            break;
+          case 15:
+            kprintf("%02X\n", p[i]);
+            break;
+          default:
+            kprintf("%02X ", p[i]);
+            break;
+        }
+    }
+    if ((i & 15) != 15) {
+        kprintf("\n");
+    }
+}
+#define hexdump(p,n,e) hexdump0((const unsigned char *)p, n, e)
+
+static void
+div_inspect(DebugInfoValue *v, FILE *errout)
+{
+    switch (v->type) {
+      case VAL_uint:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+        break;
+      case VAL_int:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+        break;
+      case VAL_cstr:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+        break;
+      case VAL_data:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+        hexdump(v->as.ptr, 16, errout);
+        break;
+    }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die, FILE *errout)
+{
+    uint64_t abbrev_number = uleb128(&reader->p);
+    if (abbrev_number == 0) {
+        reader->level--;
+        return NULL;
+    }
+
+    if (!(reader->q = di_find_abbrev(reader, abbrev_number, errout))) return NULL;
+
+    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+    die->tag = (int)uleb128(&reader->q); /* tag */
+    die->has_children = *reader->q++; /* has_children */
+    if (die->has_children) {
+        reader->level++;
+    }
+    return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp, FILE *errout)
+{
+    uint64_t at = uleb128(&reader->q);
+    uint64_t form = uleb128(&reader->q);
+    if (!at || !form) return NULL;
+    vp->at = at;
+    vp->form = form;
+    if (!debug_info_reader_read_value(reader, form, vp, errout)) return NULL;
+    return vp;
+}
+
+static bool
+di_skip_records(DebugInfoReader *reader, FILE *errout)
+{
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        uint64_t at = uleb128(&reader->q);
+        uint64_t form = uleb128(&reader->q);
+        if (!at || !form) return true;
+        if (!debug_info_reader_read_value(reader, form, &v, errout)) return false;
+    }
+}
+
+typedef struct addr_header {
+    const char *ptr;
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static bool
+addr_header_init(obj_info_t *obj, addr_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_addr.ptr;
+
+    header->ptr = p;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    return true;
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+    if (header->address_size == 4) {
+        return ((uint32_t*)(header->ptr + addr_base))[idx];
+    }
+    else {
+        return ((uint64_t*)(header->ptr + addr_base))[idx];
+    }
+}
+
+typedef struct rnglists_header {
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static bool
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_rnglists.ptr;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    header->offset_entry_count = *(uint32_t *)p;
+    return true;
+}
+
+typedef struct {
+    uint64_t low_pc;
+    uint64_t high_pc;
+    uint64_t ranges;
+    bool low_pc_set;
+    bool high_pc_set;
+    bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+    uint64_t n = 0;
+    if (v->type == VAL_uint) {
+        n = v->as.uint64;
+    }
+    else if (v->type == VAL_addr) {
+        n = read_addr(addr_header, addr_base, v->as.addr_idx);
+    }
+    switch (v->at) {
+      case DW_AT_low_pc:
+        ptr->low_pc = n;
+        ptr->low_pc_set = true;
+        break;
+      case DW_AT_high_pc:
+        if (v->form == DW_FORM_addr) {
+            ptr->high_pc = n;
+        }
+        else {
+            ptr->high_pc = ptr->low_pc + n;
+        }
+        ptr->high_pc_set = true;
+        break;
+      case DW_AT_ranges:
+        ptr->ranges = n;
+        ptr->ranges_set = true;
+        break;
+    }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr, FILE *errout)
+{
+    const char *p = *ptr;
+    *ptr = p + reader->address_size;
+    if (reader->address_size == 4) {
+        return read_uint32(&p);
+    } else {
+        return read_uint64(&p);
+    }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            return UINTPTR_MAX;
+        }
+        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    else if (ptr->ranges_set) {
+        /* TODO: support base address selection entry */
+        const char *p;
+        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+        bool base_valid = true;
+        if (reader->current_version >= 5) {
+            if (rnglists_header->offset_entry_count == 0) {
+                // DW_FORM_sec_offset
+                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+            }
+            else {
+                // DW_FORM_rnglistx
+                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+                if (rnglists_header->format == 4) {
+                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+                }
+                else {
+                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+                }
+            }
+            for (;;) {
+                uint8_t rle = read_uint8(&p);
+                uintptr_t from = 0, to = 0;
+                if (rle == DW_RLE_end_of_list) break;
+                switch (rle) {
+                  case DW_RLE_base_addressx:
+                    uleb128(&p);
+                    base_valid = false; /* not supported yet */
+                    break;
+                  case DW_RLE_startx_endx:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_startx_length:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_offset_pair:
+                    if (!base_valid) break;
+                    from = (uintptr_t)base + uleb128(&p);
+                    to = (uintptr_t)base + uleb128(&p);
+                    break;
+                  case DW_RLE_base_address:
+                    base = read_dw_form_addr(reader, &p, errout);
+                    base_valid = true;
+                    break;
+                  case DW_RLE_start_end:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    break;
+                  case DW_RLE_start_length:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = from + uleb128(&p);
+                    break;
+                }
+                if (from <= addr && addr < to) {
+                    return from;
+                }
+            }
+            return 0;
+        }
+        p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            if (from == UINTPTR_MAX) {
+                /* base address selection entry */
+                base = to;
+            }
+            else if (base + from <= addr && addr < base + to) {
+                return (uintptr_t)base + from;
+            }
+        }
+    }
+    else if (ptr->low_pc_set) {
+        if (ptr->low_pc == addr) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    return 0;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            kprintf("low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+            return;
+        }
+        kprintf("low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+    }
+    else if (ptr->ranges_set) {
+        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        kprintf("low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            kprintf("%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+        }
+        kprintf("\n");
+    }
+    else if (ptr->low_pc_set) {
+        kprintf("low_pc:%"PRIx64"\n",ptr->low_pc);
+    }
+    else {
+        kprintf("empty\n");
+    }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader, FILE *errout)
+{
+    uint64_t unit_length;
+    uint16_t version;
+    uint64_t debug_abbrev_offset;
+    reader->format = 4;
+    reader->current_cu = reader->p;
+    unit_length = read_uint32(&reader->p);
+    if (unit_length == 0xffffffff) {
+        unit_length = read_uint64(&reader->p);
+        reader->format = 8;
+    }
+    reader->cu_end = reader->p + unit_length;
+    version = read_uint16(&reader->p);
+    reader->current_version = version;
+    if (version > 5) {
+        return -1;
+    }
+    else if (version == 5) {
+        /* unit_type = */ read_uint8(&reader->p);
+        reader->address_size = read_uint8(&reader->p);
+        debug_abbrev_offset = read_uint(reader);
+    }
+    else {
+        debug_abbrev_offset = read_uint(reader);
+        reader->address_size = read_uint8(&reader->p);
+    }
+    if (reader->address_size != 4 && reader->address_size != 8) {
+        kprintf("unknown address_size:%d", reader->address_size);
+        return -1;
+    }
+    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+    reader->level = 0;
+    di_read_debug_abbrev_cu(reader);
+    if (di_read_debug_line_cu(reader, errout)) return -1;
+
+    do {
+        DIE die;
+
+        if (!di_read_die(reader, &die, errout)) continue;
+
+        if (die.tag != DW_TAG_compile_unit) {
+            if (!di_skip_records(reader, errout)) return -1;
+            break;
+        }
+
+        reader->current_str_offsets_base = 0;
+        reader->current_addr_base = 0;
+        reader->current_rnglists_base = 0;
+
+        DebugInfoValue low_pc = {{0}};
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            if (!di_read_record(reader, &v, errout)) break;
+            switch (v.at) {
+              case DW_AT_low_pc:
+                // clang may output DW_AT_addr_base after DW_AT_low_pc.
+                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+                low_pc = v;
+                break;
+              case DW_AT_str_offsets_base:
+                reader->current_str_offsets_base = v.as.uint64;
+                break;
+              case DW_AT_addr_base:
+                reader->current_addr_base = v.as.uint64;
+                break;
+              case DW_AT_rnglists_base:
+                reader->current_rnglists_base = v.as.uint64;
+                break;
+            }
+        }
+        // Resolve the DW_FORM_addr of DW_AT_low_pc
+        switch (low_pc.type) {
+            case VAL_uint:
+                reader->current_low_pc = low_pc.as.uint64;
+                break;
+            case VAL_addr:
+                {
+                    addr_header_t header = {0};
+                    if (!addr_header_init(reader->obj, &header, errout)) return -1;
+                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+                }
+                break;
+        }
+    } while (0);
+
+    return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line, FILE *errout)
+{
+    const char *p = reader->p;
+    const char *q = reader->q;
+    int level = reader->level;
+    DIE die;
+
+    switch (form) {
+      case DW_FORM_ref1:
+      case DW_FORM_ref2:
+      case DW_FORM_ref4:
+      case DW_FORM_ref8:
+      case DW_FORM_ref_udata:
+        reader->p = reader->current_cu + abstract_origin;
+        break;
+      case DW_FORM_ref_addr:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sig8:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sup4:
+      case DW_FORM_ref_sup8:
+        goto finish; /* not supported yet */
+      default:
+        goto finish;
+    }
+    if (!di_read_die(reader, &die, errout)) goto finish;
+
+    /* enumerate abbrev */
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        if (!di_read_record(reader, &v, errout)) break;
+        switch (v.at) {
+          case DW_AT_name:
+            line->sname = get_cstr_value(&v);
+            break;
+        }
+    }
+
+  finish:
+    reader->p = p;
+    reader->q = q;
+    reader->level = level;
+}
+
+static bool
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+                line_info_t *lines, int offset, FILE *errout)
+{
+
+    addr_header_t addr_header = {0};
+    if (!addr_header_init(reader->obj, &addr_header, errout)) return false;
+
+    rnglists_header_t rnglists_header = {0};
+    if (!rnglists_header_init(reader->obj, &rnglists_header, errout)) return false;
+
+    while (reader->p < reader->cu_end) {
+        DIE die;
+        ranges_t ranges = {0};
+        line_info_t line = {0};
+
+        if (!di_read_die(reader, &die, errout)) continue;
+        /* kprintf("%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+          skip_die:
+            if (!di_skip_records(reader, errout)) return false;
+            continue;
+        }
+
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            /* ptrdiff_t pos = reader->p - reader->p0; */
+            if (!di_read_record(reader, &v, errout)) break;
+            /* kprintf("\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+            /* div_inspect(&v, errout); */
+            switch (v.at) {
+              case DW_AT_name:
+                line.sname = get_cstr_value(&v);
+                break;
+              case DW_AT_call_file:
+                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj, errout);
+                break;
+              case DW_AT_call_line:
+                line.line = (int)v.as.uint64;
+                break;
+              case DW_AT_low_pc:
+              case DW_AT_high_pc:
+              case DW_AT_ranges:
+                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+                break;
+              case DW_AT_declaration:
+                goto skip_die;
+              case DW_AT_inline:
+                /* 1 or 3 */
+                break; /* goto skip_die; */
+              case DW_AT_abstract_origin:
+                read_abstract_origin(reader, v.form, v.as.uint64, &line, errout);
+                break; /* goto skip_die; */
+            }
+        }
+        /* ranges_inspect(reader, &ranges, errout); */
+        /* kprintf("%d:%tx: %x ",__LINE__,diepos,die.tag); */
+        for (int i=offset; i < num_traces; i++) {
+            uintptr_t addr = (uintptr_t)traces[i];
+            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header, errout);
+            if (saddr == UINTPTR_MAX) return false;
+            if (saddr) {
+                /* kprintf("%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+                if (lines[i].sname) {
+                    line_info_t *lp = malloc(sizeof(line_info_t));
+                    memcpy(lp, &lines[i], sizeof(line_info_t));
+                    lines[i].next = lp;
+                    lp->dirname = line.dirname;
+                    lp->filename = line.filename;
+                    lp->line = line.line;
+                    lp->saddr = 0;
+                }
+                lines[i].path = reader->obj->path;
+                lines[i].base_addr = line.base_addr;
+                lines[i].sname = line.sname;
+                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+            }
+        }
+    }
+    return true;
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format,
+                             obj_info_t *obj, const char **out_path,
+                             uint64_t *out_directory_index, FILE *errout)
+{
+    int i, j;
+    int entry_format_count = *(uint8_t *)p++;
+    const char *entry_format = p;
+
+    /* skip the part of entry_format */
+    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+    int entry_count = (int)uleb128(&p);
+
+    DebugInfoReader reader = {0};
+    debug_info_reader_init(&reader, obj);
+    reader.format = format;
+    reader.p = p;
+    for (j = 0; j < entry_count; j++) {
+        const char *format = entry_format;
+        for (i = 0; i < entry_format_count; i++) {
+            DebugInfoValue v = {{0}};
+            unsigned long dw_lnct = uleb128(&format);
+            unsigned long dw_form = uleb128(&format);
+            if (!debug_info_reader_read_value(&reader, dw_form, &v, errout)) return 0;
+            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+                *out_path = v.as.ptr + v.off;
+            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+                *out_directory_index = v.as.uint64;
+        }
+        if (j == idx) return 0;
+    }
+
+    return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+    *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+    unsigned long destsize = chdr->ch_size;
+    int ret = 0;
+
+    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+        /* unsupported compression type */
+        return 0;
+    }
+
+    *ptr = malloc(destsize);
+    if (!*ptr) return 0;
+    ret = uncompress((Bytef *)*ptr, &destsize,
+            (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+            shdr->sh_size - sizeof(ElfW(Chdr)));
+    if (ret != Z_OK) goto fail;
+    return destsize;
+
+fail:
+    free(*ptr);
+    *ptr = NULL;
+#endif
+    return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    int i, j;
+    char *shstr;
+    ElfW(Ehdr) *ehdr;
+    ElfW(Shdr) *shdr, *shstr_shdr;
+    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *note_gnu_build_id = NULL;
+    int fd;
+    off_t filesize;
+    char *file;
+    ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+    ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+    obj_info_t *obj = *objp;
+    uintptr_t dladdr_fbase = 0;
+
+    fd = open(binary_filename, O_RDONLY);
+    if (fd < 0) {
+        goto fail;
+    }
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    ehdr = (ElfW(Ehdr) *)file;
+    if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+        /*
+         * Huh? Maybe filename was overridden by setproctitle() and
+         * it match non-elf file.
+         */
+        goto fail;
+    }
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+    shstr_shdr = shdr + ehdr->e_shstrndx;
+    shstr = file + shstr_shdr->sh_offset;
+
+    for (i = 0; i < ehdr->e_shnum; i++) {
+        char *section_name = shstr + shdr[i].sh_name;
+        switch (shdr[i].sh_type) {
+          case SHT_STRTAB:
+            if (!strcmp(section_name, ".strtab")) {
+                strtab_shdr = shdr + i;
+            }
+            else if (!strcmp(section_name, ".dynstr")) {
+                dynstr_shdr = shdr + i;
+            }
+            break;
+          case SHT_SYMTAB:
+            /* if (!strcmp(section_name, ".symtab")) */
+            symtab_shdr = shdr + i;
+            break;
+          case SHT_DYNSYM:
+            /* if (!strcmp(section_name, ".dynsym")) */
+            dynsym_shdr = shdr + i;
+            break;
+          case SHT_NOTE:
+            if (!strcmp(section_name, ".note.gnu.build-id")) {
+                note_gnu_build_id = shdr + i;
+            }
+            break;
+          case SHT_PROGBITS:
+            if (!strcmp(section_name, ".gnu_debuglink")) {
+                gnu_debuglink_shdr = shdr + i;
+            }
+            else {
+                const char *debug_section_names[] = {
+                    ".debug_abbrev",
+                    ".debug_info",
+                    ".debug_line",
+                    ".debug_ranges",
+                    ".debug_str_offsets",
+                    ".debug_addr",
+                    ".debug_rnglists",
+                    ".debug_str",
+                    ".debug_line_str"
+                };
+
+                for (j=0; j < DWARF_SECTION_COUNT; j++) {
+                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                    if (strcmp(section_name, debug_section_names[j]) != 0)
+                        continue;
+
+                    s->ptr = file + shdr[i].sh_offset;
+                    s->size = shdr[i].sh_size;
+                    s->flags = shdr[i].sh_flags;
+                    if (s->flags & SHF_COMPRESSED) {
+                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+                        if (!s->size) goto fail;
+                    }
+                    break;
+                }
+            }
+            break;
+        }
+    }
+
+    if (offset == 0) {
+        /* main executable */
+        if (dynsym_shdr && dynstr_shdr) {
+            char *strtab = file + dynstr_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+            int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+            if (handle) {
+                for (j = 0; j < symtab_count; j++) {
+                    ElfW(Sym) *sym = &symtab[j];
+                    Dl_info info;
+                    void *s;
+                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+                    s = dlsym(handle, strtab + sym->st_name);
+                    if (s && dladdr(s, &info)) {
+                        obj->base_addr = dladdr_fbase;
+                        dladdr_fbase = (uintptr_t)info.dli_fbase;
+                        break;
+                    }
+                }
+                dlclose(handle);
+            }
+            if (ehdr->e_type == ET_EXEC) {
+                obj->base_addr = 0;
+            }
+            else {
+                /* PIE (position-independent executable) */
+                obj->base_addr = dladdr_fbase;
+            }
+        }
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        i = 0;
+        while (reader.p < reader.pend) {
+            /* kprintf("%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+            if (di_read_cu(&reader, errout)) goto use_symtab;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto use_symtab;
+        }
+    }
+    else {
+        /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+        if (!symtab_shdr) {
+            /* This file doesn't have symtab, use dynsym instead */
+            symtab_shdr = dynsym_shdr;
+            strtab_shdr = dynstr_shdr;
+        }
+
+        if (symtab_shdr && strtab_shdr) {
+            char *strtab = file + strtab_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+            for (j = 0; j < symtab_count; j++) {
+                ElfW(Sym) *sym = &symtab[j];
+                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+                for (i = offset; i < num_traces; i++) {
+                    uintptr_t d = (uintptr_t)traces[i] - saddr;
+                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+                        continue;
+                    /* fill symbol name and addr from .symtab */
+                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+                    lines[i].saddr = saddr;
+                    lines[i].path  = obj->path;
+                    lines[i].base_addr = obj->base_addr;
+                }
+            }
+        }
+    }
+
+    if (!obj->debug_line.ptr) {
+        /* This file doesn't have .debug_line section,
+           let's check .gnu_debuglink section instead. */
+        if (gnu_debuglink_shdr && check_debuglink) {
+            follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+                             num_traces, traces,
+                             objp, lines, offset, errout);
+        }
+        if (note_gnu_build_id && check_debuglink) {
+            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+            follow_debuglink_build_id(build_id, nhdr->n_descsz,
+                               num_traces, traces,
+                               objp, lines, offset, errout);
+        }
+        goto finish;
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
+finish:
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+        obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+# ifdef __LP64__
+#  define LP(x) x##_64
+# else
+#  define LP(x) x
+# endif
+    int fd;
+    off_t filesize;
+    char *file, *p = NULL;
+    obj_info_t *obj = *objp;
+    struct LP(mach_header) *header;
+    uintptr_t dladdr_fbase = 0;
+
+    {
+        char *s = binary_filename;
+        char *base = strrchr(binary_filename, '/')+1;
+        size_t max = PATH_MAX;
+        size_t size = strlen(binary_filename);
+        size_t basesize = size - (base - binary_filename);
+        s += size;
+        max -= size;
+        p = s;
+        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+        if (size == 0) goto fail;
+        s += size;
+        max -= size;
+        if (max <= basesize) goto fail;
+        memcpy(s, base, basesize);
+        s[basesize] = 0;
+
+        fd = open(binary_filename, O_RDONLY);
+        if (fd < 0) {
+            *p = 0; /* binary_filename becomes original file name */
+            fd = open(binary_filename, O_RDONLY);
+            if (fd < 0) {
+                goto fail;
+            }
+        }
+    }
+
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    header = (struct LP(mach_header) *)file;
+    if (header->magic == LP(MH_MAGIC)) {
+        /* non universal binary */
+        p = file;
+    }
+    else if (header->magic == FAT_CIGAM) {
+        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+        struct fat_header *fat = (struct fat_header *)file;
+        char *q = file + sizeof(*fat);
+        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+        /* kprintf("%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+        for (uint32_t i = 0; i < nfat_arch; i++) {
+            struct fat_arch *arch = (struct fat_arch *)q;
+            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+            uint32_t offset = __builtin_bswap32(arch->offset);
+            /* kprintf("%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+            if (mhp->cputype == cputype &&
+                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+                p = file + offset;
+                file = p;
+                header = (struct LP(mach_header) *)p;
+                if (header->magic == LP(MH_MAGIC)) {
+                    goto found_mach_header;
+                }
+                break;
+            }
+            q += sizeof(*arch);
+        }
+        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+        close(fd);
+        goto fail;
+    }
+    else {
+# ifdef __LP64__
+#   define bitsize "64"
+# else
+#   define bitsize "32"
+# endif
+        kprintf("'%s' is not a " bitsize
+                "-bit Mach-O file!\n",binary_filename);
+# undef bitsize
+        close(fd);
+        goto fail;
+    }
+found_mach_header:
+    p += sizeof(*header);
+
+    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+        struct load_command *lcmd = (struct load_command *)p;
+        switch (lcmd->cmd) {
+          case LP(LC_SEGMENT):
+            {
+                static const char *debug_section_names[] = {
+                    "__debug_abbrev",
+                    "__debug_info",
+                    "__debug_line",
+                    "__debug_ranges",
+                    "__debug_str_offsets",
+                    "__debug_addr",
+                    "__debug_rnglists",
+                    "__debug_str",
+                    "__debug_line_str",
+                };
+                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+                if (strcmp(scmd->segname, "__TEXT") == 0) {
+                    obj->vmaddr = scmd->vmaddr;
+                }
+                else if (strcmp(scmd->segname, "__DWARF") == 0) {
+                    p += sizeof(struct LP(segment_command));
+                    for (uint64_t i = 0; i < scmd->nsects; i++) {
+                        struct LP(section) *sect = (struct LP(section) *)p;
+                        p += sizeof(struct LP(section));
+                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                            if (strcmp(sect->sectname, debug_section_names[j]) != 0
+#ifdef __APPLE__
+                                    /* macOS clang 16 generates DWARF5, which have Mach-O
+                                     * section names that are limited to 16 characters,
+                                     * which causes sections with long names to be truncated
+                                     * and not match above.
+                                     * See: https://wiki.dwarfstd.org/Best_Practices.md#Mach-2d-O
+                                     */
+                                    && strncmp(sect->sectname, debug_section_names[j], 16) != 0
+#endif
+                                )
+                                continue;
+
+                            s->ptr = file + sect->offset;
+                            s->size = sect->size;
+                            s->flags = sect->flags;
+                            if (s->flags & SHF_COMPRESSED) {
+                                goto fail;
+                            }
+                            break;
+                        }
+                    }
+                }
+            }
+            break;
+
+          case LC_SYMTAB:
+            {
+                struct symtab_command *cmd = (struct symtab_command *)lcmd;
+                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+                char *strtab = file + cmd->stroff, *sname = 0;
+                uint32_t j;
+                uintptr_t saddr = 0;
+                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+                for (j = 0; j < cmd->nsyms; j++) {
+                    uintptr_t symsize, d;
+                    struct LP(nlist) *e = &nl[j];
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                    if (e->n_type != N_FUN) continue;
+                    if (e->n_sect) {
+                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+                        sname = strtab + e->n_un.n_strx;
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                        continue;
+                    }
+                    for (int k = offset; k < num_traces; k++) {
+                        d = (uintptr_t)traces[k] - saddr;
+                        symsize = e->n_value;
+                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
+                            continue;
+                        /* fill symbol name and addr from .symtab */
+                        if (!lines[k].sname) lines[k].sname = sname;
+                        lines[k].saddr = saddr;
+                        lines[k].path  = obj->path;
+                        lines[k].base_addr = obj->base_addr;
+                    }
+                }
+            }
+        }
+        p += lcmd->cmdsize;
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        while (reader.p < reader.pend) {
+            if (di_read_cu(&reader, errout)) goto fail;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto fail;
+        }
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#endif
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__) || defined(__DragonFly__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(FILE *errout)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+# if defined(__linux__)
+#  define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+#  define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
+    ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    if (len < 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+    int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+    size_t len = PATH_MAX;
+    int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+    if (err) {
+        kprintf("Can't get the path of ruby");
+        return -1;
+    }
+    len--; /* sysctl sets strlen+1 */
+    return len;
+}
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+    if (len == 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+static void
+print_line0(line_info_t *line, void *address, FILE *errout)
+{
+    uintptr_t addr = (uintptr_t)address;
+    uintptr_t d = addr - line->saddr;
+    if (!address) {
+        /* inlined */
+        if (line->dirname && line->dirname[0]) {
+            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+        }
+        else {
+            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+        }
+    }
+    else if (!line->path) {
+        kprintf("[0x%"PRIxPTR"]\n", addr);
+    }
+    else if (!line->sname) {
+        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+    }
+    else if (!line->saddr) {
+        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+    }
+    else if (line->line <= 0) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+                d, addr);
+    }
+    else if (!line->filename) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+                d, addr, line->line);
+    }
+    else if (line->dirname && line->dirname[0]) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+                d, addr, line->dirname, line->filename, line->line);
+    }
+    else {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+                d, addr, line->filename, line->line);
+    }
+}
+
+static void
+print_line(line_info_t *line, void *address, FILE *errout)
+{
+    print_line0(line, address, errout);
+    if (line->next) {
+        print_line(line->next, NULL, errout);
+    }
+}
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
+{
+    int i;
+    /* async-signal unsafe */
+    line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+    obj_info_t *obj = NULL;
+    /* 2 is NULL + main executable */
+    void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
+#ifdef HAVE_MAIN_EXE_PATH
+    char *main_path = NULL; /* used on printing backtrace */
+    ssize_t len;
+    if ((len = main_exe_path(errout)) > 0) {
+        main_path = (char *)alloca(len + 1);
+        if (main_path) {
+            uintptr_t addr;
+            memcpy(main_path, binary_filename, len+1);
+            append_obj(&obj);
+            obj->path = main_path;
+            addr = fill_lines(num_traces, traces, 1, &obj, lines, 0, errout);
+            if (addr != (uintptr_t)-1) {
+                dladdr_fbases[0] = (void *)addr;
+            }
+        }
+    }
+#endif
+
+    /* fill source lines by reading dwarf */
+    for (i = 0; i < num_traces; i++) {
+        Dl_info info;
+        if (lines[i].line) continue;
+        if (dladdr(traces[i], &info)) {
+            const char *path;
+            void **p;
+
+            /* skip symbols which is in already checked objects */
+            /* if the binary is strip-ed, this may effect */
+            for (p=dladdr_fbases; *p; p++) {
+                if (*p == info.dli_fbase) {
+                    if (info.dli_fname) lines[i].path = info.dli_fname;
+                    if (info.dli_sname) lines[i].sname = info.dli_sname;
+                    goto next_line;
+                }
+            }
+            *p = info.dli_fbase;
+
+            append_obj(&obj);
+            obj->base_addr = (uintptr_t)info.dli_fbase;
+            path = info.dli_fname;
+            obj->path = path;
+            if (path) lines[i].path = path;
+            if (info.dli_sname) {
+                lines[i].sname = info.dli_sname;
+                lines[i].saddr = (uintptr_t)info.dli_saddr;
+            }
+            strlcpy(binary_filename, path, PATH_MAX);
+            if (fill_lines(num_traces, traces, 1, &obj, lines, i, errout) == (uintptr_t)-1)
+                break;
+        }
+next_line:
+        continue;
+    }
+
+    /* output */
+    for (i = 0; i < num_traces; i++) {
+        print_line(&lines[i], traces[i], errout);
+
+        /* FreeBSD's backtrace may show _start and so on */
+        if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
+            break;
+    }
+
+    /* free */
+    while (obj) {
+        obj_info_t *o = obj;
+        for (i=0; i < DWARF_SECTION_COUNT; i++) {
+            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+            if (s->flags & SHF_COMPRESSED) {
+                free(s->ptr);
+            }
+        }
+        if (obj->mapped_size) {
+            munmap(obj->mapped, obj->mapped_size);
+        }
+        obj = o->next;
+        free(o);
+    }
+    for (i = 0; i < num_traces; i++) {
+        line_info_t *line = lines[i].next;
+        while (line) {
+            line_info_t *l = line;
+            line = line->next;
+            free(l);
+        }
+    }
+    free(lines);
+    free(dladdr_fbases);
+}
+
+#undef kprintf
+
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..ff8e476b92
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,22 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
+
+#include <stdio.h>
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 957a11f9f6..6720406d89 100644
--- a/array.c
+++ b/array.c
@@ -3,167 +3,762 @@
   array.c -
 
   $Author$
-  $Date$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-2003 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
   Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
   Copyright (C) 2000  Information-technology Promotion Agency, Japan
 
 **********************************************************************/
 
-#include "ruby.h"
-#include "util.h"
-#include "st.h"
+#include "debug_counter.h"
+#include "id.h"
+#include "internal.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
+#include "probes.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby/ractor.h"
+#include "shape.h"
+#include "vm_core.h"
+#include "builtin.h"
+
+#if !ARRAY_DEBUG
+# undef NDEBUG
+# define NDEBUG
+#endif
+#include "ruby_assert.h"
 
-VALUE rb_cArray, rb_cValues;
+VALUE rb_cArray;
+VALUE rb_cArray_empty_frozen;
 
-static ID id_cmp;
+/* Flags of RArray
+ *
+ * 0:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ *          The array is shared. The buffer this array points to is owned by
+ *          another array (the shared root).
+ * 1:   RARRAY_EMBED_FLAG
+ *          The array is embedded (its contents follow the header, rather than
+ *          being on a separately allocated buffer).
+ * 3-9: RARRAY_EMBED_LEN
+ *          The length of the array when RARRAY_EMBED_FLAG is set.
+ * 12:  RARRAY_SHARED_ROOT_FLAG
+ *          The array is a shared root that does reference counting. The buffer
+ *          this array points to is owned by this array but may be pointed to
+ *          by other arrays.
+ *          Note: Frozen arrays may be a shared root without this flag being
+ *                set. Frozen arrays do not have reference counting because
+ *                they cannot be modified. Not updating the reference count
+ *                improves copy-on-write performance. Their reference count is
+ *                assumed to be infinity.
+ * 14:  RARRAY_PTR_IN_USE_FLAG
+ *          The buffer of the array is in use. This is only used during
+ *          debugging.
+ */
+
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
 
 #define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
+
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+    return RB_TYPE_P(ary, T_ARRAY);
+}
+
+#define ARY_HEAP_PTR(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(!ARY_SHARED_ROOT_P(a)), \
+                          RARRAY(a)->as.heap.aux.capa)
+
+#define ARY_EMBED_PTR(a) (RUBY_ASSERT(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+    (RUBY_ASSERT(ARY_EMBED_P(a)), \
+     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (RUBY_ASSERT(should_be_T_ARRAY((VALUE)(a))), \
+                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
+
+#define FL_SET_EMBED(a) do { \
+    RUBY_ASSERT(!ARY_SHARED_P(a)); \
+    FL_SET((a), RARRAY_EMBED_FLAG); \
+    ary_verify(a); \
+} while (0)
+
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_FLAG); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
+
+#define ARY_SET_PTR_FORCE(ary, p) \
+    (RARRAY(ary)->as.heap.ptr = (p))
+#define ARY_SET_PTR(ary, p) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_PTR_FORCE(ary, p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+    long tmp_n = (n); \
+    RUBY_ASSERT(ARY_EMBED_P(ary)); \
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), (n)); \
+    } \
+    else { \
+        ARY_SET_HEAP_LEN((ary), (n)); \
+    } \
+    RUBY_ASSERT(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do  { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do  { \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+    } \
+    else { \
+        RARRAY(ary)->as.heap.len += (n); \
+    } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_SET_CAPA_FORCE(ary, n) \
+    RARRAY(ary)->as.heap.aux.capa = (n);
+#define ARY_SET_CAPA(ary, n) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!ARY_SHARED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_CAPA_FORCE(ary, n); \
+} while (0)
+
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT((value) >= 0); \
+    RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+    RUBY_ASSERT(!ARY_SHARED_P(a));
+    RUBY_ASSERT(!OBJ_FROZEN(a));
+
+    RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+static long
+ary_embed_capa(VALUE ary)
+{
+    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+    RUBY_ASSERT(size % sizeof(VALUE) == 0);
+    return size / sizeof(VALUE);
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+    size_t size = offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+    if (size < sizeof(struct RArray)) size = sizeof(struct RArray);
+    return size;
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+    return rb_gc_size_allocatable_p(ary_embed_size(capa));
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+    /* An array cannot be turned embeddable when the array is:
+     *  - Shared root: other objects may point to the buffer of this array
+     *    so we cannot make it embedded.
+     *  - Frozen: this array may also be a shared root without the shared root
+     *    flag.
+     *  - Shared: we don't want to re-embed an array that points to a shared
+     *    root (to save memory).
+     */
+    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+    size_t real_size;
+
+    if (ARY_EMBED_P(ary)) {
+        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+    }
+    else if (rb_ary_embeddable_p(ary)) {
+        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+    }
+    else {
+        real_size = sizeof(struct RArray);
+    }
+    return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
 
+    if (ARY_SHARED_P(ary)) {
+        VALUE root = ARY_SHARED_ROOT(ary);
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        const VALUE *root_ptr = RARRAY_CONST_PTR(root);
+        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+        RUBY_ASSERT(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+        RUBY_ASSERT(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+        ary_verify(root);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        RUBY_ASSERT(!ARY_SHARED_P(ary));
+        RUBY_ASSERT(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+    }
+    else {
+        const VALUE *ptr = RARRAY_CONST_PTR(ary);
+        long i, len = RARRAY_LEN(ary);
+        volatile VALUE v;
+        if (len > 1) len = 1; /* check only HEAD */
+        for (i=0; i<len; i++) {
+            v = ptr[i]; /* access check */
+        }
+        v = v;
+    }
+
+    return ary;
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+    return (VALUE *)RARRAY_CONST_PTR(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
 
 void
-rb_mem_clear(mem, size)
-    register VALUE *mem;
-    register long size;
+rb_mem_clear(VALUE *mem, long size)
 {
     while (size--) {
-	*mem++ = Qnil;
+        *mem++ = Qnil;
     }
 }
 
+static void
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+        rb_mem_clear(ptr + beg, size);
+    });
+}
+
 static inline void
-memfill(mem, size, val)
-    register VALUE *mem;
-    register long size;
-    register VALUE val;
+memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
-	*mem++ = val;
+        *mem++ = val;
+    }
+}
+
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+        memfill(ptr + beg, size, val);
+        RB_OBJ_WRITTEN(ary, Qundef, val);
+    });
+}
+
+static void
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
+{
+    RUBY_ASSERT(!ARY_SHARED_P(buff_owner_ary));
+
+    if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+        rb_gc_writebarrier_remember(buff_owner_ary);
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMCPY(ptr+beg, argv, VALUE, argc);
+        });
+    }
+    else {
+        int i;
+        RARRAY_PTR_USE(ary, ptr, {
+            for (i=0; i<argc; i++) {
+                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+            }
+        });
+    }
+}
+
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+    ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static VALUE *
+ary_heap_alloc_buffer(size_t capa)
+{
+    return ALLOC_N(VALUE, capa);
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+    ruby_xfree_sized((void *)ptr, size);
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+    ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, ARY_HEAP_CAPA(ary));
+    ary_verify(ary);
+
+    return new_capa;
+}
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+    RUBY_ASSERT(rb_ary_embeddable_p(ary));
+    if (!ARY_EMBED_P(ary)) {
+        const VALUE *buf = ARY_HEAP_PTR(ary);
+        long len = ARY_HEAP_LEN(ary);
+        long capa = ARY_HEAP_CAPA(ary);
+
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, len);
+
+        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+        ary_heap_free_ptr(ary, buf, capa * sizeof(VALUE));
     }
 }
 
-#define ARY_TMPLOCK  FL_USER1
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+    RUBY_ASSERT(RARRAY_LEN(ary) <= capacity);
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+
+    if (capacity > ary_embed_capa(ary)) {
+        size_t new_capa = capacity;
+        if (ARY_EMBED_P(ary)) {
+            long len = ARY_EMBED_LEN(ary);
+            VALUE *ptr = ary_heap_alloc_buffer(capacity);
+
+            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+            FL_UNSET_EMBED(ary);
+            ARY_SET_PTR(ary, ptr);
+            ARY_SET_HEAP_LEN(ary, len);
+        }
+        else {
+            new_capa = ary_heap_realloc(ary, capacity);
+        }
+        ARY_SET_CAPA(ary, new_capa);
+    }
+    else {
+        if (!ARY_EMBED_P(ary)) {
+            long len = ARY_HEAP_LEN(ary);
+            long old_capa = ARY_HEAP_CAPA(ary);
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
+
+            if (len > capacity) len = capacity;
+            MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            ary_heap_free_ptr(ary, ptr, old_capa * sizeof(VALUE));
+
+            FL_SET_EMBED(ary);
+            ARY_SET_LEN(ary, len);
+        }
+    }
+
+    ary_verify(ary);
+}
 
 static inline void
-rb_ary_modify_check(ary)
-    VALUE ary;
+ary_shrink_capa(VALUE ary)
 {
-    if (OBJ_FROZEN(ary)) rb_error_frozen("array");
-    if (FL_TEST(ary, ARY_TMPLOCK))
-	rb_raise(rb_eRuntimeError, "can't modify array during iteration");
-    if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
-	rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+    long capacity = ARY_HEAP_LEN(ary);
+    long old_capa = ARY_HEAP_CAPA(ary);
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    RUBY_ASSERT(old_capa >= capacity);
+    if (old_capa > capacity) {
+        size_t new_capa = ary_heap_realloc(ary, capacity);
+        ARY_SET_CAPA(ary, new_capa);
+    }
+
+    ary_verify(ary);
 }
 
 static void
-rb_ary_modify(ary)
-    VALUE ary;
+ary_double_capa(VALUE ary, long min)
 {
-    VALUE *ptr;
+    long new_capa = ARY_CAPA(ary) / 2;
 
-    rb_ary_modify_check(ary);
-    if (FL_TEST(ary, ELTS_SHARED)) {
-	ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
-	FL_UNSET(ary, ELTS_SHARED);
-	RARRAY(ary)->aux.capa = RARRAY(ary)->len;
-	MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-	RARRAY(ary)->ptr = ptr;
+    if (new_capa < ARY_DEFAULT_SIZE) {
+        new_capa = ARY_DEFAULT_SIZE;
     }
+    if (new_capa >= ARY_MAX_SIZE - min) {
+        new_capa = (ARY_MAX_SIZE - min) / 2;
+    }
+    new_capa += min;
+    ary_resize_capa(ary, new_capa);
+
+    ary_verify(ary);
 }
 
-VALUE
-rb_ary_freeze(ary)
-    VALUE ary;
+static void
+rb_ary_decrement_share(VALUE shared_root)
 {
-    return rb_obj_freeze(ary);
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
+    }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+    VALUE shared_root = ARY_SHARED_ROOT(ary);
+    rb_ary_decrement_share(shared_root);
+    FL_UNSET_SHARED(ary);
+}
+
+static void
+rb_ary_reset(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+        ary_heap_free(ary);
+    }
+    else if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+    }
+
+    FL_SET_EMBED(ary);
+    ARY_SET_EMBED_LEN(ary, 0);
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared_root)
+{
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        RUBY_ASSERT(num >= 0);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
+    }
+    return shared_root;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
+{
+    RUBY_ASSERT(!ARY_EMBED_P(ary));
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(shared_root) || OBJ_FROZEN(shared_root));
+
+    rb_ary_increment_share(shared_root);
+    FL_SET_SHARED(ary);
+    RB_OBJ_WRITE(ary, &RARRAY(ary)->as.heap.aux.shared_root, shared_root);
+
+    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
+    rb_check_frozen(ary);
+    ary_verify(ary);
+}
+
+void
+rb_ary_cancel_sharing(VALUE ary)
+{
+    if (ARY_SHARED_P(ary)) {
+        long shared_len, len = RARRAY_LEN(ary);
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+        ary_verify(shared_root);
+
+        if (len <= ary_embed_capa(ary)) {
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
+            FL_UNSET_SHARED(ary);
+            FL_SET_EMBED(ary);
+            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared_root);
+            ARY_SET_EMBED_LEN(ary, len);
+        }
+        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+            long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared_root);
+            FL_UNSET_SHARED(ary);
+            ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared_root));
+            ARY_SET_CAPA(ary, shared_len);
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr+shift, VALUE, len);
+            });
+            FL_SET_EMBED(shared_root);
+            rb_ary_decrement_share(shared_root);
+        }
+        else {
+            VALUE *ptr = ary_heap_alloc_buffer(len);
+            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
+            rb_ary_unshare(ary);
+            ARY_SET_CAPA_FORCE(ary, len);
+            ARY_SET_PTR_FORCE(ary, ptr);
+        }
+
+        rb_gc_writebarrier_remember(ary);
+    }
+    ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    rb_ary_cancel_sharing(ary);
+}
+
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
+{
+    long old_len = RARRAY_LEN(ary);
+    long new_len = old_len + add_len;
+    long capa;
+
+    if (old_len > ARY_MAX_SIZE - add_len) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    if (ARY_SHARED_P(ary)) {
+        if (new_len > ary_embed_capa(ary)) {
+            VALUE shared_root = ARY_SHARED_ROOT(ary);
+            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+                    rb_ary_modify_check(ary);
+
+                    ary_verify(ary);
+                    ary_verify(shared_root);
+                    return shared_root;
+                }
+                else {
+                    /* if array is shared, then it is likely it participate in push/shift pattern */
+                    rb_ary_modify(ary);
+                    capa = ARY_CAPA(ary);
+                    if (new_len > capa - (capa >> 6)) {
+                        ary_double_capa(ary, new_len);
+                    }
+                    ary_verify(ary);
+                    return ary;
+                }
+            }
+        }
+        ary_verify(ary);
+        rb_ary_modify(ary);
+    }
+    else {
+        rb_ary_modify_check(ary);
+    }
+    capa = ARY_CAPA(ary);
+    if (new_len > capa) {
+        ary_double_capa(ary, new_len);
+    }
+
+    ary_verify(ary);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     array.frozen?  -> true or false
+ *    freeze -> self
+ *
+ *  Freezes +self+ (if not already frozen); returns +self+:
+ *
+ *    a = []
+ *    a.frozen? # => false
+ *    a.freeze
+ *    a.frozen? # => true
  *
- *  Return <code>true</code> if this array is frozen (or temporarily frozen
- *  while being sorted).
+ *  No further changes may be made to +self+;
+ *  raises FrozenError if a change is attempted.
+ *
+ *  Related: Kernel#frozen?.
  */
 
-static VALUE
-rb_ary_frozen_p(ary)
-    VALUE ary;
+VALUE
+rb_ary_freeze(VALUE ary)
+{
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
+
+    if (OBJ_FROZEN(ary)) return ary;
+
+    if (!ARY_EMBED_P(ary) && !ARY_SHARED_P(ary) && !ARY_SHARED_ROOT_P(ary)) {
+        ary_shrink_capa(ary);
+    }
+
+    return rb_obj_freeze(ary);
+}
+
+/* This can be used to take a snapshot of an array (with
+   e.g. rb_ary_replace) and check later whether the array has been
+   modified from the snapshot.  The snapshot is cheap, though if
+   something does modify the array it will pay the cost of copying
+   it.  If Array#pop or Array#shift has been called, the array will
+   be still shared with the snapshot, but the array length will
+   differ. */
+VALUE
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
-    if (OBJ_FROZEN(ary)) return Qtrue;
-    if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
+    if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+        return Qtrue;
+    }
     return Qfalse;
 }
 
-static VALUE ary_alloc(VALUE);
 static VALUE
-ary_alloc(klass)
-    VALUE klass;
+ary_alloc_embed(VALUE klass, long capa)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, klass, T_ARRAY);
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+   /* Created array is:
+    *   FL_SET_EMBED((VALUE)ary);
+    *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+    */
+    return rb_newobj_of(klass, T_ARRAY | RARRAY_EMBED_FLAG, size);
+}
 
-    ary->len = 0;
-    ary->ptr = 0;
-    ary->aux.capa = 0;
+static VALUE
+ary_alloc_heap(VALUE klass)
+{
+    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY, sizeof(struct RArray));
+
+    ary->as.heap.len = 0;
+    ary->as.heap.aux.capa = 0;
+    ary->as.heap.ptr = NULL;
 
     return (VALUE)ary;
 }
 
 static VALUE
-ary_new(klass, len)
-    VALUE klass;
-    long len;
+empty_ary_alloc(VALUE klass)
+{
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+    return ary_alloc_embed(klass, 0);
+}
+
+static VALUE
+ary_new(VALUE klass, long capa)
 {
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
     VALUE ary;
 
-    if (len < 0) {
-	rb_raise(rb_eArgError, "negative array size (or size too big)");
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ary_alloc_embed(klass, capa);
     }
-    if (len > 0 && len * sizeof(VALUE) <= len) {
-	rb_raise(rb_eArgError, "array size too big");
+    else {
+        ary = ary_alloc_heap(klass);
+        ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
+        ARY_SET_HEAP_LEN(ary, 0);
     }
-    if (len == 0) len++;
-    
-    ary = ary_alloc(klass);
-    RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
-    RARRAY(ary)->aux.capa = len;
 
     return ary;
 }
 
 VALUE
-rb_ary_new2(len)
-    long len;
+rb_ary_new_capa(long capa)
 {
-    return ary_new(rb_cArray, len);
+    return ary_new(rb_cArray, capa);
 }
 
-
 VALUE
-rb_ary_new()
+rb_ary_new(void)
 {
-    return rb_ary_new2(ARY_DEFAULT_SIZE);
+    return rb_ary_new_capa(0);
 }
 
-#ifdef HAVE_STDARG_PROTOTYPES
-#include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
-
 VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
-rb_ary_new3(long n, ...)
-#else
-rb_ary_new3(n, va_alist)
-    long n;
-    va_dcl
-#endif
+(rb_ary_new_from_args)(long n, ...)
 {
     va_list ar;
     VALUE ary;
@@ -171,781 +766,1289 @@ rb_ary_new3(n, va_alist)
 
     ary = rb_ary_new2(n);
 
-    va_init_list(ar, n);
+    va_start(ar, n);
     for (i=0; i<n; i++) {
-	RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+        ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
-    RARRAY(ary)->len = n;
+    ARY_SET_LEN(ary, n);
     return ary;
 }
 
 VALUE
-rb_ary_new4(n, elts)
-    long n;
-    const VALUE *elts;
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
 {
     VALUE ary;
 
-    ary = rb_ary_new2(n);
+    ary = ary_new(klass, n);
     if (n > 0 && elts) {
-	MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
     }
-    RARRAY(ary)->len = n;
 
     return ary;
 }
 
 VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
-rb_values_new(long n, ...)
-#else
-rb_values_new(n, va_alist)
-    long n;
-    va_dcl
-#endif
+rb_ary_new_from_values(long n, const VALUE *elts)
 {
-    va_list ar;
-    VALUE val;
-    long i;
+    return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
 
-    val = ary_new(rb_cValues, n);
-    va_init_list(ar, n);
-    for (i=0; i<n; i++) {
-	RARRAY(val)->ptr[i] = va_arg(ar, VALUE);
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+   /* Created array is:
+    *   FL_SET_EMBED((VALUE)ary);
+    *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+    */
+    return rb_ec_newobj_of(ec, klass, T_ARRAY | RARRAY_EMBED_FLAG, size);
+}
+
+static VALUE
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
+{
+    VALUE ary = rb_ec_newobj_of(ec, klass, T_ARRAY, sizeof(struct RArray));
+    RARRAY(ary)->as.heap.len = 0;
+    RARRAY(ary)->as.heap.aux.capa = 0;
+    RARRAY(ary)->as.heap.ptr = NULL;
+    return ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    VALUE ary;
+
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
     }
-    va_end(ar);
-    RARRAY(val)->len = n;
 
-    return val;
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ec_ary_alloc_embed(ec, klass, capa);
+    }
+    else {
+        ary = ec_ary_alloc_heap(ec, klass);
+        ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
+
+    return ary;
 }
 
 VALUE
-rb_values_new2(n, elts)
-    long n;
-    const VALUE *elts;
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
 {
-    VALUE val;
+    VALUE ary;
 
-    val = ary_new(rb_cValues, n);
+    ary = ec_ary_new(ec, rb_cArray, n);
     if (n > 0 && elts) {
-	RARRAY(val)->len = n;
-	MEMCPY(RARRAY(val)->ptr, elts, VALUE, n);
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
     }
 
-    return val;
+    return ary;
+}
+
+VALUE
+rb_ary_hidden_new(long capa)
+{
+    VALUE ary = ary_new(0, capa);
+    return ary;
+}
+
+VALUE
+rb_ary_hidden_new_fill(long capa)
+{
+    VALUE ary = rb_ary_hidden_new(capa);
+    ary_memfill(ary, 0, capa, Qnil);
+    ARY_SET_LEN(ary, capa);
+    return ary;
+}
+
+void
+rb_ary_free(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+        if (USE_DEBUG_COUNTER &&
+            !ARY_SHARED_ROOT_P(ary) &&
+            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+        }
+
+        RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+        ary_heap_free(ary);
+    }
+    else {
+        RB_DEBUG_COUNTER_INC(obj_ary_embed);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared);
+    }
+    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+    }
 }
 
+static VALUE fake_ary_flags;
+
 static VALUE
-ary_make_shared(ary)
-    VALUE ary;
+init_fake_ary_flags(void)
+{
+    struct RArray fake_ary = {0};
+    fake_ary.basic.flags = T_ARRAY;
+    VALUE ary = (VALUE)&fake_ary;
+    RBASIC_SET_SHAPE_ID(ary, ROOT_SHAPE_ID | SHAPE_ID_LAYOUT_OTHER);
+    rb_ary_freeze(ary);
+    return fake_ary.basic.flags;
+}
+
+VALUE
+rb_setup_fake_ary(struct RArray *fake_ary, const VALUE *list, long len)
 {
-    if (!FL_TEST(ary, ELTS_SHARED)) {
-	NEWOBJ(shared, struct RArray);
-	OBJSETUP(shared, rb_cArray, T_ARRAY);
+    fake_ary->basic.flags = fake_ary_flags;
+    RBASIC_CLEAR_CLASS((VALUE)fake_ary);
+
+    // bypass frozen checks
+    fake_ary->as.heap.ptr = list;
+    fake_ary->as.heap.len = len;
+    fake_ary->as.heap.aux.capa = len;
+    return (VALUE)fake_ary;
+}
 
-	shared->len = RARRAY(ary)->len;
-	shared->ptr = RARRAY(ary)->ptr;
-	shared->aux.capa = RARRAY(ary)->aux.capa;
-	RARRAY(ary)->aux.shared = (VALUE)shared;
-	FL_SET(ary, ELTS_SHARED);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
+size_t
+rb_ary_memsize(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+        return ARY_CAPA(ary) * sizeof(VALUE);
     }
     else {
-	return RARRAY(ary)->aux.shared;
+        return 0;
     }
 }
 
 static VALUE
-ary_shared_array(klass, ary)
-    VALUE klass, ary;
+ary_make_shared(VALUE ary)
 {
-    VALUE val = ary_alloc(klass);
+    ary_verify(ary);
 
-    ary_make_shared(ary);
-    RARRAY(val)->ptr = RARRAY(ary)->ptr;
-    RARRAY(val)->len = RARRAY(ary)->len;
-    RARRAY(val)->aux.shared = RARRAY(ary)->aux.shared;
-    FL_SET(val, ELTS_SHARED);
-    return val;
+    if (ARY_SHARED_P(ary)) {
+        return ARY_SHARED_ROOT(ary);
+    }
+    else if (ARY_SHARED_ROOT_P(ary)) {
+        return ary;
+    }
+    else if (OBJ_FROZEN(ary)) {
+        return ary;
+    }
+    else {
+        long capa = ARY_CAPA(ary);
+        long len = RARRAY_LEN(ary);
+
+        /* Shared roots cannot be embedded because the reference count
+         * (refcnt) is stored in as.heap.aux.capa. */
+        VALUE shared = ary_alloc_heap(0);
+        FL_SET_SHARED_ROOT(shared);
+
+        if (ARY_EMBED_P(ary)) {
+            VALUE *ptr = ary_heap_alloc_buffer(capa);
+            ARY_SET_PTR(shared, ptr);
+            ary_memcpy(shared, 0, len, RARRAY_CONST_PTR(ary));
+
+            FL_UNSET_EMBED(ary);
+            ARY_SET_HEAP_LEN(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+        else {
+            ARY_SET_PTR(shared, RARRAY_CONST_PTR(ary));
+        }
+
+        ARY_SET_LEN(shared, capa);
+        ary_mem_clear(shared, len, capa - len);
+        rb_ary_set_shared(ary, shared);
+
+        ary_verify(shared);
+        ary_verify(ary);
+
+        return shared;
+    }
+}
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+
+    if (ary_embeddable_p(len)) {
+        VALUE subst = rb_ary_new_capa(len);
+        RUBY_ASSERT(ARY_EMBED_P(subst));
+
+        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+        ARY_SET_EMBED_LEN(subst, len);
+        return subst;
+    }
+    else {
+        return rb_ary_increment_share(ary_make_shared(ary));
+    }
 }
 
 VALUE
-rb_values_from_ary(ary)
-    VALUE ary;
+rb_assoc_new(VALUE car, VALUE cdr)
 {
-    return ary_shared_array(rb_cValues, ary);
+    return rb_ary_new3(2, car, cdr);
 }
 
 VALUE
-rb_ary_from_values(val)
-    VALUE val;
+rb_to_array_type(VALUE ary)
 {
-    return ary_shared_array(rb_cArray, val);
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
 }
+#define to_ary rb_to_array_type
 
 VALUE
-rb_assoc_new(car, cdr)
-    VALUE car, cdr;
+rb_check_array_type(VALUE ary)
 {
-    return rb_values_new(2, car, cdr);
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
 }
 
-static VALUE
-to_ary(ary)
-    VALUE ary;
+VALUE
+rb_check_to_array(VALUE ary)
+{
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
 {
-    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
 }
 
+/*
+ *  call-seq:
+ *    Array.try_convert(object) -> object, new_array, or nil
+ *
+ *  Attempts to return an array, based on the given +object+.
+ *
+ *  If +object+ is an array, returns +object+.
+ *
+ *  Otherwise if +object+ responds to <tt>:to_ary</tt>.
+ *  calls <tt>object.to_ary</tt>:
+ *  if the return value is an array or +nil+, returns that value;
+ *  if not, raises TypeError.
+ *
+ *  Otherwise returns +nil+.
+ *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ */
+
 static VALUE
-to_a(ary)
-    VALUE ary;
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
 {
-    return rb_convert_type(ary, T_ARRAY, "Array", "to_a");
+    return rb_check_array_type(ary);
 }
 
-VALUE
-rb_check_array_type(ary)
-    VALUE ary;
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
 {
-    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
-}
-
-static VALUE rb_ary_replace _((VALUE, VALUE));
-
-/*
- *  call-seq:
- *     Array.new(size=0, obj=nil)
- *     Array.new(array)
- *     Array.new(size) {|index| block }
- *
- *  Returns a new array. In the first form, the new array is
- *  empty. In the second it is created with _size_ copies of _obj_
- *  (that is, _size_ references to the same
- *  _obj_). The third form creates a copy of the array
- *  passed as a parameter (the array is generated by calling
- *  to_ary  on the parameter). In the last form, an array
- *  of the given size is created. Each element in this array is
- *  calculated by passing the element's index to the given block and
- *  storing the return value.
- *
- *     Array.new
- *     Array.new(2)
- *     Array.new(5, "A")
- * 
- *     # only one copy of the object is created
- *     a = Array.new(2, Hash.new)
- *     a[0]['cat'] = 'feline'
- *     a
- *     a[1]['cat'] = 'Felix'
- *     a
- * 
- *     # here multiple copies are created
- *     a = Array.new(2) { Hash.new }
- *     a[0]['cat'] = 'feline'
- *     a
- * 
- *     squares = Array.new(5) {|i| i*i}
- *     squares
- * 
- *     copy = Array.new(squares)
- */
-
-static VALUE
-rb_ary_initialize(argc, argv, ary)
-    int argc;
-    VALUE *argv;
     VALUE ary;
+
+    if (klass == rb_cArray) {
+        long size = 0;
+        if (argc > 0 && FIXNUM_P(argv[0])) {
+            size = FIX2LONG(argv[0]);
+            if (size < 0) size = 0;
+        }
+
+        ary = ary_new(klass, size);
+
+        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+    }
+    else {
+        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+    }
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    Array.new -> new_empty_array
+ *    Array.new(array) -> new_array
+ *    Array.new(size, default_value = nil) -> new_array
+ *    Array.new(size = 0) {|index| ... } -> new_array
+ *
+ *  Returns a new array.
+ *
+ *  With no block and no argument given, returns a new empty array:
+ *
+ *    Array.new # => []
+ *
+ *  With no block and array argument given, returns a new array with the same elements:
+ *
+ *    Array.new([:foo, 'bar', 2]) # => [:foo, "bar", 2]
+ *
+ *  With no block and integer argument given, returns a new array containing
+ *  that many instances of the given +default_value+:
+ *
+ *    Array.new(0)    # => []
+ *    Array.new(3)    # => [nil, nil, nil]
+ *    Array.new(2, 3) # => [3, 3]
+ *
+ *  With a block given, returns an array of the given +size+;
+ *  calls the block with each +index+ in the range <tt>(0...size)</tt>;
+ *  the element at that +index+ in the returned array is the blocks return value:
+ *
+ *    Array.new(3)  {|index| "Element #{index}" } # => ["Element 0", "Element 1", "Element 2"]
+ *
+ *  A common pitfall for new Rubyists is providing an expression as +default_value+:
+ *
+ *    array = Array.new(2, {})
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {a: 1}], as array[0] and array[1] are same object
+ *
+ *  If you want the elements of the array to be distinct, you should pass a block:
+ *
+ *    array = Array.new(2) { {} }
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {}], as array[0] and array[1] are different objects
+ *
+ *  Raises TypeError if the first argument is not either an array
+ *  or an {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]).
+ *  Raises ArgumentError if the first argument is a negative integer.
+ *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ */
+
+static VALUE
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 {
     long len;
     VALUE size, val;
 
-    if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
-	RARRAY(ary)->len = 0;
-	if (rb_block_given_p()) {
-	    rb_warning("given block not used");
-	}
-	return ary;
-    }
-
+    rb_ary_modify(ary);
+    if (argc == 0) {
+        rb_ary_reset(ary);
+        RUBY_ASSERT(ARY_EMBED_P(ary));
+        RUBY_ASSERT(ARY_EMBED_LEN(ary) == 0);
+        if (rb_block_given_p()) {
+            rb_warning("given block not used");
+        }
+        return ary;
+    }
+    rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
-	val = rb_check_array_type(size);
-	if (!NIL_P(val)) {
-	    rb_ary_replace(ary, val);
-	    return ary;
-	}
+        val = rb_check_array_type(size);
+        if (!NIL_P(val)) {
+            rb_ary_replace(ary, val);
+            return ary;
+        }
     }
 
     len = NUM2LONG(size);
+    /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
-    if (len > 0 && len * (long)sizeof(VALUE) <= len) {
-	rb_raise(rb_eArgError, "array size too big");
+    if (len > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
     }
+    /* recheck after argument conversion */
     rb_ary_modify(ary);
-    if (len > RARRAY(ary)->aux.capa) {
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
-	RARRAY(ary)->aux.capa = len;
-    }
+    ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
-	long i;
+        long i;
 
-	if (argc == 2) {
-	    rb_warn("block supersedes default value argument");
-	}
-	for (i=0; i<len; i++) {
-	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    RARRAY(ary)->len = i + 1;
-	}
+        if (argc == 2) {
+            rb_warn("block supersedes default value argument");
+        }
+        for (i=0; i<len; i++) {
+            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+            ARY_SET_LEN(ary, i + 1);
+        }
     }
     else {
-	memfill(RARRAY(ary)->ptr, len, val);
-	RARRAY(ary)->len = len;
+        ary_memfill(ary, 0, len, val);
+        ARY_SET_LEN(ary, len);
     }
-
     return ary;
 }
 
-
-/* 
-* Returns a new array populated with the given objects. 
-*
-*   Array.[]( 1, 'a', /^A/ )
-*   Array[ 1, 'a', /^A/ ]
-*   [ 1, 'a', /^A/ ]
-*/
+/*
+ * Returns a new array, populated with the given objects:
+ *
+ *   Array[1, 'a', /^A/]    # => [1, "a", /^A/]
+ *   Array[]                # => []
+ *   Array.[](1, 'a', /^A/) # => [1, "a", /^A/]
+ *
+ * Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ */
 
 static VALUE
-rb_ary_s_create(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
 {
-    VALUE ary = ary_alloc(klass);
-
-    if (argc < 0) {
-	rb_raise(rb_eArgError, "negative number of arguments");
-    }
-    if (argc > 0) {
-	RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
-	MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+    VALUE ary = ary_new(klass, argc);
+    if (argc > 0 && argv) {
+        ary_memcpy(ary, 0, argc, argv);
+        ARY_SET_LEN(ary, argc);
     }
-    RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
 
     return ary;
 }
 
 void
-rb_ary_store(ary, idx, val)
-    VALUE ary;
-    long idx;
-    VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
 {
+    long len = RARRAY_LEN(ary);
+
     if (idx < 0) {
-	idx += RARRAY(ary)->len;
-	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld out of array",
-		    idx - RARRAY(ary)->len);
-	}
+        idx += len;
+        if (idx < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     idx - len, -len);
+        }
+    }
+    else if (idx >= ARY_MAX_SIZE) {
+        rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
     rb_ary_modify(ary);
-    if (idx >= RARRAY(ary)->aux.capa) {
-	long new_capa = RARRAY(ary)->aux.capa / 2;
-
-	if (new_capa < ARY_DEFAULT_SIZE) {
-	    new_capa = ARY_DEFAULT_SIZE;
-	}
-	new_capa += idx;
-	if (new_capa * (long)sizeof(VALUE) <= new_capa) {
-	    rb_raise(rb_eArgError, "index too big");
-	}
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
-	RARRAY(ary)->aux.capa = new_capa;
+    if (idx >= ARY_CAPA(ary)) {
+        ary_double_capa(ary, idx);
     }
-    if (idx > RARRAY(ary)->len) {
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
-		     idx-RARRAY(ary)->len + 1);
+    if (idx > len) {
+        ary_mem_clear(ary, len, idx - len + 1);
     }
 
-    if (idx >= RARRAY(ary)->len) {
-	RARRAY(ary)->len = idx + 1;
+    if (idx >= len) {
+        ARY_SET_LEN(ary, idx + 1);
     }
-    RARRAY(ary)->ptr[idx] = val;
+    ARY_SET(ary, idx, val);
 }
 
 static VALUE
-ary_shared_first(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
 {
-    VALUE nv, result;
-    long n;
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
 
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    if (n > RARRAY(ary)->len) {
-	n = RARRAY(ary)->len;
+    VALUE result = ary_alloc_heap(klass);
+    size_t embed_capa = ary_embed_capa(result);
+    if ((size_t)len <= embed_capa) {
+        FL_SET_EMBED(result);
+        ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+        ARY_SET_EMBED_LEN(result, len);
     }
-    else if (n < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+    else {
+        VALUE shared = ary_make_shared(ary);
+
+        /* The ary_make_shared call may allocate, which can trigger a GC
+         * compaction. This can cause the array to be embedded because it has
+         * a length of 0. */
+        FL_UNSET_EMBED(result);
+
+        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+        ARY_SET_LEN(result, RARRAY_LEN(ary));
+        rb_ary_set_shared(result, shared);
+
+        ARY_INCREASE_PTR(result, offset);
+        ARY_SET_LEN(result, len);
+
+        ary_verify(shared);
     }
-    result = ary_shared_array(rb_cArray, ary);
-    RARRAY(result)->len = n;
+
+    ary_verify(result);
     return result;
 }
 
 static VALUE
-ary_shared_last(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
 {
-    VALUE result = ary_shared_first(argc, argv, ary);
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+    RUBY_ASSERT(step != 0);
+
+    const long orig_len = len;
+
+    if (step > 0 && step >= len) {
+        VALUE result = ary_new(klass, 1);
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RB_OBJ_WRITE(result, ptr, values[offset]);
+        ARY_SET_EMBED_LEN(result, 1);
+        return result;
+    }
+    else if (step < 0 && step < -len) {
+        step = -len;
+    }
+
+    long ustep = (step < 0) ? -step : step;
+    len = roomof(len, ustep);
+
+    long i;
+    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+    VALUE result = ary_new(klass, len);
+    if (ARY_EMBED_P(result)) {
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        for (i = 0; i < len; ++i) {
+            RB_OBJ_WRITE(result, ptr+i, values[j]);
+            j += step;
+        }
+        ARY_SET_EMBED_LEN(result, len);
+    }
+    else {
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RARRAY_PTR_USE(result, ptr, {
+            for (i = 0; i < len; ++i) {
+                RB_OBJ_WRITE(result, ptr+i, values[j]);
+                j += step;
+            }
+        });
+        ARY_SET_LEN(result, len);
+    }
 
-    RARRAY(result)->ptr += RARRAY(ary)->len - RARRAY(result)->len;
     return result;
 }
 
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+}
+
+enum ary_take_pos_flags
+{
+    ARY_TAKE_FIRST = 0,
+    ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last_n(VALUE ary, long n, enum ary_take_pos_flags last)
+{
+    long len = RARRAY_LEN(ary);
+    long offset = 0;
+
+    if (n > len) {
+        n = len;
+    }
+    else if (n < 0) {
+        rb_raise(rb_eArgError, "negative array size");
+    }
+    if (last) {
+        offset = len - n;
+    }
+    return ary_make_partial(ary, rb_cArray, offset, n);
+}
+
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    argc = rb_check_arity(argc, 0, 1);
+    /* the case optional argument is omitted should be handled in
+     * callers of this function.  if another arity case is added,
+     * this arity check needs to rewrite. */
+    RUBY_ASSERT_ALWAYS(argc == 1);
+    return ary_take_first_or_last_n(ary, NUM2LONG(argv[0]), last);
+}
+
 /*
  *  call-seq:
- *     array << obj            -> array
- *  
- *  Append---Pushes the given object on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together.
+ *    self << object -> self
+ *
+ *  Appends +object+ as the last element in +self+; returns +self+:
+ *
+ *    [:foo, 'bar', 2] << :baz # => [:foo, "bar", 2, :baz]
  *
- *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *  Appends +object+ as a single element, even if it is another array:
  *
+ *    [:foo, 'bar', 2] << [3, 4] # => [:foo, "bar", 2, [3, 4]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
-rb_ary_push(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
 {
-    rb_ary_store(ary, RARRAY(ary)->len, item);
+    long idx = RARRAY_LEN((ary_verify(ary), ary));
+    VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+    RARRAY_PTR_USE(ary, ptr, {
+        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+    });
+    ARY_SET_LEN(ary, idx + 1);
+    ary_verify(ary);
     return ary;
 }
 
-/* 
+VALUE
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
+{
+    long oldlen = RARRAY_LEN(ary);
+    VALUE target_ary = ary_ensure_room_for_push(ary, len);
+    ary_memcpy0(ary, oldlen, len, argv, target_ary);
+    ARY_SET_LEN(ary, oldlen + len);
+    return ary;
+}
+
+/*
  *  call-seq:
- *     array.push(obj, ... )   -> array
- *  
- *  Append---Pushes the given object(s) on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together.
+ *    push(*objects) -> self
+ *    append(*objects) -> self
+ *
+ *  Appends each argument in +objects+ to +self+; returns +self+:
+ *
+ *    a = [:foo, 'bar', 2] # => [:foo, "bar", 2]
+ *    a.push(:baz, :bat)   # => [:foo, "bar", 2, :baz, :bat]
+ *
+ *  Appends each argument as a single element, even if it is another array:
+ *
+ *    a = [:foo, 'bar', 2]               # => [:foo, "bar", 2]
+      a.push([:baz, :bat], [:bam, :bad]) # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
  *
- *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")  
- *             #=> ["a", "b", "c", "d", "e", "f"]
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
-rb_ary_push_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
 {
-    while (argc--) {
-	rb_ary_push(ary, *argv++);
-    }
-    return ary;
+    return rb_ary_cat(ary, argv, argc);
 }
 
 VALUE
-rb_ary_pop(ary)
-    VALUE ary;
+rb_ary_pop(VALUE ary)
 {
+    long n;
     rb_ary_modify_check(ary);
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (!FL_TEST(ary, ELTS_SHARED) &&
-	    RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
-	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
-	RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+    n = RARRAY_LEN(ary);
+    if (n == 0) return Qnil;
+    if (ARY_OWNS_HEAP_P(ary) &&
+        n * 3 < ARY_CAPA(ary) &&
+        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+    {
+        ary_resize_capa(ary, n * 2);
     }
-    return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+    VALUE obj = RARRAY_AREF(ary, n - 1);
+
+    ARY_SET_LEN(ary, n - 1);
+    ary_verify(ary);
+    return obj;
 }
 
 /*
  *  call-seq:
- *     array.pop  -> obj or nil
- *  
- *  Removes the last element from <i>self</i> and returns it, or
- *  <code>nil</code> if the array is empty.
- *     
- *     a = [ "a", "b", "c", "d" ]
- *     a.pop     #=> "d"
- *     a.pop(2)  #=> ["b", "c"]
- *     a         #=> ["a"]
+ *    pop -> object or nil
+ *    pop(count) -> new_array
+ *
+ *  Removes and returns trailing elements of +self+.
+ *
+ *  With no argument given, removes and returns the last element, if available;
+ *  otherwise returns +nil+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop  # => 2
+ *    a      # => [:foo, "bar"]
+ *    [].pop # => nil
+ *
+ *  With non-negative integer argument +count+ given,
+ *  returns a new array containing the trailing +count+ elements of +self+, as available:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(2) # => ["bar", 2]
+ *    a        # => [:foo]
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(50) # => [:foo, "bar", 2]
+ *    a         # => []
+ *
+ *  Related: Array#push;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_pop_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE result;
 
     if (argc == 0) {
-	return rb_ary_pop(ary);
+        return rb_ary_pop(ary);
     }
 
     rb_ary_modify_check(ary);
-
-    result = ary_shared_last(argc, argv, ary);
-    RARRAY(ary)->len -= RARRAY(result)->len;
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    ary_verify(ary);
     return result;
 }
 
 VALUE
-rb_ary_shift(ary)
-    VALUE ary;
+rb_ary_shift(VALUE ary)
 {
     VALUE top;
+    long len = RARRAY_LEN(ary);
 
-    rb_ary_modify_check(ary);
-    if (RARRAY(ary)->len == 0) return Qnil;
-    top = RARRAY(ary)->ptr[0];
-    ary_make_shared(ary);
-    RARRAY(ary)->ptr++;		/* shift ptr */
-    RARRAY(ary)->len--;
+    if (len == 0) {
+        rb_ary_modify_check(ary);
+        return Qnil;
+    }
+
+    top = RARRAY_AREF(ary, 0);
+
+    rb_ary_behead(ary, 1);
 
     return top;
 }
 
 /*
  *  call-seq:
- *     array.shift   ->   obj or nil
- *  
- *  Returns the first element of <i>self</i> and removes it (shifting all
- *  other elements down by one). Returns <code>nil</code> if the array
- *  is empty.
- *     
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift     #=> "-m"
- *     args           #=> ["-q", "filename"]
+ *    shift -> object or nil
+ *    shift(count) -> new_array or nil
+ *
+ *  Removes and returns leading elements from +self+.
+ *
+ *  With no argument, removes and returns one element, if available,
+ *  or +nil+ otherwise:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift  # => 0
+ *    a        # => [1, 2, 3]
+ *    [].shift # => nil
+ *
+ *  With non-negative numeric argument +count+ given,
+ *  removes and returns the first +count+ elements:
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift(2)  #=> ["-m", "-q"]
- *     args           #=> ["filename"]
+ *    a = [0, 1, 2, 3]
+ *    a.shift(2)   # => [0, 1]
+ *    a            # => [2, 3]
+ *    a.shift(1.1) # => [2]
+ *    a            # => [3]
+ *    a.shift(0)   # => []
+ *    a            # => [3]
+ *
+ *  If +count+ is large,
+ *  removes and returns all elements:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift(50) # => [0, 1, 2, 3]
+ *    a           # => []
+ *
+ *  If +self+ is empty, returns a new empty array.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_shift_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE result;
     long n;
 
     if (argc == 0) {
-	return rb_ary_shift(ary);
+        return rb_ary_shift(ary);
     }
 
     rb_ary_modify_check(ary);
-
-    result = ary_shared_first(argc, argv, ary);
-    n = RARRAY(result)->len;
-    RARRAY(ary)->ptr += n;
-    RARRAY(ary)->len -= n;
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    n = RARRAY_LEN(result);
+    rb_ary_behead(ary,n);
 
     return result;
 }
 
 VALUE
-rb_ary_unshift(ary, item)
-    VALUE ary, item;
+rb_ary_behead(VALUE ary, long n)
 {
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
-	long capa_inc = RARRAY(ary)->aux.capa / 2;
-	if (capa_inc < ARY_DEFAULT_SIZE) {
-	    capa_inc = ARY_DEFAULT_SIZE;
-	}
-	RARRAY(ary)->aux.capa += capa_inc;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+    if (n <= 0) {
+        return ary;
     }
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    rb_ary_modify_check(ary);
+
+    if (!ARY_SHARED_P(ary)) {
+        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+            }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -n);
+            ary_verify(ary);
+            return ary;
+        }
+
+        ary_mem_clear(ary, 0, n);
+        ary_make_shared(ary);
+    }
+    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+        ary_mem_clear(ary, 0, n);
+    }
 
-    RARRAY(ary)->len++;
-    RARRAY(ary)->ptr[0] = item;
+    ARY_INCREASE_PTR(ary, n);
+    ARY_INCREASE_LEN(ary, -n);
+    ary_verify(ary);
 
     return ary;
 }
 
+static VALUE
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+    if (head - sharedp < argc) {
+        long room = capa - len - argc;
+
+        room -= room >> 4;
+        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+        head = sharedp + argc + room;
+    }
+    ARY_SET_PTR(ary, head - argc);
+    RUBY_ASSERT(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+    ary_verify(ary);
+    return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+    long capa;
+    const VALUE *head, *sharedp;
+
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (capa - (capa >> 6) <= new_len) {
+        ary_double_capa(ary, new_len);
+    }
+
+    /* use shared array for big "queues" */
+    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+        ary_verify(ary);
+
+        /* make a room for unshifted items */
+        capa = ARY_CAPA(ary);
+        ary_make_shared(ary);
+
+        head = sharedp = RARRAY_CONST_PTR(ary);
+        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
+    }
+    else {
+        /* sliding items */
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMMOVE(ptr + argc, ptr, VALUE, len);
+        });
+
+        ary_verify(ary);
+        return ary;
+    }
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+
+    if (len > ARY_MAX_SIZE - argc) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    else if (! ARY_SHARED_P(ary)) {
+        return ary_modify_for_unshift(ary, argc);
+    }
+    else {
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+        long capa = RARRAY_LEN(shared_root);
+
+        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else if (new_len > capa) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else {
+            const VALUE * head = RARRAY_CONST_PTR(ary);
+            void *sharedp = (void *)RARRAY_CONST_PTR(shared_root);
+
+            rb_ary_modify_check(ary);
+            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+        }
+    }
+}
+
 /*
  *  call-seq:
- *     array.unshift(obj, ...)  -> array
- *  
- *  Prepends objects to the front of <i>array</i>.
- *  other elements up one.
- *     
- *     a = [ "b", "c", "d" ]
- *     a.unshift("a")   #=> ["a", "b", "c", "d"]
- *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
+ *    unshift(*objects) -> self
+ *    prepend(*objects) -> self
+ *
+ *  Prepends the given +objects+ to +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
+ *
+ *  Related: Array#shift;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
-static VALUE
-rb_ary_unshift_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+VALUE
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
-    long len = RARRAY(ary)->len;
+    long len = RARRAY_LEN(ary);
+    VALUE target_ary;
 
-    if (argc < 0) {
-	rb_raise(rb_eArgError, "negative number of arguments");
+    if (argc == 0) {
+        rb_ary_modify_check(ary);
+        return ary;
     }
-    if (argc == 0) return ary;
-
-    /* make rooms by setting the last item */
-    rb_ary_store(ary, len + argc - 1, Qnil);
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
-    MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
-    
+    target_ary = ary_ensure_room_for_unshift(ary, argc);
+    ary_memcpy0(ary, 0, argc, argv, target_ary);
+    ARY_SET_LEN(ary, len + argc);
     return ary;
 }
 
+VALUE
+rb_ary_unshift(VALUE ary, VALUE item)
+{
+    return rb_ary_unshift_m(1, &item, ary);
+}
+
 /* faster version - use this if you don't need to treat negative offset */
 static inline VALUE
-rb_ary_elt(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_elt(VALUE ary, long offset)
 {
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (offset < 0 || RARRAY(ary)->len <= offset) {
-	return Qnil;
+    long len = RARRAY_LEN(ary);
+    if (len == 0) return Qnil;
+    if (offset < 0 || len <= offset) {
+        return Qnil;
     }
-    return RARRAY(ary)->ptr[offset];
+    return RARRAY_AREF(ary, offset);
 }
 
 VALUE
-rb_ary_entry(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_entry(VALUE ary, long offset)
 {
-    if (offset < 0) {
-	offset += RARRAY(ary)->len;
-    }
-    return rb_ary_elt(ary, offset);
+    return rb_ary_entry_internal(ary, offset);
 }
 
-static VALUE
-rb_ary_subseq(ary, beg, len)
-    VALUE ary;
-    long beg, len;
+VALUE
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
 {
-    VALUE klass, ary2, shared;
-    VALUE *ptr;
+    VALUE klass;
+    long alen = RARRAY_LEN(ary);
 
-    if (beg > RARRAY(ary)->len) return Qnil;
+    if (beg > alen) return Qnil;
     if (beg < 0 || len < 0) return Qnil;
 
-    if (beg + len > RARRAY(ary)->len) {
-	len = RARRAY(ary)->len - beg;
-	if (len < 0)
-	    len = 0;
+    if (alen < len || alen < beg + len) {
+        len = alen - beg;
     }
-    klass = rb_obj_class(ary);
+    klass = rb_cArray;
     if (len == 0) return ary_new(klass, 0);
+    if (step == 0)
+        rb_raise(rb_eArgError, "slice step cannot be zero");
+    if (step == 1)
+        return ary_make_partial(ary, klass, beg, len);
+    else
+        return ary_make_partial_step(ary, klass, beg, len, step);
+}
 
-    shared = ary_make_shared(ary);
-    ptr = RARRAY(ary)->ptr;
-    ary2 = ary_alloc(klass);
-    RARRAY(ary2)->ptr = ptr + beg;
-    RARRAY(ary2)->len = len;
-    RARRAY(ary2)->aux.shared = shared;
-    FL_SET(ary2, ELTS_SHARED);
-
-    return ary2;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+    return rb_ary_subseq_step(ary, beg, len, 1);
 }
 
-/* 
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
+/*
  *  call-seq:
- *     array[index]                -> obj      or nil
- *     array[start, length]        -> an_array or nil
- *     array[range]                -> an_array or nil
- *     array.slice(index)          -> obj      or nil
- *     array.slice(start, length)  -> an_array or nil
- *     array.slice(range)          -> an_array or nil
+ *    self[offset] -> object or nil
+ *    self[offset, size] -> object or nil
+ *    self[range] -> object or nil
+ *    self[aseq] -> object or nil
+ *
+ *  Returns elements from +self+; does not modify +self+.
+ *
+ *  In brief:
+ *
+ *    a = [:foo, 'bar', 2]
+ *
+ *    # Single argument offset: returns one element.
+ *    a[0]     # => :foo          # Zero-based index.
+ *    a[-1]    # => 2             # Negative index counts backwards from end.
+ *
+ *    # Arguments offset and size: returns an array.
+ *    a[1, 2]  # => ["bar", 2]
+ *    a[-2, 2] # => ["bar", 2]    # Negative offset counts backwards from end.
+ *
+ *    # Single argument range: returns an array.
+ *    a[0..1]  # => [:foo, "bar"]
+ *    a[0..-2] # => [:foo, "bar"] # Negative range-begin counts backwards from end.
+ *    a[-2..2] # => ["bar", 2]    # Negative range-end counts backwards from end.
+ *
+ *  When a single integer argument +offset+ is given, returns the element at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] # => :foo
+ *    a[2] # => 2
+ *    a # => [:foo, "bar", 2]
+ *
+ *  If +offset+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] # => 2
+ *    a[-2] # => "bar"
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  When two Integer arguments +offset+ and +size+ are given,
+ *  returns a new array of size +size+ containing successive elements beginning at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] # => [:foo, "bar"]
+ *    a[1, 2] # => ["bar", 2]
+ *
+ *  If <tt>offset + size</tt> is greater than <tt>self.size</tt>,
+ *  returns all elements from offset +offset+ to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 4] # => [:foo, "bar", 2]
+ *    a[1, 3] # => ["bar", 2]
+ *    a[2, 2] # => [2]
+ *
+ *  If <tt>offset == self.size</tt> and <tt>size >= 0</tt>,
+ *  returns a new empty array.
  *
- *  Element Reference---Returns the element at _index_,
- *  or returns a subarray starting at _start_ and
- *  continuing for _length_ elements, or returns a subarray
- *  specified by _range_.
- *  Negative indices count backward from the end of the
- *  array (-1 is the last element). Returns nil if the index
- *  (or starting index) are out of range.
+ *  If +size+ is negative, returns +nil+.
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a[2] +  a[0] + a[1]    #=> "cab"
- *     a[6]                   #=> nil
- *     a[1, 2]                #=> [ "b", "c" ]
- *     a[1..3]                #=> [ "b", "c", "d" ]
- *     a[4..7]                #=> [ "e" ]
- *     a[6..10]               #=> nil
- *     a[-3, 3]               #=> [ "c", "d", "e" ]
- *     # special cases
- *     a[5]                   #=> nil
- *     a[5, 1]                #=> []
- *     a[5..10]               #=> []
+ *  When a single Range argument +range+ is given,
+ *  treats <tt>range.min</tt> as +offset+ above
+ *  and <tt>range.size</tt> as +size+ above:
  *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] # => [:foo, "bar"]
+ *    a[1..2] # => ["bar", 2]
+ *
+ *  Special case: If <tt>range.start == a.size</tt>, returns a new empty array.
+ *
+ *  If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..-1] # => [:foo, "bar", 2]
+ *    a[0..-2] # => [:foo, "bar"]
+ *    a[0..-3] # => [:foo]
+ *
+ *  If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1..2] # => [2]
+ *    a[-2..2] # => ["bar", 2]
+ *    a[-3..2] # => [:foo, "bar", 2]
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[4..1] # => nil
+ *    a[4..0] # => nil
+ *    a[4..-1] # => nil
+ *
+ *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ *  returns an array of elements corresponding to the indexes produced by
+ *  the sequence.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ *  Unlike slicing with range, if the start or the end of the arithmetic sequence
+ *  is larger than array size, throws RangeError.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..11).step(2)]
+ *    # RangeError (((1..11).step(2)) out of range)
+ *    a[(7..).step(2)]
+ *    # RangeError (((7..).step(2)) out of range)
+ *
+ *  If given a single argument, and its type is not one of the listed, tries to
+ *  convert it to Integer, and raises if it is impossible:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    # Raises TypeError (no implicit conversion of Symbol into Integer):
+ *    a[:foo]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
-rb_ary_aref(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
-    VALUE arg;
-    long beg, len;
-
+    rb_check_arity(argc, 1, 2);
     if (argc == 2) {
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	if (beg < 0) {
-	    beg += RARRAY(ary)->len;
-	}
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_aref2(ary, argv[0], argv[1]);
     }
-    if (argc != 1) {
-	rb_scan_args(argc, argv, "11", 0, 0);
+    return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+    long beg = NUM2LONG(b);
+    long len = NUM2LONG(e);
+    if (beg < 0) {
+        beg += RARRAY_LEN(ary);
     }
-    arg = argv[0];
+    return rb_ary_subseq(ary, beg, len);
+}
+
+VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+    long beg, len, step;
+
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
-	return rb_ary_entry(ary, FIX2LONG(arg));
+        return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
+    /* check if idx is Range or ArithmeticSequence */
+    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
       case Qfalse:
-	break;
+        break;
       case Qnil:
-	return Qnil;
+        return Qnil;
       default:
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_subseq_step(ary, beg, len, step);
     }
+
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
-/* 
+/*
  *  call-seq:
- *     array.at(index)   ->   obj  or nil
+ *    at(index) -> object or nil
  *
- *  Returns the element at _index_. A
- *  negative index counts from the end of _self_.  Returns +nil+
- *  if the index is out of range. See also <code>Array#[]</code>.
- *  (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
- *  as it does not accept ranges and so on.)
+ *  Returns the element of +self+ specified by the given +index+
+ *  or +nil+ if there is no such element;
+ *  +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.at(0)     #=> "a"
- *     a.at(-1)    #=> "e"
+ *  For non-negative +index+, returns the element of +self+ at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.at(0)   # => :foo
+ *    a.at(2)   # => 2
+ *    a.at(2.0) # => 2
+ *
+ *  For negative +index+, counts backwards from the end of +self+:
+ *
+ *    a.at(-2) # => "bar"
+ *
+ *  Related: Array#[];
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
-static VALUE
-rb_ary_at(ary, pos)
-    VALUE ary, pos;
+VALUE
+rb_ary_at(VALUE ary, VALUE pos)
 {
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
-/*
- *  call-seq:
- *     array.first     ->   obj or nil
- *     array.first(n)  ->   an_array
- *  
- *  Returns the first element of the array. If the array is empty,
- *  returns <code>nil</code>.
- *     
- *     a = [ "q", "r", "s", "t" ]
- *     a.first     #=> "q"
- *     a.first(2)  #=> ["q", "r"]
- */
-
+#if 0
 static VALUE
-rb_ary_first(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY(ary)->len == 0) return Qnil;
-	return RARRAY(ary)->ptr[0];
+        if (RARRAY_LEN(ary) == 0) return Qnil;
+        return RARRAY_AREF(ary, 0);
     }
     else {
-	return ary_shared_first(argc, argv, ary);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
+#endif
 
-/*
- *  call-seq:
- *     array.last     ->  obj or nil
- *     array.last(n)  ->  an_array
- *  
- *  Returns the last element(s) of <i>self</i>. If the array is empty,
- *  the first form returns <code>nil</code>.
- *     
- *     a = [ "w", "x", "y", "z" ]
- *     a.last     #=> "z"
- *     a.last(2)  #=> ["y", "z"]
- */
+static VALUE
+ary_first(VALUE self)
+{
+    return (RARRAY_LEN(self) == 0) ? Qnil : RARRAY_AREF(self, 0);
+}
 
 static VALUE
-rb_ary_last(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+ary_last(VALUE self)
+{
+    long len = RARRAY_LEN(self);
+    return (len == 0) ? Qnil : RARRAY_AREF(self, len-1);
+}
+
+VALUE
+rb_ary_last(int argc, const VALUE *argv, VALUE ary) // used by parse.y
 {
     if (argc == 0) {
-	if (RARRAY(ary)->len == 0) return Qnil;
-	return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
+        return ary_last(ary);
     }
     else {
-	return ary_shared_last(argc, argv, ary);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *     array.fetch(index)                    -> obj
- *     array.fetch(index, default )          -> obj
- *     array.fetch(index) {|index| block }   -> obj
- *  
- *  Tries to return the element at position <i>index</i>. If the index
- *  lies outside the array, the first form throws an
- *  <code>IndexError</code> exception, the second form returns
- *  <i>default</i>, and the third form returns the value of invoking
- *  the block, passing in the index. Negative values of <i>index</i>
- *  count from the end of the array.
- *     
- *     a = [ 11, 22, 33, 44 ]
- *     a.fetch(1)               #=> 22
- *     a.fetch(-1)              #=> 44
- *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(4) { |i| i*i }   #=> 16
+ *    fetch(index) -> element
+ *    fetch(index, default_value) -> element or default_value
+ *    fetch(index) {|index| ... } -> element or block_return_value
+ *
+ *  Returns the element of +self+ at offset +index+ if +index+ is in range; +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  With the single argument +index+ and no block,
+ *  returns the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1)   # => "bar"
+ *    a.fetch(1.1) # => "bar"
+ *
+ *  If +index+ is negative, counts from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(-1) # => 2
+ *    a.fetch(-2) # => "bar"
+ *
+ *  With arguments +index+ and +default_value+ (which may be any object) and no block,
+ *  returns +default_value+ if +index+ is out-of-range:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1, nil)  # => "bar"
+ *    a.fetch(3, :foo) # => :foo
+ *
+ *  With argument +index+ and a block,
+ *  returns the element at offset +index+ if index is in range
+ *  (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
-rb_ary_fetch(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
 {
     VALUE pos, ifnone;
     long block_given;
@@ -954,2006 +2057,4524 @@ rb_ary_fetch(argc, argv, ary)
     rb_scan_args(argc, argv, "11", &pos, &ifnone);
     block_given = rb_block_given_p();
     if (block_given && argc == 2) {
-	rb_warn("block supersedes default value argument");
+        rb_warn("block supersedes default value argument");
     }
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY(ary)->len;
+        idx +=  RARRAY_LEN(ary);
+    }
+    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+        if (block_given) return rb_yield(pos);
+        if (argc == 1) {
+            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+        }
+        return ifnone;
+    }
+    return RARRAY_AREF(ary, idx);
+}
+
+/*
+ * call-seq:
+ *   find(if_none_proc = nil) {|element| ... } -> object or nil
+ *   find(if_none_proc = nil) -> enumerator
+ *
+ * Returns the first element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array;
+ * returns the first element for which the block returns a truthy value:
+ *
+ *   [1, 3, 5].find {|element| element > 2}                # => 3
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 3, 5].find(proc {-1}) {|element| element > 12} # => -1
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_find(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    for (idx = 0; idx < RARRAY_LEN(ary); idx++) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+    }
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
+    }
+    return Qnil;
+}
+
+/*
+ * call-seq:
+ *   rfind(if_none_proc = nil) {|element| ... } -> object or nil
+ *   rfind(if_none_proc = nil) -> enumerator
+ *
+ * Returns the last element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array in
+ * reverse order; returns the first element for which the block returns a truthy
+ * value:
+ *
+ *   [1, 2, 3, 4, 5, 6].rfind {|element| element < 5}       # => 4
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 2, 3, 4].rfind(proc {0}) {|element| element < -2}  # => 0
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_rfind(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long len, idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    idx = RARRAY_LEN(ary);
+    while (idx--) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+
+        len = RARRAY_LEN(ary);
+        idx = (idx >= len) ? len : idx;
     }
-    if (idx < 0 || RARRAY(ary)->len <= idx) {
-	if (block_given) return rb_yield(pos);
-	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld out of array", idx);
-	}
-	return ifnone;
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
     }
-    return RARRAY(ary)->ptr[idx];
+    return Qnil;
 }
 
 /*
  *  call-seq:
- *     array.index(obj)           ->  int or nil
- *     array.index {|item| block} ->  int or nil
- *  
- *  Returns the index of the first object in <i>self</i> such that is
- *  <code>==</code> to <i>obj</i>. If a block is given instead of an
- *  argument, returns first object for which <em>block</em> is true.
- *  Returns <code>nil</code> if no match is found.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.index("b")        #=> 1
- *     a.index("z")        #=> nil
- *     a.index{|x|x=="b"}  #=> 1
+ *    find_index(object) -> integer or nil
+ *    find_index {|element| ... } -> integer or nil
+ *    find_index -> new_enumerator
+ *    index(object) -> integer or nil
+ *    index {|element| ... } -> integer or nil
+ *    index -> new_enumerator
+ *
+ *  Returns the zero-based integer index of a specified element, or +nil+.
+ *
+ *  With only argument +object+ given,
+ *  returns the index of the first element +element+
+ *  for which <tt>object == element</tt>:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index('bar') # => 1
+ *
+ *  Returns +nil+ if no such element found.
+ *
+ *  With only a block given,
+ *  calls the block with each successive element;
+ *  returns the index of the first element for which the block returns a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index {|element| element == 'bar' } # => 1
+ *
+ *  Returns +nil+ if the block never returns a truthy value.
+ *
+ *  With neither an argument nor a block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_index(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
     VALUE val;
     long i;
 
-    if (rb_scan_args(argc, argv, "01", &val) == 0) {
-	for (i=0; i<RARRAY(ary)->len; i++) {
-	    if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
-		return LONG2NUM(i);
-	    }
-	}
-    }
-    else {
-	for (i=0; i<RARRAY(ary)->len; i++) {
-	    if (rb_equal(RARRAY(ary)->ptr[i], val))
-		return LONG2NUM(i);
-	}
+    if (argc == 0) {
+        RETURN_ENUMERATOR(ary, 0, 0);
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                return LONG2NUM(i);
+            }
+        }
+        return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+        rb_warn("given block not used");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     array.rindex(obj)    ->  int or nil
- *  
- *  Returns the index of the last object in <i>array</i>
- *  <code>==</code> to <i>obj</i>. If a block is given instead of an
- *  argument, returns first object for which <em>block</em> is
- *  true. Returns <code>nil</code> if no match is found.
- *     
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")        #=> 3
- *     a.rindex("z")        #=> nil
- *     a.rindex{|x|x=="b"}  #=> 3
+ *    rindex(object) -> integer or nil
+ *    rindex {|element| ... } -> integer or nil
+ *    rindex -> new_enumerator
+ *
+ *  Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ *  With argument +object+ given, returns the index of the last such element found:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex('bar') # => 3
+ *
+ *  Returns +nil+ if no such object found.
+ *
+ *  With a block given, calls the block with each successive element;
+ *  returns the index of the last element for which the block returns a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex {|element| element == 'bar' } # => 3
+ *
+ *  Returns +nil+ if the block never returns a truthy value.
+ *
+ *  When neither an argument nor a block is given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_rindex(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
     VALUE val;
-    long i = RARRAY(ary)->len;
+    long i = RARRAY_LEN(ary), len;
 
-    if (rb_scan_args(argc, argv, "01", &val) == 0) {
-	while (i--) {
-	    if (RTEST(rb_yield(RARRAY(ary)->ptr[i])))
-		return LONG2NUM(i);
-	    if (i > RARRAY(ary)->len) {
-		i = RARRAY(ary)->len;
-	    }
-	}
-    }
-    else {
-	while (i--) {
-	    if (rb_equal(RARRAY(ary)->ptr[i], val))
-		return LONG2NUM(i);
-	    if (i > RARRAY(ary)->len) {
-		i = RARRAY(ary)->len;
-	    }
-	}
+    if (argc == 0) {
+        RETURN_ENUMERATOR(ary, 0, 0);
+        while (i--) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+                return LONG2NUM(i);
+            if (i > (len = RARRAY_LEN(ary))) {
+                i = len;
+            }
+        }
+        return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+        rb_warn("given block not used");
+    while (i--) {
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
+        if (i > RARRAY_LEN(ary)) {
+            break;
+        }
     }
     return Qnil;
 }
 
 VALUE
-rb_ary_to_ary(obj)
-    VALUE obj;
+rb_ary_to_ary(VALUE obj)
 {
-    if (TYPE(obj) == T_ARRAY) {
-	return obj;
-    }
-    if (rb_respond_to(obj, rb_intern("to_ary"))) {
-	return to_ary(obj);
-    }
+    VALUE tmp = rb_check_array_type(obj);
+
+    if (!NIL_P(tmp)) return tmp;
     return rb_ary_new3(1, obj);
 }
 
 static void
-rb_ary_splice(ary, beg, len, rpl)
-    VALUE ary;
-    long beg, len;
-    VALUE rpl;
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
 {
-    long rlen;
+    long olen;
+    long rofs;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+    olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg += RARRAY(ary)->len;
-	if (beg < 0) {
-	    beg -= RARRAY(ary)->len;
-	    rb_raise(rb_eIndexError, "index %ld out of array", beg);
-	}
+        beg += olen;
+        if (beg < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     beg - olen, -olen);
+        }
+    }
+    if (olen < len || olen < beg + len) {
+        len = olen - beg;
+    }
+
+    {
+        const VALUE *optr = RARRAY_CONST_PTR(ary);
+        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+    }
+
+    if (beg >= olen) {
+        VALUE target_ary;
+        if (beg > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", beg);
+        }
+        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+        len = beg + rlen;
+        ary_mem_clear(ary, olen, beg - olen);
+        if (rlen > 0) {
+            if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
+            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+        }
+        ARY_SET_LEN(ary, len);
     }
-    if (beg + len > RARRAY(ary)->len) {
-	len = RARRAY(ary)->len - beg;
+    else {
+        long alen;
+
+        if (olen - len > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+        }
+        rb_ary_modify(ary);
+        alen = olen + rlen - len;
+        if (alen >= ARY_CAPA(ary)) {
+            ary_double_capa(ary, alen);
+        }
+
+        if (len != rlen) {
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+                                             VALUE, olen - (beg + len)));
+            ARY_SET_LEN(ary, alen);
+        }
+        if (rlen > 0) {
+            if (rofs == -1) {
+                rb_gc_writebarrier_remember(ary);
+            }
+            else {
+                /* In this case, we're copying from a region in this array, so
+                 * we don't need to fire the write barrier. */
+                rptr = RARRAY_CONST_PTR(ary) + rofs;
+            }
+
+            /* do not use RARRAY_PTR() because it can causes GC.
+             * ary can contain T_NONE object because it is not cleared.
+             */
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+        }
     }
+}
 
-    if (rpl == Qundef) {
-	rlen = 0;
+void
+rb_ary_set_len(VALUE ary, long len)
+{
+    long capa;
+
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+        rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
-    else {
-	rpl = rb_ary_to_ary(rpl);
-	rlen = RARRAY(rpl)->len;
+    if (len > (capa = (long)ARY_CAPA(ary))) {
+        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
     }
+    ARY_SET_LEN(ary, len);
+}
+
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+    long olen;
+
     rb_ary_modify(ary);
+    olen = RARRAY_LEN(ary);
+    if (len == olen) return ary;
+    if (len > ARY_MAX_SIZE) {
+        rb_raise(rb_eIndexError, "index %ld too big", len);
+    }
+    if (len > olen) {
+        if (len > ARY_CAPA(ary)) {
+            ary_double_capa(ary, len);
+        }
+        ary_mem_clear(ary, olen, len - olen);
+        ARY_SET_LEN(ary, len);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else if (len <= ary_embed_capa(ary)) {
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long ptr_capa = ARY_HEAP_SIZE(ary);
+        bool is_malloc_ptr = !ARY_SHARED_P(ary);
 
-    if (beg >= RARRAY(ary)->len) {
-	len = beg + rlen;
-	if (len >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
-	    RARRAY(ary)->aux.capa = len;
-	}
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
-	if (rlen > 0) {
-	    MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
-	}
-	RARRAY(ary)->len = len;
+        FL_SET_EMBED(ary);
+
+        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
+        ARY_SET_EMBED_LEN(ary, len);
+
+        if (is_malloc_ptr) ruby_xfree_sized((void *)ptr, ptr_capa);
     }
     else {
-	long alen;
-
-	if (beg + len > RARRAY(ary)->len) {
-	    len = RARRAY(ary)->len - beg;
-	}
-
-	alen = RARRAY(ary)->len + rlen - len;
-	if (alen >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
-	    RARRAY(ary)->aux.capa = alen;
-	}
-
-	if (len != rlen) {
-	    MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
-		    VALUE, RARRAY(ary)->len - (beg + len));
-	    RARRAY(ary)->len = alen;
-	}
-	if (rlen > 0) {
-	    MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
-	}
-    }
-}
-
-/* 
- *  call-seq:
- *     array[index]         = obj                     ->  obj
- *     array[start, length] = obj or an_array or nil  ->  obj or an_array or nil
- *     array[range]         = obj or an_array or nil  ->  obj or an_array or nil
- *
- *  Element Assignment---Sets the element at _index_,
- *  or replaces a subarray starting at _start_ and
- *  continuing for _length_ elements, or replaces a subarray
- *  specified by _range_.  If indices are greater than
- *  the current capacity of the array, the array grows
- *  automatically. A negative indices will count backward
- *  from the end of the array. Inserts elements if _length_ is
- *  zero. An +IndexError+ is raised if a negative index points
- *  past the beginning of the array. See also
- *  <code>Array#push</code>, and <code>Array#unshift</code>.
- * 
- *     a = Array.new
- *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
- *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
- *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
- *     a[0..2] = "A"               #=> ["A", "4"]
- *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A", nil]
- *     a[1..-1] = []              #=> ["A"]
- */
-
-static VALUE
-rb_ary_aset(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+        if (olen > len + ARY_DEFAULT_SIZE) {
+            size_t new_capa = ary_heap_realloc(ary, len);
+            ARY_SET_CAPA(ary, new_capa);
+        }
+        ARY_SET_HEAP_LEN(ary, len);
+    }
+    ary_verify(ary);
+    return ary;
+}
+
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+    rb_ary_store(ary, key, val);
+    return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+    VALUE rpl = rb_ary_to_ary(val);
+    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
+    RB_GC_GUARD(rpl);
+    return val;
+}
+
+/*
+ *  call-seq:
+ *    self[index] = object -> object
+ *    self[start, length] = object -> object
+ *    self[range] = object -> object
+ *
+ *  Assigns elements in +self+, based on the given +object+; returns +object+.
+ *
+ *  In brief:
+ *
+ *      a_orig = [:foo, 'bar', 2]
+ *
+ *      # With argument index.
+ *      a = a_orig.dup
+ *      a[0] = 'foo' # => "foo"
+ *      a # => ["foo", "bar", 2]
+ *      a = a_orig.dup
+ *      a[7] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *      # With arguments start and length.
+ *      a = a_orig.dup
+ *      a[0, 2] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6, 50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *      # With argument range.
+ *      a = a_orig.dup
+ *      a[0..1] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6..50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  When Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] = 'foo' # => "foo"
+ *    a # => ["foo", "bar", 2]
+ *
+ *  If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[7] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *  If +index+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] = 'two' # => "two"
+ *    a # => [:foo, "bar", "two"]
+ *
+ *  When Integer arguments +start+ and +length+ are given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  If +start+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2, 2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ *  extends the array with +nil+, assigns +object+ at offset +start+,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6, 50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If +length+ is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If +length+ is too large for the existing array, does not extend the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  When Range argument +range+ is given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2..2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If the array length is less than <tt>range.begin</tt>,
+ *  extends the array with +nil+, assigns +object+ at offset <tt>range.begin</tt>,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6..50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-1] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", 2]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-3] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *    a = [:foo, 'bar', 2]
+ *
+ *  If <tt>range.end</tt> is too large for the existing array,
+ *  replaces array elements, but does not extend the array with +nil+ values:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
 
+    rb_check_arity(argc, 2, 3);
+    rb_ary_modify_check(ary);
     if (argc == 3) {
-	rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
-	return argv[2];
-    }
-    if (argc != 2) {
-	rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
+        beg = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
     }
     if (FIXNUM_P(argv[0])) {
-	offset = FIX2LONG(argv[0]);
-	goto fixnum;
+        offset = FIX2LONG(argv[0]);
+        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
     }
-    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
-	/* check if idx is Range */
-	rb_ary_splice(ary, beg, len, argv[1]);
-	return argv[1];
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+        /* check if idx is Range */
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
     }
 
     offset = NUM2LONG(argv[0]);
-fixnum:
-    rb_ary_store(ary, offset, argv[1]);
-    return argv[1];
+    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
 }
 
 /*
  *  call-seq:
- *     array.insert(index, obj...)  -> array
- *  
- *  Inserts the given values before the element with the given index
- *  (which may be negative).
- *     
- *     a = %w{ a b c d }
- *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
- *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ *    insert(index, *objects) -> self
+ *
+ *  Inserts the given +objects+ as elements of +self+;
+ *  returns +self+.
+ *
+ *  When +index+ is non-negative, inserts +objects+
+ *  _before_ the element at offset +index+:
+ *
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(1, :x, :y, :z) # => ["a", :x, :y, :z, "b", "c"]
+ *
+ *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
+ *
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(5, :x, :y, :z) # => ["a", "b", "c", nil, nil, :x, :y, :z]
+ *
+ *  When +index+ is negative, inserts +objects+
+ *  _after_ the element at offset <tt>index + self.size</tt>:
+ *
+ *    a = ['a', 'b', 'c']      # => ["a", "b", "c"]
+ *    a.insert(-2, :x, :y, :z) # => ["a", "b", :x, :y, :z, "c"]
+ *
+ *  With no +objects+ given, does nothing:
+ *
+ *    a = ['a', 'b', 'c'] # => ["a", "b", "c"]
+ *    a.insert(1)         # => ["a", "b", "c"]
+ *    a.insert(50)        # => ["a", "b", "c"]
+ *    a.insert(-50)       # => ["a", "b", "c"]
+ *
+ *  Raises IndexError if +objects+ are given and +index+ is negative and out of range.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
-rb_ary_insert(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 {
     long pos;
 
-    if (argc < 1) {
-	rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
-    }
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    rb_ary_modify_check(ary);
     pos = NUM2LONG(argv[0]);
+    if (argc == 1) return ary;
     if (pos == -1) {
-	pos = RARRAY(ary)->len;
+        pos = RARRAY_LEN(ary);
     }
     else if (pos < 0) {
-	pos++;
-    }
-
-    if (argc == 1) return ary;
-    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+        long minpos = -RARRAY_LEN(ary) - 1;
+        if (pos < minpos) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     pos, minpos);
+        }
+        pos++;
+    }
+    rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
     return ary;
 }
 
+static VALUE
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
+{
+    return rb_ary_length(ary);
+}
+
+// These array primitives enable tight compatibility with the C implementation
+// in terms of what method calls happen. They can use unchecked utilities such as
+// FIX2LONG since unlike userland Ruby code, these methods cannot be traced with
+// TracePoint (or ruby/debug.h APIs) and have their local variables changed from
+// underneath them.
+
+// Return true if the index is at or past the end of the array.
+VALUE
+rb_jit_ary_at_end(rb_execution_context_t *ec, VALUE self, VALUE index)
+{
+    return FIX2LONG(index) >= RARRAY_LEN(self) ? Qtrue : Qfalse;
+}
+
+// Return the element at the given fixnum index.
+VALUE
+rb_jit_ary_at(rb_execution_context_t *ec, VALUE self, VALUE index)
+{
+    return RARRAY_AREF(self, FIX2LONG(index));
+}
+
+// Increment a fixnum by 1.
+VALUE
+rb_jit_fixnum_inc(rb_execution_context_t *ec, VALUE self, VALUE num)
+{
+    return LONG2FIX(FIX2LONG(num) + 1);
+}
+
+// Push a value onto an array and return the value.
+VALUE
+rb_jit_ary_push(rb_execution_context_t *ec, VALUE self, VALUE ary, VALUE val)
+{
+    rb_ary_push(ary, val);
+    return val;
+}
+
 /*
  *  call-seq:
- *     array.each {|item| block }   ->   array
- *  
- *  Calls <i>block</i> once for each element in <i>self</i>, passing that
- *  element as a parameter.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.each {|x| print x, " -- " }
- *     
- *  produces:
- *     
- *     a -- b -- c --
+ *    each {|element| ... } -> self
+ *    each -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each element to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element|  puts "#{element.class} #{element}" }
+ *
+ *  Output:
+ *
+ *    Symbol foo
+ *    String bar
+ *    Integer 2
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *
+ *  Output:
+ *
+ *    foo
+ *    bar
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 VALUE
-rb_ary_each(ary)
-    VALUE ary;
+rb_ary_each(VALUE ary)
 {
     long i;
-
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	rb_yield(RARRAY(ary)->ptr[i]);
+    ary_verify(ary);
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.each_index {|index| block }  ->  array
- *  
- *  Same as <code>Array#each</code>, but passes the index of the element
- *  instead of the element itself.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.each_index {|x| print x, " -- " }
- *     
- *  produces:
- *     
- *     0 -- 1 -- 2 --
+ *    each_index {|index| ... } -> self
+ *    each_index -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each <i>array index</i> to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index|  puts "#{index} #{a[index]}" }
+ *
+ *  Output:
+ *
+ *    0 foo
+ *    1 bar
+ *    2 2
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index| puts index; a.clear if index > 0 }
+ *    a # => []
+ *
+ *  Output:
+ *
+ *    0
+ *    1
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
-rb_ary_each_index(ary)
-    VALUE ary;
+rb_ary_each_index(VALUE ary)
 {
     long i;
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	rb_yield(LONG2NUM(i));
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        rb_yield(LONG2NUM(i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.reverse_each {|item| block } 
- *  
- *  Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
- *  order.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.reverse_each {|x| print x, " " }
- *     
- *  produces:
- *     
- *     c b a
+ *    reverse_each {|element| ... } -> self
+ *    reverse_each -> Enumerator
+ *
+ *  When a block given, iterates backwards over the elements of +self+,
+ *  passing, in reverse order, each element to the block;
+ *  returns +self+:
+ *
+ *    a = []
+ *    [0, 1, 2].reverse_each {|element| a.push(element) }
+ *    a # => [2, 1, 0]
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = ['a', 'b', 'c']
+ *    a.reverse_each {|element| a.clear if element.start_with?('b') }
+ *    a # => []
+ *
+ *  When no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
-rb_ary_reverse_each(ary)
-    VALUE ary;
+rb_ary_reverse_each(VALUE ary)
 {
-    long len = RARRAY(ary)->len;
+    long len;
 
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    len = RARRAY_LEN(ary);
     while (len--) {
-	rb_yield(RARRAY(ary)->ptr[len]);
-	if (RARRAY(ary)->len < len) {
-	    len = RARRAY(ary)->len;
-	}
+        long nlen;
+        rb_yield(RARRAY_AREF(ary, len));
+        nlen = RARRAY_LEN(ary);
+        if (nlen < len) {
+            len = nlen;
+        }
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.length -> int
- *  
- *  Returns the number of elements in <i>self</i>. May be zero.
- *     
- *     [ 1, 2, 3, 4, 5 ].length   #=> 5
+ *    length -> integer
+ *    size -> integer
+ *
+ *  Returns the count of elements in +self+:
+ *
+ *    [0, 1, 2].length # => 3
+ *    [].length        # => 0
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_length(ary)
-    VALUE ary;
+rb_ary_length(VALUE ary)
 {
-    return LONG2NUM(RARRAY(ary)->len);
+    long len = RARRAY_LEN(ary);
+    return LONG2NUM(len);
 }
 
 /*
  *  call-seq:
- *     array.empty?   -> true or false
- *  
- *  Returns <code>true</code> if <i>self</i> array contains no elements.
- *     
- *     [].empty?   #=> true
+ *    empty?  -> true or false
+ *
+ *  Returns +true+ if the count of elements in +self+ is zero,
+ *  +false+ otherwise.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_empty_p(ary)
-    VALUE ary;
+rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0)
-	return Qtrue;
-    return Qfalse;
+    return RBOOL(RARRAY_LEN(ary) == 0);
 }
 
 VALUE
-rb_ary_dup(ary)
-    VALUE ary;
+rb_ary_dup(VALUE ary)
 {
-    VALUE dup = rb_ary_new2(RARRAY(ary)->len);
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(dup, len);
 
-    DUPSETUP(dup, ary);
-    MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-    RARRAY(dup)->len = RARRAY(ary)->len;
+    ary_verify(ary);
+    ary_verify(dup);
     return dup;
 }
 
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+}
+
 extern VALUE rb_output_fs;
 
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
 static VALUE
-inspect_join(ary, arg)
-    VALUE ary;
-    VALUE *arg;
+recursive_join(VALUE obj, VALUE argp, int recur)
+{
+    VALUE *arg = (VALUE *)argp;
+    VALUE ary = arg[0];
+    VALUE sep = arg[1];
+    VALUE result = arg[2];
+    int *first = (int *)arg[3];
+
+    if (recur) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        ary_join_1(obj, ary, sep, 0, result, first);
+    }
+    return Qnil;
+}
+
+static long
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+{
+    long i;
+    VALUE val;
+
+    if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
+    for (i=0; i<max; i++) {
+        val = RARRAY_AREF(ary, i);
+        if (!RB_TYPE_P(val, T_STRING)) break;
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+        rb_str_buf_append(result, val);
+    }
+    return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
 {
-    return rb_ary_join(arg[0], arg[1]);
+    rb_str_buf_append(dst, src);
+    if (*first) {
+        rb_enc_copy(dst, src);
+        *first = FALSE;
+    }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+    if (val == ary) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        VALUE args[4];
+
+        *first = FALSE;
+        args[0] = val;
+        args[1] = sep;
+        args[2] = result;
+        args[3] = (VALUE)first;
+        rb_exec_recursive(recursive_join, obj, (VALUE)args);
+    }
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+    VALUE val, tmp;
+
+    for (; i<RARRAY_LEN(ary); i++) {
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+
+        val = RARRAY_AREF(ary, i);
+        if (RB_TYPE_P(val, T_STRING)) {
+            ary_join_1_str(result, val, first);
+        }
+        else if (RB_TYPE_P(val, T_ARRAY)) {
+            ary_join_1_ary(val, ary, sep, result, val, first);
+        }
+        else if (!NIL_P(tmp = rb_check_string_type(val))) {
+            ary_join_1_str(result, tmp, first);
+        }
+        else if (!NIL_P(tmp = rb_check_array_type(val))) {
+            ary_join_1_ary(val, ary, sep, result, tmp, first);
+        }
+        else {
+            ary_join_1_str(result, rb_obj_as_string(val), first);
+        }
+    }
 }
 
 VALUE
-rb_ary_join(ary, sep)
-    VALUE ary, sep;
+rb_ary_join(VALUE ary, VALUE sep)
 {
     long len = 1, i;
-    int taint = Qfalse;
-    VALUE result, tmp;
+    VALUE val, tmp, result;
 
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
-	len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
-    }
     if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
-    }
-    result = rb_str_buf_new(len);
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	tmp = RARRAY(ary)->ptr[i];
-	switch (TYPE(tmp)) {
-	  case T_STRING:
-	    break;
-	  case T_ARRAY:
-	    if (rb_inspecting_p(tmp)) {
-		tmp = rb_str_new2("[...]");
-	    }
-	    else {
-		VALUE args[2];
-
-		args[0] = tmp;
-		args[1] = sep;
-		tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
-	    }
-	    break;
-	  default:
-	    tmp = rb_obj_as_string(tmp);
-	}
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, tmp);
-	if (OBJ_TAINTED(tmp)) taint = Qtrue;
-    }
-
-    if (taint) OBJ_TAINT(result);
+        StringValue(sep);
+        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    long len_memo = RARRAY_LEN(ary);
+    for (i=0; i < len_memo; i++) {
+        val = RARRAY_AREF(ary, i);
+        if (RB_UNLIKELY(!RB_TYPE_P(val, T_STRING))) {
+            tmp = rb_check_string_type(val);
+            if (NIL_P(tmp) || tmp != val) {
+                int first;
+                long n = RARRAY_LEN(ary);
+                if (i > n) i = n;
+                result = rb_str_buf_new(len + (n-i)*10);
+                rb_enc_associate(result, rb_usascii_encoding());
+                i = ary_join_0(ary, sep, i, result);
+                first = i == 0;
+                ary_join_1(ary, ary, sep, i, result, &first);
+                return result;
+            }
+            len += RSTRING_LEN(tmp);
+            len_memo = RARRAY_LEN(ary);
+        }
+        else {
+            len += RSTRING_LEN(val);
+        }
+    }
+
+    result = rb_str_new(0, len);
+    rb_str_set_len(result, 0);
+
+    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
+
     return result;
 }
 
 /*
  *  call-seq:
- *     array.join(sep=$,)    -> str
- *  
- *  Returns a string created by converting each element of the array to
- *  a string, separated by <i>sep</i>.
- *     
- *     [ "a", "b", "c" ].join        #=> "abc"
- *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
+ *    join(separator = $,) -> new_string
+ *
+ *  Returns the new string formed by joining the converted elements of +self+;
+ *  for each element +element+:
+ *
+ *  - Converts recursively using <tt>element.join(separator)</tt>
+ *    if +element+ is a <tt>kind_of?(Array)</tt>.
+ *  - Otherwise, converts using <tt>element.to_s</tt>.
+ *
+ *  With no argument given, joins using the output field separator, <tt>$,</tt>:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    $, # => nil
+ *    a.join # => "foobar2"
+ *
+ *  With string argument +separator+ given, joins using that separator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.join("\n") # => "foo\nbar\n2"
+ *
+ *  Joins recursively for nested arrays:
+ *
+ *   a = [:foo, [:bar, [:baz, :bat]]]
+ *   a.join # => "foobarbazbat"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
-
 static VALUE
-rb_ary_join_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    rb_scan_args(argc, argv, "01", &sep);
-    if (NIL_P(sep)) sep = rb_output_fs;
-    
+    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+        sep = rb_output_fs;
+        if (!NIL_P(sep)) {
+            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+        }
+    }
+
     return rb_ary_join(ary, sep);
 }
 
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
+{
+    long i;
+    VALUE s, str;
+
+    if (recur) return rb_usascii_str_new_cstr("[...]");
+    str = rb_str_buf_new2("[");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        s = rb_inspect(RARRAY_AREF(ary, i));
+        if (i > 0) rb_str_buf_cat2(str, ", ");
+        else rb_enc_copy(str, s);
+        rb_str_buf_append(str, s);
+    }
+    rb_str_buf_cat2(str, "]");
+    return str;
+}
+
 /*
  *  call-seq:
- *     array.to_s -> string
- *  
- *  Returns _self_<code>.join</code>.
- *     
- *     [ "a", "e", "i", "o" ].to_s   #=> "aeio"
+ *    inspect -> new_string
+ *    to_s -> new_string
  *
+ *  Returns the new string formed by calling method <tt>#inspect</tt>
+ *  on each array element:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.inspect # => "[:foo, \"bar\", 2]"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
-VALUE
-rb_ary_to_s(ary)
-    VALUE ary;
+static VALUE
+rb_ary_inspect(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    
-    return rb_ary_join(ary, rb_output_fs);
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+    return rb_exec_recursive(inspect_ary, ary, 0);
 }
 
-static ID inspect_key;
+VALUE
+rb_ary_to_s(VALUE ary)
+{
+    return rb_ary_inspect(ary);
+}
 
-struct inspect_arg {
-    VALUE (*func)();
-    VALUE arg1, arg2;
-};
+/*
+ *  call-seq:
+ *    to_a -> self or new_array
+ *
+ *  When +self+ is an instance of \Array, returns +self+.
+ *
+ *  Otherwise, returns a new array containing the elements of +self+:
+ *
+ *    class MyArray < Array; end
+ *    my_a = MyArray.new(['foo', 'bar', 'two'])
+ *    a = my_a.to_a
+ *    a # => ["foo", "bar", "two"]
+ *    a.class # => Array # Not MyArray.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
 
 static VALUE
-inspect_call(arg)
-    struct inspect_arg *arg;
+rb_ary_to_a(VALUE ary)
 {
-    return (*arg->func)(arg->arg1, arg->arg2);
+    if (rb_obj_class(ary) != rb_cArray) {
+        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+        rb_ary_replace(dup, ary);
+        return dup;
+    }
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *    to_h -> new_hash
+ *    to_h {|element| ... } -> new_hash
+ *
+ *  Returns a new hash formed from +self+.
+ *
+ *  With no block given, each element of +self+ must be a 2-element sub-array;
+ *  forms each sub-array into a key-value pair in the new hash:
+ *
+ *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ *    a.to_h # => {"foo" => "zero", "bar" => "one", "baz" => "two"}
+ *    [].to_h # => {}
+ *
+ *  With a block given, the block must return a 2-element array;
+ *  calls the block with each element of +self+;
+ *  forms each returned array into a key-value pair in the returned hash:
+ *
+ *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ *    a.to_h {|element| [element, element.class] }
+ *    # => {"foo" => String, bar: Symbol, 1 => Integer, [2, 3] => Array, {baz: 4} => Hash}
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
 static VALUE
-get_inspect_tbl(create)
-    int create;
+rb_ary_to_h(VALUE ary)
 {
-    VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-
-    if (NIL_P(inspect_tbl)) {
-	if (create) {
-	  tbl_init:
-	    inspect_tbl = rb_ary_new();
-	    rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
-	}
-    }
-    else if (TYPE(inspect_tbl) != T_ARRAY) {
-	rb_warn("invalid inspect_tbl value");
-	if (create) goto tbl_init;
-	rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
-	return Qnil;
+    long i;
+    VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+    int block_given = rb_block_given_p();
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        const VALUE e = rb_ary_elt(ary, i);
+        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+        const VALUE key_value_pair = rb_check_array_type(elt);
+        if (NIL_P(key_value_pair)) {
+            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+                     rb_obj_class(elt), i);
+        }
+        if (RARRAY_LEN(key_value_pair) != 2) {
+            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+                i, RARRAY_LEN(key_value_pair));
+        }
+        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
-    return inspect_tbl;
+    return hash;
 }
 
+/*
+ *  call-seq:
+ *    to_ary -> self
+ *
+ *  Returns +self+.
+ */
+
 static VALUE
-inspect_ensure(obj)
-    VALUE obj;
+rb_ary_to_ary_m(VALUE ary)
 {
-    VALUE inspect_tbl;
-
-    inspect_tbl = get_inspect_tbl(Qfalse);
-    if (!NIL_P(inspect_tbl)) {
-	rb_ary_pop(inspect_tbl);
-    }
-    return 0;
+    return ary;
 }
 
-VALUE
-rb_protect_inspect(func, obj, arg)
-    VALUE (*func)(ANYARGS);
-    VALUE obj, arg;
+static void
+ary_reverse(VALUE *p1, VALUE *p2)
 {
-    struct inspect_arg iarg;
-    VALUE inspect_tbl;
-    VALUE id;
-
-    inspect_tbl = get_inspect_tbl(Qtrue);
-    id = rb_obj_id(obj);
-    if (rb_ary_includes(inspect_tbl, id)) {
-	return (*func)(obj, arg);
+    while (p1 < p2) {
+        VALUE tmp = *p1;
+        *p1++ = *p2;
+        *p2-- = tmp;
     }
-    rb_ary_push(inspect_tbl, id);
-    iarg.func = func;
-    iarg.arg1 = obj;
-    iarg.arg2 = arg;
-
-    return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
 }
 
 VALUE
-rb_inspecting_p(obj)
-    VALUE obj;
-{
-    VALUE inspect_tbl;
-
-    inspect_tbl = get_inspect_tbl(Qfalse);
-    if (NIL_P(inspect_tbl)) return Qfalse;
-    return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
-}
-
-static VALUE
-inspect_ary(ary)
-    VALUE ary;
+rb_ary_reverse(VALUE ary)
 {
-    int tainted = OBJ_TAINTED(ary);
-    long i;
-    VALUE s, str;
+    VALUE *p2;
+    long len = RARRAY_LEN(ary);
 
-    str = rb_str_buf_new2("[");
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	s = rb_inspect(RARRAY(ary)->ptr[i]);
-	if (OBJ_TAINTED(s)) tainted = Qtrue;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	rb_str_buf_append(str, s);
+    rb_ary_modify(ary);
+    if (len > 1) {
+        RARRAY_PTR_USE(ary, p1, {
+            p2 = p1 + len - 1;	/* points last item */
+            ary_reverse(p1, p2);
+        }); /* WB: no new reference */
     }
-    rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
-    return str;
+    return ary;
 }
 
 /*
  *  call-seq:
- *     array.inspect  -> string
+ *    reverse! -> self
+ *
+ *  Reverses the order of the elements of +self+;
+ *  returns +self+:
+ *
+ *    a = [0, 1, 2]
+ *    a.reverse! # => [2, 1, 0]
+ *    a          # => [2, 1, 0]
  *
- *  Create a printable version of <i>array</i>.
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
-rb_ary_inspect(ary)
-    VALUE ary;
+rb_ary_reverse_bang(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
-    if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
-    return rb_protect_inspect(inspect_ary, ary, 0);
+    return rb_ary_reverse(ary);
 }
 
 /*
  *  call-seq:
- *     array.to_a     -> array
- *  
- *  Returns _self_. If called on a subclass of Array, converts
- *  the receiver to an Array object.
+ *    reverse -> new_array
+ *
+ *  Returns a new array containing the elements of +self+ in reverse order:
+ *
+ *    [0, 1, 2].reverse # => [2, 1, 0]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
-rb_ary_to_a(ary)
-    VALUE ary;
+rb_ary_reverse_m(VALUE ary)
 {
-    if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY(ary)->len);
-	rb_ary_replace(dup, ary);
-	return dup;
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+
+    if (len > 0) {
+        const VALUE *p1 = RARRAY_CONST_PTR(ary);
+        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+        do *p2-- = *p1++; while (--len > 0);
     }
-    return ary;
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
 }
 
-/*
- *  call-seq:
- *     array.to_ary -> array
- *  
- *  Returns _self_.
- */
+static inline long
+rotate_count(long cnt, long len)
+{
+    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+}
 
-static VALUE
-rb_ary_to_ary_m(ary)
-    VALUE ary;
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
 {
-    return ary;
+    if (cnt == 1) {
+        VALUE tmp = *ptr;
+        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+        *(ptr + len - 1) = tmp;
+    }
+    else if (cnt == len - 1) {
+        VALUE tmp = *(ptr + len - 1);
+        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+        *ptr = tmp;
+    }
+    else {
+        --len;
+        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+        if (len > 0) ary_reverse(ptr, ptr + len);
+    }
 }
 
 VALUE
-rb_ary_reverse(ary)
-    VALUE ary;
+rb_ary_rotate(VALUE ary, long cnt)
 {
-    VALUE *p1, *p2;
-    VALUE tmp;
-
     rb_ary_modify(ary);
-    if (RARRAY(ary)->len > 1) {
-	p1 = RARRAY(ary)->ptr;
-	p2 = p1 + RARRAY(ary)->len - 1;	/* points last item */
 
-	while (p1 < p2) {
-	    tmp = *p1;
-	    *p1++ = *p2;
-	    *p2-- = tmp;
-	}
+    if (cnt != 0) {
+        long len = RARRAY_LEN(ary);
+        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+            RARRAY_PTR_USE(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+            return ary;
+        }
     }
-    return ary;
+    return Qnil;
 }
 
 /*
  *  call-seq:
- *     array.reverse!   -> array 
- *  
- *  Reverses _self_ in place.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
+ *    rotate!(count = 1) -> self
+ *
+ *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates +count+ elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate!(2)   # => [2, 3, 0, 1]
+      [0, 1, 2, 3].rotate!(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(21) # => [1, 2, 3, 0]
+ *
+ *  If +count+ is zero, rotates no elements:
+ *
+ *    [0, 1, 2, 3].rotate!(0) # => [0, 1, 2, 3]
+ *
+ *  With a negative numeric +count+, rotates in the opposite direction,
+ *  from end to beginning:
+ *
+ *    [0, 1, 2, 3].rotate!(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
-rb_ary_reverse_bang(ary)
-    VALUE ary;
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_ary_reverse(ary);
+    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+    rb_ary_rotate(ary, n);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     array.reverse -> an_array
- *  
- *  Returns a new array containing <i>self</i>'s elements in reverse order.
- *     
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
+ *    rotate(count = 1) -> new_array
+ *
+ *  Returns a new array formed from +self+ with elements
+ *  rotated from one end to the other.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate(2)   # => [2, 3, 0, 1]
+ *    [0, 1, 2, 3].rotate(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(22) # => [2, 3, 0, 1]
+ *
+ *  With a +count+ of zero, rotates no elements:
+ *
+ *    [0, 1, 2, 3].rotate(0) # => [0, 1, 2, 3]
+ *
+ *  With negative numeric +count+, rotates in the opposite direction,
+ *  from the end to the beginning:
+ *
+ *    [0, 1, 2, 3].rotate(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
-rb_ary_reverse_m(ary)
-    VALUE ary;
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_ary_reverse(rb_ary_dup(ary));
+    VALUE rotated;
+    const VALUE *ptr;
+    long len;
+    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+
+    len = RARRAY_LEN(ary);
+    rotated = rb_ary_new2(len);
+    if (len > 0) {
+        cnt = rotate_count(cnt, len);
+        ptr = RARRAY_CONST_PTR(ary);
+        len -= cnt;
+        ary_memcpy(rotated, 0, len, ptr + cnt);
+        ary_memcpy(rotated, len, cnt, ptr);
+    }
+    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+    return rotated;
 }
 
 struct ary_sort_data {
     VALUE ary;
-    VALUE *ptr;
-    long len;
+    VALUE receiver;
 };
 
+static VALUE
+sort_reentered(VALUE ary)
+{
+    if (RBASIC(ary)->klass) {
+        rb_raise(rb_eRuntimeError, "sort reentered");
+    }
+    return Qnil;
+}
+
 static void
-ary_sort_check(data)
-    struct ary_sort_data *data;
+sort_returned(struct ary_sort_data *data)
 {
-    if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
-	rb_raise(rb_eRuntimeError, "array modified during sort");
+    if (rb_obj_frozen_p(data->receiver)) {
+        rb_raise(rb_eFrozenError, "array frozen during sort");
     }
+    sort_reentered(data->ary);
 }
 
 static int
-sort_1(a, b, data)
-    VALUE *a, *b;
-    struct ary_sort_data *data;
+sort_1(const void *ap, const void *bp, void *dummy)
 {
-    VALUE retval = rb_yield_values(2, *a, *b);
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    VALUE args[2];
     int n;
 
-    n = rb_cmpint(retval, *a, *b);
-    ary_sort_check(data);
+    args[0] = a;
+    args[1] = b;
+    retval = rb_yield_values2(2, args);
+    n = rb_cmpint(retval, a, b);
+    sort_returned(data);
     return n;
 }
 
 static int
-sort_2(ap, bp, data)
-    VALUE *ap, *bp;
-    struct ary_sort_data *data;
+sort_2(const void *ap, const void *bp, void *dummy)
 {
-    VALUE retval;
-    VALUE a = *ap, b = *bp;
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b)) {
-	if ((long)a > (long)b) return 1;
-	if ((long)a < (long)b) return -1;
-	return 0;
+    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+        if ((long)a > (long)b) return 1;
+        if ((long)a < (long)b) return -1;
+        return 0;
+    }
+    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+        return rb_str_cmp(a, b);
     }
-    if (TYPE(a) == T_STRING && TYPE(b) == T_STRING) {
-	return rb_str_cmp(a, b);
+    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+        return rb_float_cmp(a, b);
     }
 
-    retval = rb_funcall(a, id_cmp, 1, b);
+    retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    ary_sort_check(data);
+    sort_returned(data);
 
     return n;
 }
 
-static VALUE
-sort_internal(ary)
-    VALUE ary;
-{
-    struct ary_sort_data data;
+/*
+ *  call-seq:
+ *    sort! -> self
+ *    sort! {|a, b| ... } -> self
+ *
+ *  Like Array#sort, but returns +self+ with its elements sorted in place.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
 
-    data.ary = ary;
-    data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
-    qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
-	  rb_block_given_p()?sort_1:sort_2, &data);
+VALUE
+rb_ary_sort_bang(VALUE ary)
+{
+    rb_ary_modify(ary);
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    if (RARRAY_LEN(ary) > 1) {
+        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+        struct ary_sort_data data;
+        long len = RARRAY_LEN(ary);
+        RBASIC_CLEAR_CLASS(tmp);
+        data.ary = tmp;
+        data.receiver = ary;
+        RARRAY_PTR_USE(tmp, ptr, {
+            ruby_qsort(ptr, len, sizeof(VALUE),
+                       rb_block_given_p()?sort_1:sort_2, &data);
+        }); /* WB: no new reference */
+        rb_ary_modify(ary);
+        if (ARY_EMBED_P(tmp)) {
+            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+                rb_ary_unshare(ary);
+                FL_SET_EMBED(ary);
+            }
+            if (ARY_EMBED_LEN(tmp) > ARY_CAPA(ary)) {
+                ary_resize_capa(ary, ARY_EMBED_LEN(tmp));
+            }
+            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+        }
+        else {
+            if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+                FL_UNSET_SHARED(ary);
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+            }
+            else {
+                RUBY_ASSERT(!ARY_SHARED_P(tmp));
+                if (ARY_EMBED_P(ary)) {
+                    FL_UNSET_EMBED(ary);
+                }
+                else if (ARY_SHARED_P(ary)) {
+                    /* ary might be destructively operated in the given block */
+                    rb_ary_unshare(ary);
+                }
+                else {
+                    ary_heap_free(ary);
+                }
+                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
+                ARY_SET_HEAP_LEN(ary, len);
+                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
+            }
+            /* tmp was lost ownership for the ptr */
+            FL_SET_EMBED(tmp);
+            ARY_SET_EMBED_LEN(tmp, 0);
+            OBJ_FREEZE(tmp);
+        }
+        /* tmp will be GC'ed. */
+        RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
+    }
+    ary_verify(ary);
     return ary;
 }
 
-static VALUE
-sort_unlock(ary)
-    VALUE ary;
+/*
+ *  call-seq:
+ *    sort -> new_array
+ *    sort {|a, b| ... } -> new_array
+ *
+ *  Returns a new array containing the elements of +self+, sorted.
+ *
+ *  With no block given, compares elements using operator <tt>#<=></tt>
+ *  (see Object#<=>):
+ *
+ *    [0, 2, 3, 1].sort # => [0, 1, 2, 3]
+ *
+ *  With a block given, calls the block with each combination of pairs of elements from +self+;
+ *  for each pair +a+ and +b+, the block should return a numeric:
+ *
+ *  - Negative when +b+ is to follow +a+.
+ *  - Zero when +a+ and +b+ are equivalent.
+ *  - Positive when +a+ is to follow +b+.
+ *
+ *  Example:
+ *
+ *    a = [3, 2, 0, 1]
+ *    a.sort {|a, b| a <=> b } # => [0, 1, 2, 3]
+ *    a.sort {|a, b| b <=> a } # => [3, 2, 1, 0]
+ *
+ *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ *  and may be unstable.
+ *
+ *  See an example in Numeric#nonzero? for the idiom to sort more
+ *  complex structure.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+VALUE
+rb_ary_sort(VALUE ary)
 {
-    FL_UNSET(ary, ARY_TMPLOCK);
+    ary = rb_ary_dup(ary);
+    rb_ary_sort_bang(ary);
     return ary;
 }
 
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
 /*
  *  call-seq:
- *     array.sort!                   -> array
- *     array.sort! {| a,b | block }  -> array 
- *  
- *  Sorts _self_. Comparisons for
- *  the sort will be done using the <code><=></code> operator or using
- *  an optional code block. The block implements a comparison between
- *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- *  <code>Enumerable#sort_by</code>.
- *     
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ *    bsearch {|element| ... } -> found_element or nil
+ *    bsearch -> new_enumerator
+ *
+ *  Returns the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
-VALUE
-rb_ary_sort_bang(ary)
-    VALUE ary;
+static VALUE
+rb_ary_bsearch(VALUE ary)
 {
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len > 1) {
-	FL_SET(ary, ARY_TMPLOCK);	/* prohibit modification during sort */
-	rb_ensure(sort_internal, ary, sort_unlock, ary);
+    VALUE index_result = rb_ary_bsearch_index(ary);
+
+    if (FIXNUM_P(index_result)) {
+        return rb_ary_entry(ary, FIX2LONG(index_result));
     }
-    return ary;
+    return index_result;
 }
 
 /*
  *  call-seq:
- *     array.sort                   -> an_array 
- *     array.sort {| a,b | block }  -> an_array 
- *  
- *  Returns a new array created by sorting <i>self</i>. Comparisons for
- *  the sort will be done using the <code><=></code> operator or using
- *  an optional code block. The block implements a comparison between
- *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- *  <code>Enumerable#sort_by</code>.
- *     
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ *    bsearch_index {|element| ... } -> integer or nil
+ *    bsearch_index -> new_enumerator
+ *
+ *  Returns the integer index of the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
-VALUE
-rb_ary_sort(ary)
-    VALUE ary;
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_sort_bang(ary);
+    long low = 0, high = RARRAY_LEN(ary), mid;
+    int smaller = 0, satisfied = 0;
+    VALUE v, val;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    while (low < high) {
+        mid = low + ((high - low) / 2);
+        val = rb_ary_entry(ary, mid);
+        v = rb_yield(val);
+        if (FIXNUM_P(v)) {
+            if (v == INT2FIX(0)) return INT2FIX(mid);
+            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+        }
+        else if (v == Qtrue) {
+            satisfied = 1;
+            smaller = 1;
+        }
+        else if (!RTEST(v)) {
+            smaller = 0;
+        }
+        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+            const VALUE zero = INT2FIX(0);
+            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+              case 0: return INT2FIX(mid);
+              case 1: smaller = 0; break;
+              case -1: smaller = 1;
+            }
+        }
+        else {
+            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+                     " (must be numeric, true, false or nil)",
+                     rb_obj_class(v));
+        }
+        if (smaller) {
+            high = mid;
+        }
+        else {
+            low = mid + 1;
+        }
+    }
+    if (!satisfied) return Qnil;
+    return INT2FIX(low);
+}
+
+
+static VALUE
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+{
+    return rb_yield(i);
+}
+
+/*
+ *  call-seq:
+ *    sort_by! {|element| ... } -> self
+ *    sort_by! -> new_enumerator
+ *
+ *  With a block given, sorts the elements of +self+ in place;
+ *  returns self.
+ *
+ *  Calls the block with each successive element;
+ *  sorts elements based on the values returned from the block:
+ *
+ *    a = ['aaaa', 'bbb', 'cc', 'd']
+ *    a.sort_by! {|element| element.size }
+ *    a # => ["d", "cc", "bbb", "aaaa"]
+ *
+ *  For duplicate values returned by the block, the ordering is indeterminate, and may be unstable.
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+    VALUE sorted;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > 1) {
+        sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+        rb_ary_replace(ary, sorted);
+    }
     return ary;
 }
 
+
 /*
  *  call-seq:
- *     array.collect {|item| block }  -> an_array
- *     array.map     {|item| block }  -> an_array
- *  
- *  Invokes <i>block</i> once for each element of <i>self</i>. Creates a 
- *  new array containing the values returned by the block.
- *  See also <code>Enumerable#collect</code>.
- *     
- *     a = [ "a", "b", "c", "d" ]
- *     a.collect {|x| x + "!" }   #=> ["a!", "b!", "c!", "d!"]
- *     a                          #=> ["a", "b", "c", "d"]
+ *    collect {|element| ... } -> new_array
+ *    collect -> new_enumerator
+ *    map {|element| ... } -> new_array
+ *    map -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array whose elements are the return values from the block:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map {|element| element.class }
+ *    a1 # => [Symbol, String, Integer]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: #collect!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
-rb_ary_collect(ary)
-    VALUE ary;
+rb_ary_collect(VALUE ary)
 {
     long i;
     VALUE collect;
 
-    if (!rb_block_given_p()) {
-	return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
-    }
-
-    collect = rb_ary_new2(RARRAY(ary)->len);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    collect = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
 
-/* 
+
+/*
  *  call-seq:
- *     array.collect! {|item| block }   ->   array
- *     array.map!     {|item| block }   ->   array
+ *    collect! {|element| ... } -> self
+ *    collect! -> new_enumerator
+ *    map! {|element| ... } -> self
+ *    map! -> new_enumerator
  *
- *  Invokes the block once for each element of _self_, replacing the
- *  element with the value returned by _block_.
- *  See also <code>Enumerable#collect</code>.
- *   
- *     a = [ "a", "b", "c", "d" ]
- *     a.collect! {|x| x + "!" }
- *     a             #=>  [ "a!", "b!", "c!", "d!" ]
+ *  With a block given, calls the block with each element of +self+
+ *  and replaces the element with the block's return value;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.map! { |element| element.class } # => [Symbol, String, Integer]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: #collect;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
-rb_ary_collect_bang(ary)
-    VALUE ary;
+rb_ary_collect_bang(VALUE ary)
 {
     long i;
 
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
 
 VALUE
-rb_get_values_at(obj, olen, argc, argv, func)
-    VALUE obj;
-    long olen;
-    int argc;
-    VALUE *argv;
-    VALUE (*func) _((VALUE,long));
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
 {
     VALUE result = rb_ary_new2(argc);
     long beg, len, i, j;
 
     for (i=0; i<argc; i++) {
-	if (FIXNUM_P(argv[i])) {
-	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-	    continue;
-	}
-	/* check if idx is Range */
-	switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
-	  case Qfalse:
-	    break;
-	  case Qnil:
-	    continue;
-	  default:
-	    for (j=0; j<len; j++) {
-		rb_ary_push(result, (*func)(obj, j+beg));
-	    }
-	    continue;
-	}
-	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+        if (FIXNUM_P(argv[i])) {
+            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+            continue;
+        }
+        /* check if idx is Range */
+        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+            long end = olen < beg+len ? olen : beg+len;
+            for (j = beg; j < end; j++) {
+                rb_ary_push(result, (*func)(obj, j));
+            }
+            if (beg + len > j)
+                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+            continue;
+        }
+        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
     return result;
 }
 
-/* 
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+    long beg, len;
+    if (FIXNUM_P(idx)) {
+        beg = FIX2LONG(idx);
+    }
+    /* check if idx is Range */
+    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+        if (len > 0) {
+            const VALUE *const src = RARRAY_CONST_PTR(ary);
+            const long end = beg + len;
+            const long prevlen = RARRAY_LEN(result);
+            if (beg < olen) {
+                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+            }
+            if (end > olen) {
+                rb_ary_store(result, prevlen + len - 1, Qnil);
+            }
+        }
+        return result;
+    }
+    else {
+        beg = NUM2LONG(idx);
+    }
+    return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
+/*
  *  call-seq:
- *     array.values_at(selector,... )  -> an_array
+ *    values_at(*specifiers) -> new_array
+ *
+ *  Returns elements from +self+ in a new array; does not modify +self+.
+ *
+ *  The objects included in the returned array are the elements of +self+
+ *  selected by the given +specifiers+,
+ *  each of which must be a numeric index or a Range.
+ *
+ *  In brief:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *
+ *    # Index specifiers.
+ *    a.values_at(2, 0, 2, 0)     # => ["c", "a", "c", "a"] # May repeat.
+ *    a.values_at(-4, -3, -2, -1) # => ["a", "b", "c", "d"] # Counts backwards if negative.
+ *    a.values_at(-50, 50)        # => [nil, nil]           # Outside of self.
+ *
+ *    # Range specifiers.
+ *    a.values_at(1..3)       # => ["b", "c", "d"] # From range.begin to range.end.
+ *    a.values_at(1...3)      # => ["b", "c"]      # End excluded.
+ *    a.values_at(3..1)       # => []              # No such elements.
+ *
+ *    a.values_at(-3..3)  # => ["b", "c", "d"]     # Negative range.begin counts backwards.
+ *    a.values_at(-50..3)                          # Raises RangeError.
+ *
+ *    a.values_at(1..-2)  # => ["b", "c"]          # Negative range.end counts backwards.
+ *    a.values_at(1..-50) # => []                  # No such elements.
+ *
+ *    # Mixture of specifiers.
+ *    a.values_at(2..3, 3, 0..1, 0) # => ["c", "d", "d", "a", "b", "a"]
+ *
+ *  With no +specifiers+ given, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.values_at # => []
+ *
+ *  For each numeric specifier +index+, includes an element:
+ *
+ *  - For each non-negative numeric specifier +index+ that is in-range (less than <tt>self.size</tt>),
+ *    includes the element at offset +index+:
+ *
+ *      a.values_at(0, 2)     # => ["a", "c"]
+ *      a.values_at(0.1, 2.9) # => ["a", "c"]
+ *
+ *  - For each negative numeric +index+ that is in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-1, -4) # => ["d", "a"]
+ *
+ *  The given indexes may be in any order, and may repeat:
+ *
+ *    a.values_at(2, 0, 1, 0, 2) # => ["c", "a", "b", "a", "c"]
+ *
+ *  For each +index+ that is out-of-range, includes +nil+:
  *
- *  Returns an array containing the elements in
- *  _self_ corresponding to the given selector(s). The selectors
- *  may be either integer indices or ranges. 
- *  See also <code>Array#select</code>.
- * 
- *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)
- *     a.values_at(1, 3, 5, 7)
- *     a.values_at(-1, -3, -5, -7)
- *     a.values_at(1..3, 2...5)
+ *    a.values_at(4, -5) # => [nil, nil]
+ *
+ *  For each Range specifier +range+, includes elements
+ *  according to <tt>range.begin</tt> and <tt>range.end</tt>:
+ *
+ *  - If both <tt>range.begin</tt> and <tt>range.end</tt>
+ *    are non-negative and in-range (less than <tt>self.size</tt>),
+ *    includes elements from index <tt>range.begin</tt>
+ *    through <tt>range.end - 1</tt> (if <tt>range.exclude_end?</tt>),
+ *    or through <tt>range.end</tt> (otherwise):
+ *
+ *      a.values_at(1..2)  # => ["b", "c"]
+ *      a.values_at(1...2) # => ["b"]
+ *
+ *  - If <tt>range.begin</tt> is negative and in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-2..3) # => ["c", "d"]
+ *
+ *  - If <tt>range.begin</tt> is negative and out-of-range, raises an exception:
+ *
+ *      a.values_at(-5..3) # Raises RangeError.
+ *
+ *  - If <tt>range.end</tt> is positive and out-of-range,
+ *    extends the returned array with +nil+ elements:
+ *
+ *      a.values_at(1..5) # => ["b", "c", "d", nil, nil]
+ *
+ *  - If <tt>range.end</tt> is negative and in-range,
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(1..-2) # => ["b", "c"]
+ *
+ *  - If <tt>range.end</tt> is negative and out-of-range,
+ *    returns an empty array:
+ *
+ *      a.values_at(1..-5) # => []
+ *
+ *  The given ranges may be in any order and may repeat:
+ *
+ *    a.values_at(2..3, 0..1, 2..3) # => ["c", "d", "a", "b", "c", "d"]
+ *
+ *  The given specifiers may be any mixture of indexes and ranges:
+ *
+ *    a.values_at(3, 1..2, 0, 2..3) # => ["d", "b", "c", "a", "c", "d"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
-rb_ary_values_at(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_get_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
+    long i, olen = RARRAY_LEN(ary);
+    VALUE result = rb_ary_new_capa(argc);
+    for (i = 0; i < argc; ++i) {
+        append_values_at_single(result, ary, olen, argv[i]);
+    }
+    RB_GC_GUARD(ary);
+    return result;
 }
 
+
 /*
  *  call-seq:
- *     array.select {|item| block } -> an_array
- *  
- *  Invokes the block passing in successive elements from <i>array</i>,
- *  returning an array containing those elements for which the block
- *  returns a true value (equivalent to <code>Enumerable#select</code>).
- *     
- *     a = %w{ a b c d e f }
- *     a.select {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
+ *    select {|element| ... } -> new_array
+ *    select -> new_enumerator
+ *    filter {|element| ... } -> new_array
+ *    filter -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array containing those elements of +self+
+ *  for which the block returns a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select {|element| element.to_s.start_with?('b') }
+ *    # => ["bar", :bam]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
-rb_ary_select(ary)
-    VALUE ary;
+rb_ary_select(VALUE ary)
 {
     VALUE result;
     long i;
 
-    result = rb_ary_new2(RARRAY(ary)->len);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
-	    rb_ary_push(result, rb_ary_elt(ary, i));
-	}
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    result = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+            rb_ary_push(result, rb_ary_elt(ary, i));
+        }
     }
     return result;
 }
 
+struct select_bang_arg {
+    VALUE ary;
+    long len[2];
+};
+
+static VALUE
+select_bang_i(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (!RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
+    }
+    return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+select_bang_ensure(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long len = RARRAY_LEN(ary);
+    long i1 = arg->len[0], i2 = arg->len[1];
+
+    if (i2 < len && i2 < i1) {
+        long tail = 0;
+        rb_ary_modify(ary);
+        if (i1 < len) {
+            tail = len - i1;
+            RARRAY_PTR_USE(ary, ptr, {
+                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+                });
+        }
+        ARY_SET_LEN(ary, i2 + tail);
+    }
+    return ary;
+}
+
 /*
  *  call-seq:
- *     array.delete(obj)            -> obj or nil 
- *     array.delete(obj) { block }  -> obj or nil
- *  
- *  Deletes items from <i>self</i> that are equal to <i>obj</i>. If
- *  the item is not found, returns <code>nil</code>. If the optional
- *  code block is given, returns the result of <i>block</i> if the item
- *  is not found.
- *     
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.delete("b")                   #=> "b"
- *     a                               #=> ["a", "c"]
- *     a.delete("z")                   #=> nil
- *     a.delete("z") { "not found" }   #=> "not found"
+ *    select! {|element| ... } -> self or nil
+ *    select! -> new_enumerator
+ *    filter! {|element| ... } -> self or nil
+ *    filter! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes from +self+ those elements for which the block returns +false+ or +nil+.
+ *
+ *  Returns +self+ if any elements were removed:
+ *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *
+ *  Returns +nil+ if no elements were removed.
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+    struct select_bang_arg args;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ *  call-seq:
+ *    keep_if {|element| ... } -> self
+ *    keep_if -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element from +self+ if the block does not return a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_select_bang(ary);
+    return ary;
+}
+
+static void
+ary_resize_smaller(VALUE ary, long len)
+{
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > len) {
+        ARY_SET_LEN(ary, len);
+        if (len * 2 < ARY_CAPA(ary) &&
+            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+            ary_resize_capa(ary, len * 2);
+        }
+    }
+}
+
+/*
+ *  call-seq:
+ *    delete(object) -> last_removed_object
+ *    delete(object) {|element| ... } -> last_removed_object or block_return
+ *
+ *  Removes zero or more elements from +self+.
+ *
+ *  With no block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>;
+ *  returns the last removed element:
+ *
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) # => 2.0
+ *    a           # => [0, 1]
+ *
+ *  Returns +nil+ if no elements removed:
+ *
+ *    a.delete(2) # => nil
+ *
+ *  With a block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>.
+ *
+ *  If any such elements are found, ignores the block
+ *  and returns the last removed element:
+ *
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) {|element| fail 'Cannot happen' } # => 2.0
+ *    a                                             # => [0, 1]
+ *
+ *  If no such element is found, returns the block's return value:
+ *
+ *    a.delete(2) {|element| "Element #{element} not found." }
+ *    # => "Element 2 not found."
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 VALUE
-rb_ary_delete(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
 {
+    VALUE v = item;
     long i1, i2;
 
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	VALUE e = RARRAY(ary)->ptr[i1];
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (rb_equal(e, item)) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (rb_equal(e, item)) {
+            v = e;
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
-    if (RARRAY(ary)->len == i2) {
-	if (rb_block_given_p()) {
-	    return rb_yield(item);
-	}
-	return Qnil;
+    if (RARRAY_LEN(ary) == i2) {
+        if (rb_block_given_p()) {
+            return rb_yield(item);
+        }
+        return Qnil;
     }
 
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len > i2) {
-	RARRAY(ary)->len = i2;
-	if (i2 * 2 < RARRAY(ary)->aux.capa &&
-	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
-	    RARRAY(ary)->aux.capa = i2 * 2;
-	}
+    ary_resize_smaller(ary, i2);
+
+    ary_verify(ary);
+    return v;
+}
+
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
+{
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+        VALUE e = RARRAY_AREF(ary, i1);
+
+        if (e == item) {
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
+    }
+    if (RARRAY_LEN(ary) == i2) {
+        return;
     }
 
-    return item;
+    ary_resize_smaller(ary, i2);
 }
 
 VALUE
-rb_ary_delete_at(ary, pos)
-    VALUE ary;
-    long pos;
+rb_ary_delete_at(VALUE ary, long pos)
 {
-    long i, len = RARRAY(ary)->len;
+    long len = RARRAY_LEN(ary);
     VALUE del;
 
     if (pos >= len) return Qnil;
     if (pos < 0) {
-	pos += len;
-	if (pos < 0) return Qnil;
+        pos += len;
+        if (pos < 0) return Qnil;
     }
 
     rb_ary_modify(ary);
-    del = RARRAY(ary)->ptr[pos];
-    for (i = pos + 1; i < len; i++, pos++) {
-	RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
-    }
-    RARRAY(ary)->len = pos;
-
+    del = RARRAY_AREF(ary, pos);
+    RARRAY_PTR_USE(ary, ptr, {
+        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+    });
+    ARY_INCREASE_LEN(ary, -1);
+    ary_verify(ary);
     return del;
 }
 
 /*
  *  call-seq:
- *     array.delete_at(index)  -> obj or nil
- *  
- *  Deletes the element at the specified index, returning that element,
- *  or <code>nil</code> if the index is out of range. See also
- *  <code>Array#slice!</code>.
- *     
- *     a = %w( ant bat cat dog )
- *     a.delete_at(2)    #=> "cat"
- *     a                 #=> ["ant", "bat", "dog"]
- *     a.delete_at(99)   #=> nil
+ *    delete_at(index) -> removed_object or nil
+ *
+ *  Removes the element of +self+ at the given +index+, which must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  When +index+ is non-negative, deletes the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(1) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  When +index+ is negative, counts backward from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(-2) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  When +index+ is out of range, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(3)  # => nil
+ *    a.delete_at(-4) # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_delete_at_m(ary, pos)
-    VALUE ary, pos;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
 {
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+    const long orig_len = RARRAY_LEN(ary);
+
+    if (len < 0) {
+        return Qnil;
+    }
+    else if (pos < -orig_len) {
+        return Qnil;
+    }
+    else if (pos < 0) {
+        pos += orig_len;
+    }
+    else if (orig_len < pos) {
+        return Qnil;
+    }
+    if (orig_len < pos + len) {
+        len = orig_len - pos;
+    }
+    if (len == 0) {
+        return rb_ary_new2(0);
+    }
+    else {
+        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+        rb_ary_splice(ary, pos, len, 0, 0);
+        return arg2;
+    }
+}
+
 /*
  *  call-seq:
- *     array.slice!(index)         -> obj or nil
- *     array.slice!(start, length) -> sub_array or nil
- *     array.slice!(range)         -> sub_array or nil 
- *  
- *  Deletes the element(s) given by an index (optionally with a length)
- *  or by a range. Returns the deleted object, subarray, or
- *  <code>nil</code> if the index is out of range. Equivalent to:
- *     
- *     def slice!(*args)
- *       result = self[*args]
- *       self[*args] = nil
- *       result
- *     end
- *     
- *     a = [ "a", "b", "c" ]
- *     a.slice!(1)     #=> "b"
- *     a               #=> ["a", "c"]
- *     a.slice!(-1)    #=> "c"
- *     a               #=> ["a"]
- *     a.slice!(100)   #=> nil
- *     a               #=> ["a"]
+ *    slice!(index) -> object or nil
+ *    slice!(start, length) -> new_array or nil
+ *    slice!(range) -> new_array or nil
+ *
+ *  Removes and returns elements from +self+.
+ *
+ *  With numeric argument +index+ given,
+ *  removes and returns the element at offset +index+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2)   # => "c"
+ *    a             # => ["a", "b", "d"]
+ *    a.slice!(2.1) # => "d"
+ *    a             # => ["a", "b"]
+ *
+ *  If +index+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2) # => "c"
+ *    a            # => ["a", "b", "d"]
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  With numeric arguments +start+ and +length+ given,
+ *  removes +length+ elements from +self+ beginning at zero-based offset +start+;
+ *  returns the removed objects in a new array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1, 2)     # => ["b", "c"]
+ *    a                  # => ["a", "d"]
+ *    a.slice!(0.1, 1.1) # => ["a"]
+ *    a                  # => ["d"]
+ *
+ *  If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2, 1) # => ["c"]
+ *    a               # => ["a", "b", "d"]
+ *
+ *  If +start+ is out-of-range, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(5, 1)  # => nil
+ *    a.slice!(-5, 1) # => nil
+ *
+ *  If <tt>start + length</tt> exceeds the array size,
+ *  removes and returns all elements from offset +start+ to the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2, 50) # => ["c", "d"]
+ *    a               # => ["a", "b"]
+ *
+ *  If <tt>start == a.size</tt> and +length+ is non-negative,
+ *  returns a new empty array.
+ *
+ *  If +length+ is negative, returns +nil+.
+ *
+ *  With Range argument +range+ given,
+ *  treats <tt>range.min</tt> as +start+ (as above)
+ *  and <tt>range.size</tt> as +length+ (as above):
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1..2) # => ["b", "c"]
+ *    a              # => ["a", "d"]
+ *
+ *  If <tt>range.start == a.size</tt>, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(4..5) # => []
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+      a.slice!(5..6) # => nil
+ *
+ *  If <tt>range.start</tt> is negative,
+ *  calculates the start index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2..2) # => ["c"]
+ *
+ *  If <tt>range.end</tt> is negative,
+ *  calculates the end index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(0..-2) # => ["a", "b", "c"]
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_slice_bang(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1, arg2;
+    VALUE arg1;
     long pos, len;
 
-    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
-	pos = NUM2LONG(arg1);
-	len = NUM2LONG(arg2);
-      delete_pos_len:
-	if (pos < 0) {
-	    pos = RARRAY(ary)->len + pos;
-	}
-	arg2 = rb_ary_subseq(ary, pos, len);
-	rb_ary_splice(ary, pos, len, Qundef);	/* Qnil/rb_ary_new2(0) */
-	return arg2;
+    rb_ary_modify_check(ary);
+    rb_check_arity(argc, 1, 2);
+    arg1 = argv[0];
+
+    if (argc == 2) {
+        pos = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
     }
 
-    if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
-	goto delete_pos_len;
+    if (!FIXNUM_P(arg1)) {
+        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+          case Qtrue:
+            /* valid range */
+            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+          case Qnil:
+            /* invalid range */
+            return Qnil;
+          default:
+            /* not a range */
+            break;
+        }
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
+static VALUE
+ary_reject(VALUE orig, VALUE result)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(orig); i++) {
+        VALUE v = RARRAY_AREF(orig, i);
+
+        if (!RTEST(rb_yield(v))) {
+            rb_ary_push(result, v);
+        }
+    }
+    return result;
+}
+
+static VALUE
+reject_bang_i(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
+    }
+    return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+ary_reject_bang(VALUE ary)
+{
+    struct select_bang_arg args;
+    rb_ary_modify_check(ary);
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
 /*
  *  call-seq:
- *     array.reject! {|item| block }  -> array or nil
- *  
- *  Equivalent to <code>Array#delete_if</code>, deleting elements from
- *  _self_ for which the block evaluates to true, but returns
- *  <code>nil</code> if no changes were made. Also see
- *  <code>Enumerable#reject</code>.
+ *    reject! {|element| ... } -> self or nil
+ *    reject! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes each element for which the block returns a truthy value.
+ *
+ *  Returns +self+ if any elements removed:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *
+ *  Returns +nil+ if no elements removed.
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_reject_bang(ary)
-    VALUE ary;
+rb_ary_reject_bang(VALUE ary)
 {
-    long i1, i2;
-
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	VALUE v = RARRAY(ary)->ptr[i1];
-	if (RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	i2++;
-    }
-    if (RARRAY(ary)->len == i2) return Qnil;
-    if (i2 < RARRAY(ary)->len)
-	RARRAY(ary)->len = i2;
-
-    return ary;
+    return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *     array.reject {|item| block }  -> an_array
- *  
- *  Returns a new array containing the items in _self_
- *  for which the block is not true.
+ *    reject {|element| ... } -> new_array
+ *    reject -> new_enumerator
+ *
+ *  With a block given, returns a new array whose elements are all those from +self+
+ *  for which the block returns +false+ or +nil+:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a1 = a.reject {|element| element.to_s.start_with?('b') }
+ *    a1 # => [:foo, 2]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
-rb_ary_reject(ary)
-    VALUE ary;
+rb_ary_reject(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_reject_bang(ary);
-    return ary;
+    VALUE rejected_ary;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rejected_ary = rb_ary_new();
+    ary_reject(ary, rejected_ary);
+    return rejected_ary;
 }
 
 /*
  *  call-seq:
- *     array.delete_if {|item| block }  -> array
- *  
- *  Deletes every element of <i>self</i> for which <i>block</i> evaluates
- *  to <code>true</code>.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.delete_if {|x| x >= "b" }   #=> ["a"]
+ *    delete_if {|element| ... } -> self
+ *    delete_if -> new_numerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element if the block returns a truthy value;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_delete_if(ary)
-    VALUE ary;
+rb_ary_delete_if(VALUE ary)
 {
-    rb_ary_reject_bang(ary);
+    ary_verify(ary);
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    ary_reject_bang(ary);
     return ary;
 }
 
+static VALUE
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
+{
+    VALUE *args = (VALUE *)cbarg;
+    if (argc > 1) val = rb_ary_new4(argc, argv);
+    rb_ary_push(args[0], val);
+    if (--args[1] == 0) rb_iter_break();
+    return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+    VALUE result = rb_check_array_type(obj);
+    VALUE args[2];
+
+    if (n == 0) return result;
+    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+    result = rb_ary_new2(n);
+    args[0] = result; args[1] = (VALUE)n;
+    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+                 rb_obj_class(obj));
+    return result;
+}
+
+
 /*
  *  call-seq:
- *     array.zip(arg, ...)                   -> an_array
- *     array.zip(arg, ...) {| arr | block }  -> nil
- *  
- *  Converts any arguments to arrays, then merges elements of
- *  <i>self</i> with corresponding elements from each argument. This
- *  generates a sequence of <code>self.size</code> <em>n</em>-element
- *  arrays, where <em>n</em> is one more that the count of arguments. If
- *  the size of any argument is less than <code>enumObj.size</code>,
- *  <code>nil</code> values are supplied. If a block given, it is
- *  invoked for each output array, otherwise an array of arrays is
- *  returned.
- *     
- *     a = [ 4, 5, 6 ]
- *     b = [ 7, 8, 9 ]
- *     
- *     [1,2,3].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1,2].zip(a,b)         #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1,2],[8])       #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
+ *    zip(*other_arrays) -> new_array
+ *    zip(*other_arrays) {|sub_array| ... } -> nil
+ *
+ *  With no block given, combines +self+ with the collection of +other_arrays+;
+ *  returns a new array of sub-arrays:
+ *
+ *    [0, 1].zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *
+ *  Returned:
+ *
+ *  - The outer array is of size <tt>self.size</tt>.
+ *  - Each sub-array is of size <tt>other_arrays.size + 1</tt>.
+ *  - The _nth_ sub-array contains (in order):
+ *
+ *    - The _nth_ element of +self+.
+ *    - The _nth_ element of each of the other arrays, as available.
+ *
+ *  Example:
+ *
+ *    a = [0, 1]
+ *    zipped = a.zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *    zipped.size       # => 2 # Same size as a.
+ *    zipped.first.size # => 3 # Size of other arrays plus 1.
+ *
+ *  When the other arrays are all the same size as +self+,
+ *  the returned sub-arrays are a rearrangement containing exactly elements of all the arrays
+ *  (including +self+), with no omissions or additions:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  When one of the other arrays is smaller than +self+,
+ *  pads the corresponding sub-array with +nil+ elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2]
+ *    c = [:c0, :c1]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, nil],
+ *     [:a3, nil, nil]]
+ *
+ *  When one of the other arrays is larger than +self+,
+ *  _ignores_ its trailing elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3, :b4]
+ *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  With a block given, calls the block with each of the other arrays;
+ *  returns +nil+:
+ *
+ *    d = []
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    a.zip(b, c) {|sub_array| d.push(sub_array.reverse) } # => nil
+ *    pp d
+ *    # =>
+ *    [[:c0, :b0, :a0],
+ *     [:c1, :b1, :a1],
+ *     [:c2, :b2, :a2],
+ *     [:c3, :b3, :a3]]
+ *
+ *  For an *object* in *other_arrays* that is not actually an array,
+ *  forms the "other array" as <tt>object.to_ary</tt>, if defined,
+ *  or as <tt>object.each.to_a</tt> otherwise.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
-rb_ary_zip(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 {
     int i, j;
-    long len;
-    VALUE result;
+    long len = RARRAY_LEN(ary);
+    VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-	argv[i] = to_a(argv[i]);
+        argv[i] = take_items(argv[i], len);
     }
+
     if (rb_block_given_p()) {
-	for (i=0; i<RARRAY(ary)->len; i++) {
-	    VALUE tmp = rb_ary_new2(argc+1);
-
-	    rb_ary_push(tmp, rb_ary_elt(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	    }
-	    rb_yield(tmp);
-	}
-	return Qnil;
-    }
-    len = RARRAY(ary)->len;
-    result = rb_ary_new2(len);
-    for (i=0; i<len; i++) {
-	VALUE tmp = rb_ary_new2(argc+1);
+        int arity = rb_block_arity();
+
+        if (arity > 1) {
+            VALUE work, *tmp;
+
+            tmp = ALLOCV_N(VALUE, work, argc+1);
+
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                tmp[0] = RARRAY_AREF(ary, i);
+                for (j=0; j<argc; j++) {
+                    tmp[j+1] = rb_ary_elt(argv[j], i);
+                }
+                rb_yield_values2(argc+1, tmp);
+            }
+
+            if (work) ALLOCV_END(work);
+        }
+        else {
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                VALUE tmp = rb_ary_new2(argc+1);
+
+                rb_ary_push(tmp, RARRAY_AREF(ary, i));
+                for (j=0; j<argc; j++) {
+                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+                }
+                rb_yield(tmp);
+            }
+        }
+    }
+    else {
+        result = rb_ary_new_capa(len);
 
-	rb_ary_push(tmp, rb_ary_elt(ary, i));
-	for (j=0; j<argc; j++) {
-	    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	}
-	rb_ary_push(result, tmp);
+        for (i=0; i<len; i++) {
+            VALUE tmp = rb_ary_new_capa(argc+1);
+
+            rb_ary_push(tmp, RARRAY_AREF(ary, i));
+            for (j=0; j<argc; j++) {
+                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+            }
+            rb_ary_push(result, tmp);
+        }
     }
+
     return result;
 }
 
 /*
  *  call-seq:
- *     array.transpose -> an_array
- *  
- *  Assumes that <i>self</i> is an array of arrays and transposes the
- *  rows and columns.
- *     
- *     a = [[1,2], [3,4], [5,6]]
- *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ *    transpose -> new_array
+ *
+ *  Returns a new array that is +self+
+ *  as a {transposed matrix}[https://en.wikipedia.org/wiki/Transpose]:
+ *
+ *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
+ *
+ *  The elements of +self+ must all be the same size.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
-rb_ary_transpose(ary)
-    VALUE ary;
+rb_ary_transpose(VALUE ary)
 {
     long elen = -1, alen, i, j;
     VALUE tmp, result = 0;
 
-    alen = RARRAY(ary)->len;
+    alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
-	tmp = to_ary(rb_ary_elt(ary, i));
-	if (elen < 0) {		/* first element */
-	    elen = RARRAY(tmp)->len;
-	    result = rb_ary_new2(elen);
-	    for (j=0; j<elen; j++) {
-		rb_ary_store(result, j, rb_ary_new2(alen));
-	    }
-	}
-	else if (elen != RARRAY(tmp)->len) {
-	    rb_raise(rb_eIndexError, "element size differ (%d should be %d)",
-		     RARRAY(tmp)->len, elen);
-	}
-	for (j=0; j<elen; j++) {
-	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-	}
+        tmp = to_ary(rb_ary_elt(ary, i));
+        if (elen < 0) {		/* first element */
+            elen = RARRAY_LEN(tmp);
+            result = rb_ary_new2(elen);
+            for (j=0; j<elen; j++) {
+                rb_ary_store(result, j, rb_ary_new2(alen));
+            }
+        }
+        else if (elen != RARRAY_LEN(tmp)) {
+            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+                     RARRAY_LEN(tmp), elen);
+        }
+        for (j=0; j<elen; j++) {
+            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+        }
     }
     return result;
 }
 
 /*
  *  call-seq:
- *     array.replace(other_array)  -> array
- *  
- *  Replaces the contents of <i>self</i> with the contents of
- *  <i>other_array</i>, truncating or expanding if necessary.
- *     
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
- *     a                              #=> ["x", "y", "z"]
+ *    initialize_copy(other_array) -> self
+ *    replace(other_array) -> self
+ *
+ *  Replaces the elements of +self+ with the elements of +other_array+, which must be an
+ *  {array-convertible object}[rdoc-ref:implicit_conversion.rdoc@Array-Convertible+Objects];
+ *  returns +self+:
+ *
+ *    a = ['a', 'b', 'c']   # => ["a", "b", "c"]
+ *    a.replace(['d', 'e']) # => ["d", "e"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
-static VALUE
-rb_ary_replace(copy, orig)
-    VALUE copy, orig;
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
 {
-    VALUE shared;
-
-    rb_ary_modify(copy);
+    rb_ary_modify_check(copy);
     orig = to_ary(orig);
     if (copy == orig) return copy;
-    shared = ary_make_shared(orig);
-    if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
-	free(RARRAY(copy)->ptr);
-    RARRAY(copy)->ptr = RARRAY(orig)->ptr;
-    RARRAY(copy)->len = RARRAY(orig)->len;
-    RARRAY(copy)->aux.shared = shared;
-    FL_SET(copy, ELTS_SHARED);
 
+    rb_ary_reset(copy);
+
+    /* orig has enough space to embed the contents of orig. */
+    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+        RUBY_ASSERT(ARY_EMBED_P(copy));
+        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
+    }
+    /* orig is embedded but copy does not have enough space to embed the
+     * contents of orig. */
+    else if (ARY_EMBED_P(orig)) {
+        long len = ARY_EMBED_LEN(orig);
+        VALUE *ptr = ary_heap_alloc_buffer(len);
+
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ptr);
+        ARY_SET_LEN(copy, len);
+        ARY_SET_CAPA(copy, len);
+
+        // No allocation and exception expected that could leave `copy` in a
+        // bad state from the edits above.
+        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR(orig));
+    }
+    /* Otherwise, orig is on heap and copy does not have enough space to embed
+     * the contents of orig. */
+    else {
+        VALUE shared_root = ary_make_shared(orig);
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+        rb_ary_set_shared(copy, shared_root);
+
+        RUBY_ASSERT(RB_OBJ_SHAREABLE_P(copy) ? RB_OBJ_SHAREABLE_P(shared_root) : 1);
+    }
+    ary_verify(copy);
     return copy;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.clear    ->  array
+ *    clear -> self
+ *
+ *  Removes all elements from +self+; returns +self+:
  *
- *  Removes all elements from _self_.
+ *    a = [:foo, 'bar', 2]
+ *    a.clear # => []
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.clear    #=> [ ]
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 VALUE
-rb_ary_clear(ary)
-    VALUE ary;
+rb_ary_clear(VALUE ary)
 {
-    rb_ary_modify(ary);
-    RARRAY(ary)->len = 0;
-    if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
-	RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, 0);
+    }
+    else {
+        ARY_SET_LEN(ary, 0);
+        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+        }
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.fill(obj)                                -> array
- *     array.fill(obj, start [, length])              -> array
- *     array.fill(obj, range )                        -> array
- *     array.fill {|index| block }                    -> array
- *     array.fill(start [, length] ) {|index| block } -> array
- *     array.fill(range) {|index| block }             -> array
- *  
- *  The first three forms set the selected elements of <i>self</i> (which
- *  may be the entire array) to <i>obj</i>. A <i>start</i> of
- *  <code>nil</code> is equivalent to zero. A <i>length</i> of
- *  <code>nil</code> is equivalent to <i>self.length</i>. The last three
- *  forms fill the array with the value of the block. The block is
- *  passed the absolute index of each element to be filled.
- *     
- *     a = [ "a", "b", "c", "d" ]
- *     a.fill("x")              #=> ["x", "x", "x", "x"]
- *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
- *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill {|i| i*i}         #=> [0, 1, 4, 9]
- *     a.fill(-2) {|i| i*i*i}   #=> [0, 1, 8, 27]
+ *    fill(object, start = nil, count = nil) -> self
+ *    fill(object, range) -> self
+ *    fill(start = nil, count = nil) {|element| ... } -> self
+ *    fill(range) {|element| ... } -> self
+ *
+ *  Replaces selected elements in +self+;
+ *  may add elements to +self+;
+ *  always returns +self+ (never a new array).
+ *
+ *  In brief:
+ *
+ *    # Non-negative start.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1, 2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    # Extends with specified values if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 3, 2)          # => ["a", "b", "c", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *
+ *    # Fills with nils if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 6, 2)          # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    # For negative start, counts backwards from the end.
+ *    ['a', 'b', 'c', 'd'].fill('-', -3, 3)          # => ["a", "-", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    # Range.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  When arguments +start+ and +count+ are given,
+ *  they select the elements of +self+ to be replaced;
+ *  each must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  (or +nil+):
+ *
+ *  - +start+ specifies the zero-based offset of the first element to be replaced;
+ *    +nil+ means zero.
+ *  - +count+ is the number of consecutive elements to be replaced;
+ *    +nil+ means "all the rest."
+ *
+ *  With argument +object+ given,
+ *  that one object is used for all replacements:
+ *
+ *    o = Object.new           # => #<Object:0x0000014e7bff7600>
+ *    a = ['a', 'b', 'c', 'd'] # => ["a", "b", "c", "d"]
+ *    a.fill(o, 1, 2)
+ *    # => ["a", #<Object:0x0000014e7bff7600>, #<Object:0x0000014e7bff7600>, "d"]
+ *
+ *  With a block given, the block is called once for each element to be replaced;
+ *  the value passed to the block is the _index_ of the element to be replaced
+ *  (not the element itself);
+ *  the block's return value replaces the element:
+ *
+ *    a = ['a', 'b', 'c', 'd']               # => ["a", "b", "c", "d"]
+ *    a.fill(1, 2) {|element| element.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  For arguments +start+ and +count+:
+ *
+ *  - If +start+ is non-negative,
+ *    replaces +count+ elements beginning at offset +start+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 0, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1, 2) # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 2) # => ["a", "b", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(0, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, 2) {|e| e.to_s } # => ["a", "b", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 3, 2) # => ["a", "b", "c", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 4, 2) # => ["a", "b", "c", "d", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(4, 2) {|e| e.to_s } # => ["a", "b", "c", "d", "4", "5"]
+ *
+ *    Fills with +nil+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 5, 2) # => ["a", "b", "c", "d", nil, "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, 2) # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(5, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, "5", "6"]
+ *      ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 0)    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, -100) # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, -100) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(2, 0) {|e| fail 'Cannot happen' }    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(6, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  - If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -4, 3) # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3, 3) # => ["a", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-4, 3) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 3) # => ["a", "b", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -1, 3) # => ["a", "b", "c", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 3) {|e| e.to_s } # => ["a", "b", "2", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(-1, 3) {|e| e.to_s } # => ["a", "b", "c", "3", "4", "5"]
+ *
+ *    Starts at the beginning of +self+ if +start+ is negative and out-of-range:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -5, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -6, 2) # => ["-", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-5, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-6, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 0)  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, -1) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 0) {|e| fail 'Cannot happen' }  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-2, -1) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  When argument +range+ is given,
+ *  it must be a Range object whose members are numeric;
+ *  its +begin+ and +end+ values determine the elements of +self+
+ *  to be replaced:
+ *
+ *  - If both +begin+ and +end+ are positive, they specify the first and last elements
+ *    to be replaced:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    If +end+ is smaller than +begin+, replaces no elements:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2..1)          # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2..1) {|e| e.to_s } # => ["a", "b", "c", "d"]
+ *
+ *  - If either is negative (or both are negative), counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..-2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..-2) # => ["a", "-", "-", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-3..2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..-2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3..-2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  - If the +end+ value is excluded (see Range#exclude_end?), omits the last replacement:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...2)  # => ["a", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...-2) # => ["a", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(1...2) {|e| e.to_s }  # => ["a", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1...-2) {|e| e.to_s } # => ["a", "1", "c", "d"]
+ *
+ *  - If the range is endless (see {Endless Ranges}[rdoc-ref:Range@Endless+Ranges]),
+ *    replaces elements to the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..)          # => ["a", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill(1..) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *  - If the range is beginless (see {Beginless Ranges}[rdoc-ref:Range@Beginless+Ranges]),
+ *    replaces elements from the beginning of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', ..2)          # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(..2) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
-rb_ary_fill(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE item, arg1, arg2;
-    long beg, end, len;
-    VALUE *p, *pend;
-    int block_p = Qfalse;
+    VALUE item = Qundef, arg1, arg2;
+    long beg = 0, end = 0, len = 0;
 
     if (rb_block_given_p()) {
-	block_p = Qtrue;
-	rb_scan_args(argc, argv, "02", &arg1, &arg2);
-	argc += 1;		/* hackish */
+        rb_scan_args(argc, argv, "02", &arg1, &arg2);
+        argc += 1;		/* hackish */
     }
     else {
-	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
     }
     switch (argc) {
       case 1:
-	beg = 0;
-	len = RARRAY(ary)->len;
-	break;
+        beg = 0;
+        len = RARRAY_LEN(ary);
+        break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
-	    break;
-	}
-	/* fall through */
+        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+            break;
+        }
+        /* fall through */
       case 3:
-	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
-	if (beg < 0) {
-	    beg = RARRAY(ary)->len + beg;
-	    if (beg < 0) beg = 0;
-	}
-	len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
-	break;
+        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+        if (beg < 0) {
+            beg = RARRAY_LEN(ary) + beg;
+            if (beg < 0) beg = 0;
+        }
+        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+        break;
     }
     rb_ary_modify(ary);
+    if (len < 0) {
+        return ary;
+    }
+    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+        rb_raise(rb_eArgError, "argument too big");
+    }
     end = beg + len;
-    if (end > RARRAY(ary)->len) {
-	if (end >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
-	    RARRAY(ary)->aux.capa = end;
-	}
-	if (beg > RARRAY(ary)->len) {
-	    rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
-	}
-	RARRAY(ary)->len = end;
-    }
-
-    if (block_p) {
-	VALUE v;
-	long i;
-
-	for (i=beg; i<end; i++) {
-	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY(ary)->len) break;
-	    RARRAY(ary)->ptr[i] = v;
-	}
+    if (RARRAY_LEN(ary) < end) {
+        if (end >= ARY_CAPA(ary)) {
+            ary_resize_capa(ary, end);
+        }
+        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+        ARY_SET_LEN(ary, end);
+    }
+
+    if (UNDEF_P(item)) {
+        VALUE v;
+        long i;
+
+        for (i=beg; i<end; i++) {
+            v = rb_yield(LONG2NUM(i));
+            if (i>=RARRAY_LEN(ary)) break;
+            ARY_SET(ary, i, v);
+        }
     }
     else {
-	p = RARRAY(ary)->ptr + beg;
-	pend = p + len;
-	while (p < pend) {
-	    *p++ = item;
-	}
+        ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
-/* 
+/*
  *  call-seq:
- *     array + other_array   -> an_array
+ *    self + other_array -> new_array
  *
- *  Concatenation---Returns a new array built by concatenating the
- *  two arrays together to produce a third array.
- * 
- *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
+ *  Returns a new array containing all elements of +self+
+ *  followed by all elements of +other_array+:
+ *
+ *    a = [0, 1] + [2, 3]
+ *    a # => [0, 1, 2, 3]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 VALUE
-rb_ary_plus(x, y)
-    VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
 {
     VALUE z;
-    long len;
+    long len, xlen, ylen;
 
     y = to_ary(y);
-    len = RARRAY(x)->len + RARRAY(y)->len;
+    xlen = RARRAY_LEN(x);
+    ylen = RARRAY_LEN(y);
+    len = xlen + ylen;
     z = rb_ary_new2(len);
-    MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
-    MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
-    RARRAY(z)->len = len;
+
+    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
+    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+    ARY_SET_LEN(z, len);
     return z;
 }
 
-/* 
+static VALUE
+ary_append(VALUE x, VALUE y)
+{
+    long n = RARRAY_LEN(y);
+    if (n > 0) {
+        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
+    }
+    RB_GC_GUARD(y);
+    return x;
+}
+
+/*
  *  call-seq:
- *     array.concat(other_array)   ->  array
+ *    concat(*other_arrays) -> self
+ *
+ *  Adds to +self+ all elements from each array in +other_arrays+; returns +self+:
+ *
+ *    a = [0, 1]
+ *    a.concat(['two', 'three'], [:four, :five], a)
+ *    # => [0, 1, "two", "three", :four, :five, 0, 1]
  *
- *  Appends the elements in other_array to _self_.
- *  
- *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
-
-VALUE
-rb_ary_concat(x, y)
-    VALUE x, y;
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
 {
-    y = to_ary(y);
-    if (RARRAY(y)->len > 0) {
-	rb_ary_splice(x, RARRAY(x)->len, 0, y);
+    rb_ary_modify_check(ary);
+
+    if (argc == 1) {
+        rb_ary_concat(ary, argv[0]);
     }
-    return x;
+    else if (argc > 1) {
+        int i;
+        VALUE args = rb_ary_hidden_new(argc);
+        for (i = 0; i < argc; i++) {
+            rb_ary_concat(args, argv[i]);
+        }
+        ary_append(ary, args);
+    }
+
+    ary_verify(ary);
+    return ary;
 }
 
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+    return ary_append(x, to_ary(y));
+}
 
-/* 
+/*
  *  call-seq:
- *     array * int     ->    an_array
- *     array * str     ->    a_string
+ *    self * n -> new_array
+ *    self * string_separator -> new_string
+ *
+ *  When non-negative integer argument +n+ is given,
+ *  returns a new array built by concatenating +n+ copies of +self+:
  *
- *  Repetition---With a String argument, equivalent to
- *  self.join(str). Otherwise, returns a new array
- *  built by concatenating the _int_ copies of _self_.
+ *    a = ['x', 'y']
+ *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
  *
+ *  When string argument +string_separator+ is given,
+ *  equivalent to <tt>self.join(string_separator)</tt>:
  *
- *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
+ *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {foo: 0}"
  *
  */
 
 static VALUE
-rb_ary_times(ary, times)
-    VALUE ary, times;
+rb_ary_times(VALUE ary, VALUE times)
 {
     VALUE ary2, tmp;
-    long i, len;
+    const VALUE *ptr;
+    long t, len;
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
-	return rb_ary_join(ary, tmp);
+        return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
-    if (len == 0) return ary_new(rb_obj_class(ary), 0);
+    if (len == 0) {
+        ary2 = ary_new(rb_cArray, 0);
+        goto out;
+    }
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative argument");
+        rb_raise(rb_eArgError, "negative argument");
     }
-    if (LONG_MAX/len < RARRAY(ary)->len) {
-	rb_raise(rb_eArgError, "argument too big");
+    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+        rb_raise(rb_eArgError, "argument too big");
     }
-    len *= RARRAY(ary)->len;
+    len *= RARRAY_LEN(ary);
 
-    ary2 = ary_new(rb_obj_class(ary), len);
-    RARRAY(ary2)->len = len;
+    ary2 = ary_new(rb_cArray, len);
+    ARY_SET_LEN(ary2, len);
 
-    for (i=0; i<len; i+=RARRAY(ary)->len) {
-	MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    ptr = RARRAY_CONST_PTR(ary);
+    t = RARRAY_LEN(ary);
+    if (0 < t) {
+        ary_memcpy(ary2, 0, t, ptr);
+        while (t <= len/2) {
+            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+            t *= 2;
+        }
+        if (t < len) {
+            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+        }
     }
-    OBJ_INFECT(ary2, ary);
-
+  out:
     return ary2;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.assoc(obj)   ->  an_array  or  nil
+ *    assoc(object) -> found_array or nil
+ *
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[0] == object</tt>:
  *
- *  Searches through an array whose elements are also arrays
- *  comparing _obj_ with the first element of each contained array
- *  using obj.==.
- *  Returns the first contained array that matches (that
- *  is, the first associated array),
- *  or +nil+ if no match is found.
- *  See also <code>Array#rassoc</code>.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.assoc(4) # => [4, 5, 6]
  *
- *     s1 = [ "colors", "red", "blue", "green" ]
- *     s2 = [ "letters", "a", "b", "c" ]
- *     s3 = "foo"
- *     a  = [ s1, s2, s3 ]
- *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
- *     a.assoc("foo")      #=> nil
+ *  Returns +nil+ if no such element is found.
+ *
+ *  Related: Array#rassoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
-rb_ary_assoc(ary, key)
-    VALUE ary, key;
+rb_ary_assoc(VALUE ary, VALUE key)
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY(ary)->len; ++i) {
-	v = RARRAY(ary)->ptr[i];
-	if (TYPE(v) == T_ARRAY &&
-	    RARRAY(v)->len > 0 &&
-	    rb_equal(RARRAY(v)->ptr[0], key))
-	    return v;
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+            rb_equal(RARRAY_AREF(v, 0), key))
+            return v;
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     array.rassoc(key) -> an_array or nil
- *  
- *  Searches through the array whose elements are also arrays. Compares
- *  <em>key</em> with the second element of each contained array using
- *  <code>==</code>. Returns the first contained array that matches. See
- *  also <code>Array#assoc</code>.
- *     
- *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- *     a.rassoc("two")    #=> [2, "two"]
- *     a.rassoc("four")   #=> nil
+ *    rassoc(object) -> found_array or nil
+ *
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[1] == object</tt>:
+ *
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.rassoc(4) # => [2, 4]
+ *    a.rassoc(5) # => [4, 5, 6]
+ *
+ *  Returns +nil+ if no such element is found.
+ *
+ *  Related: Array#assoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
-rb_ary_rassoc(ary, value)
-    VALUE ary, value;
+rb_ary_rassoc(VALUE ary, VALUE value)
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY(ary)->len; ++i) {
-	v = RARRAY(ary)->ptr[i];
-	if (TYPE(v) == T_ARRAY &&
-	    RARRAY(v)->len > 1 &&
-	    rb_equal(RARRAY(v)->ptr[1], value))
-	    return v;
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (RB_TYPE_P(v, T_ARRAY) &&
+            RARRAY_LEN(v) > 1 &&
+            rb_equal(RARRAY_AREF(v, 1), value))
+            return v;
     }
     return Qnil;
 }
 
-/* 
+static VALUE
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
+{
+    long i, len1;
+    const VALUE *p1, *p2;
+
+    if (recur) return Qtrue; /* Subtle! */
+
+    /* rb_equal() can evacuate ptrs */
+    p1 = RARRAY_CONST_PTR(ary1);
+    p2 = RARRAY_CONST_PTR(ary2);
+    len1 = RARRAY_LEN(ary1);
+
+    for (i = 0; i < len1; i++) {
+        if (*p1 != *p2) {
+            if (rb_equal(*p1, *p2)) {
+                len1 = RARRAY_LEN(ary1);
+                if (len1 != RARRAY_LEN(ary2))
+                    return Qfalse;
+                if (len1 < i)
+                    return Qtrue;
+                p1 = RARRAY_CONST_PTR(ary1) + i;
+                p2 = RARRAY_CONST_PTR(ary2) + i;
+            }
+            else {
+                return Qfalse;
+            }
+        }
+        p1++;
+        p2++;
+    }
+    return Qtrue;
+}
+
+/*
  *  call-seq:
- *     array == other_array   ->   bool
+ *    self == other_array -> true or false
  *
- *  Equality---Two arrays are equal if they contain the same number
- *  of elements and if each element is equal to (according to
- *  Object.==) the corresponding element in the other array.
+ *  Returns whether both:
  *
- *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
- *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
- *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
+ *  - +self+ and +other_array+ are the same size.
+ *  - Their corresponding elements are the same;
+ *    that is, for each index +i+ in <tt>(0...self.size)</tt>,
+ *    <tt>self[i] == other_array[i]</tt>.
  *
+ *  Examples:
+ *
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2]   # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2.0] # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar']      # => false # Different sizes.
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 3]   # => false # Different elements.
+ *
+ *  This method is different from method Array#eql?,
+ *  which compares elements using <tt>Object#eql?</tt>.
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 static VALUE
-rb_ary_equal(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_equal(VALUE ary1, VALUE ary2)
+{
+    if (ary1 == ary2) return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) {
+        if (!rb_respond_to(ary2, idTo_ary)) {
+            return Qfalse;
+        }
+        return rb_equal(ary2, ary1);
+    }
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+}
+
+static VALUE
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
 {
     long i;
 
-    if (ary1 == ary2) return Qtrue;
-    if (TYPE(ary2) != T_ARRAY) {
-	if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
-	    return Qfalse;
-	}
-	return rb_equal(ary2, ary1);
-    }
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+            return Qfalse;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     array.eql?(other)  -> true or false
+ *    eql?(other_array) -> true or false
  *
- *  Returns <code>true</code> if _array_ and _other_ are the same object,
- *  or are both arrays with the same content.
+ *  Returns +true+ if +self+ and +other_array+ are the same size,
+ *  and if, for each index +i+ in +self+, <tt>self[i].eql?(other_array[i])</tt>:
+ *
+ *    a0 = [:foo, 'bar', 2]
+ *    a1 = [:foo, 'bar', 2]
+ *    a1.eql?(a0) # => true
+ *
+ *  Otherwise, returns +false+.
+ *
+ *  This method is different from method Array#==,
+ *  which compares using method <tt>Object#==</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_eql(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_eql(VALUE ary1, VALUE ary2)
+{
+    if (ary1 == ary2) return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+}
+
+static VALUE
+ary_hash_values(long len, const VALUE *elements, const VALUE ary)
 {
     long i;
+    st_index_t h;
+    VALUE n;
 
-    if (ary1 == ary2) return Qtrue;
-    if (TYPE(ary2) != T_ARRAY) return Qfalse;
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
-    }
-    return Qtrue;
+    h = rb_hash_start(len);
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash_values);
+    for (i=0; i<len; i++) {
+        n = rb_hash(elements[i]);
+        h = rb_hash_uint(h, NUM2LONG(n));
+        if (ary) {
+            len = RARRAY_LEN(ary);
+            elements = RARRAY_CONST_PTR(ary);
+        }
+    }
+    h = rb_hash_end(h);
+    return ST2FIX(h);
+}
+
+VALUE
+rb_ary_hash_values(long len, const VALUE *elements)
+{
+    return ary_hash_values(len, elements, 0);
 }
 
 /*
  *  call-seq:
- *     array.hash   -> fixnum
+ *    hash -> integer
+ *
+ *  Returns the integer hash value for +self+.
+ *
+ *  Two arrays with the same content will have the same hash value
+ *  (and will compare using eql?):
+ *
+ *    ['a', 'b'].hash == ['a', 'b'].hash # => true
+ *    ['a', 'b'].hash == ['a', 'c'].hash # => false
+ *    ['a', 'b'].hash == ['a'].hash      # => false
  *
- *  Compute a hash-code for this array. Two arrays with the same content
- *  will have the same hash code (and will compare using <code>eql?</code>).
  */
 
 static VALUE
-rb_ary_hash(ary)
-    VALUE ary;
+rb_ary_hash(VALUE ary)
 {
-    long i, h;
-    VALUE n;
-
-    h = RARRAY(ary)->len;
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	h = (h << 1) | (h<0 ? 1 : 0);
-	n = rb_hash(RARRAY(ary)->ptr[i]);
-	h ^= NUM2LONG(n);
-    }
-    return LONG2FIX(h);
+    RBIMPL_ASSERT_OR_ASSUME(ary);
+    return ary_hash_values(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary), ary);
 }
 
 /*
  *  call-seq:
- *     array.include?(obj)   -> true or false
- *  
- *  Returns <code>true</code> if the given object is present in
- *  <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
- *  <code>false</code> otherwise.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.include?("b")   #=> true
- *     a.include?("z")   #=> false
+ *    include?(object) -> true or false
+ *
+ *  Returns whether for some element +element+ in +self+,
+ *  <tt>object == element</tt>:
+ *
+ *    [0, 1, 2].include?(2)   # => true
+ *    [0, 1, 2].include?(2.0) # => true
+ *    [0, 1, 2].include?(2.1) # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 VALUE
-rb_ary_includes(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
+{
+    long i;
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, item)) {
+            return Qtrue;
+        }
+    }
+    return Qfalse;
+}
+
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
 {
     long i;
-    
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], item)) {
-	    return Qtrue;
-	}
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (rb_eql(item, e)) {
+            return Qtrue;
+        }
     }
     return Qfalse;
 }
 
+static VALUE
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
+{
+    long i, len;
+
+    if (recur) return Qundef;	/* Subtle! */
+    len = RARRAY_LEN(ary1);
+    if (len > RARRAY_LEN(ary2)) {
+        len = RARRAY_LEN(ary2);
+    }
+    for (i=0; i<len; i++) {
+        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+        if (v != INT2FIX(0)) {
+            return v;
+        }
+    }
+    return Qundef;
+}
 
-/* 
+/*
  *  call-seq:
- *     array <=> other_array   ->  -1, 0, +1
+ *    self <=> other_array -> -1, 0, or 1
+ *
+ *  Returns -1, 0, or 1 as +self+ is determined
+ *  to be less than, equal to, or greater than +other_array+.
+ *
+ *  Iterates over each index +i+ in <tt>(0...self.size)</tt>:
+ *
+ *  - Computes <tt>result[i]</tt> as <tt>self[i] <=> other_array[i]</tt>.
+ *  - Immediately returns 1 if <tt>result[i]</tt> is 1:
+ *
+ *      [0, 1, 2] <=> [0, 0, 2] # => 1
+ *
+ *  - Immediately returns -1 if <tt>result[i]</tt> is -1:
+ *
+ *      [0, 1, 2] <=> [0, 2, 2] # => -1
+ *
+ *  - Continues if <tt>result[i]</tt> is 0.
+ *
+ *  When every +result+ is 0,
+ *  returns <tt>self.size <=> other_array.size</tt>
+ *  (see Integer#<=>):
  *
- *  Comparison---Returns an integer (-1, 0,
- *  or +1) if this array is less than, equal to, or greater than
- *  other_array.  Each object in each array is compared
- *  (using <=>). If any value isn't
- *  equal, then that inequality is the return value. If all the
- *  values found are equal, then the return is based on a
- *  comparison of the array lengths.  Thus, two arrays are
- *  ``equal'' according to <code>Array#<=></code> if and only if they have
- *  the same length and the value of each element is equal to the
- *  value of the corresponding element in the other array.
- *  
- *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
- *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
+ *    [0, 1, 2] <=> [0, 1]        # => 1
+ *    [0, 1, 2] <=> [0, 1, 2]     # => 0
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
  *
+ *  Note that when +other_array+ is larger than +self+,
+ *  its trailing elements do not affect the result:
+ *
+ *    [0, 1, 2] <=> [0, 1, 2, -3] # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 0]  # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 VALUE
-rb_ary_cmp(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_cmp(VALUE ary1, VALUE ary2)
 {
-    long i, len;
+    long len;
+    VALUE v;
 
-    ary2 = to_ary(ary2);
-    len = RARRAY(ary1)->len;
-    if (len > RARRAY(ary2)->len) {
-	len = RARRAY(ary2)->len;
-    }
-    for (i=0; i<len; i++) {
-	VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
-	if (v != INT2FIX(0)) {
-	    return v;
-	}
-    }
-    len = RARRAY(ary1)->len - RARRAY(ary2)->len;
+    ary2 = rb_check_array_type(ary2);
+    if (NIL_P(ary2)) return Qnil;
+    if (ary1 == ary2) return INT2FIX(0);
+    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+    if (!UNDEF_P(v)) return v;
+    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
     return INT2FIX(-1);
 }
 
 static VALUE
-ary_make_hash(ary1, ary2)
-    VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
 {
-    VALUE hash = rb_hash_new();
     long i;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        VALUE elt = RARRAY_AREF(ary, i);
+        rb_hash_add_new_element(hash, elt, elt);
     }
-    if (ary2) {
-	for (i=0; i<RARRAY(ary2)->len; i++) {
-	    rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
-	}
+    return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(VALUE ary)
+{
+    long size = RARRAY_LEN(ary);
+    VALUE hash = rb_hash_new_with_size(size);
+
+    RBASIC_CLEAR_CLASS(hash);
+    return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new(ary);
+    return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+        rb_hash_add_new_element(hash, k, v);
     }
     return hash;
 }
 
-/* 
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new(ary);
+    return ary_add_hash_by(hash, ary);
+}
+
+/*
  *  call-seq:
- *     array - other_array    -> an_array
+ *    self - other_array -> new_array
+ *
+ *  Returns a new array containing only those elements of +self+
+ *  that are not found in +other_array+;
+ *  the order from +self+ is preserved:
+ *
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1]             # => [0, 2, 3]
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [3, 2, 0, :foo] # => [1, 1, 1, 1, 1, 1]
+ *    [0, 1, 2] - [:foo]                            # => [0, 1, 2]
  *
- *  Array Difference---Returns a new array that is a copy of
- *  the original array, removing any items that also appear in
- *  other_array. (If you need set-like behavior, see the
- *  library class Set.)
+ *  Element are compared using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
  *
- *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
-static VALUE
-rb_ary_diff(ary1, ary2)
-    VALUE ary1, ary2;
+VALUE
+rb_ary_diff(VALUE ary1, VALUE ary2)
 {
-    VALUE ary3, hash;
+    VALUE ary3;
+    VALUE hash;
     long i;
 
-    hash = ary_make_hash(to_ary(ary2), 0);
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
     ary3 = rb_ary_new();
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
-	rb_ary_push(ary3, rb_ary_elt(ary1, i));
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            VALUE elt = rb_ary_elt(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, elt)) continue;
+            rb_ary_push(ary3, elt);
+        }
+        return ary3;
+    }
+
+    hash = ary_make_hash(ary2);
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+        rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
+
     return ary3;
 }
 
-/* 
+/*
+ *  call-seq:
+ *    difference(*other_arrays = []) -> new_array
+ *
+ *  Returns a new array containing only those elements from +self+
+ *  that are not found in any of the given +other_arrays+;
+ *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
+ *
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ *    [0, 1, 2, 3].difference([3, 0], [1, 3])     # => [2]
+ *    [0, 1, 2].difference([4])                   # => [0, 1, 2]
+ *    [0, 1, 2].difference                        # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments are given.
+ *
+ *  Related: Array#-;
+ *  see also {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE ary_diff;
+    long i, length;
+    volatile VALUE t0;
+    bool *is_hash = ALLOCV_N(bool, t0, argc);
+    ary_diff = rb_ary_new();
+    length = RARRAY_LEN(ary);
+
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        int j;
+        VALUE elt = rb_ary_elt(ary, i);
+        for (j = 0; j < argc; j++) {
+            if (is_hash[j]) {
+                if (rb_hash_stlike_lookup(argv[j], elt, NULL))
+                    break;
+            }
+            else {
+                if (rb_ary_includes_by_eql(argv[j], elt)) break;
+            }
+        }
+        if (j == argc) rb_ary_push(ary_diff, elt);
+    }
+
+    ALLOCV_END(t0);
+
+    return ary_diff;
+}
+
+
+/*
  *  call-seq:
- *     array & other_array
+ *    self & other_array -> new_array
+ *
+ *  Returns a new array containing the _intersection_ of +self+ and +other_array+;
+ *  that is, containing those elements found in both +self+ and +other_array+:
+ *
+ *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
  *
- *  Set Intersection---Returns a new array
- *  containing elements common to the two arrays, with no duplicates.
+ *  Omits duplicates:
  *
- *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]   #=> [ 1, 3 ]
+ *    [0, 1, 1, 0] & [0, 1] # => [0, 1]
+ *
+ *  Preserves order from +self+:
+ *
+ *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ *  Identifies common elements using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 
 static VALUE
-rb_ary_and(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_and(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, ary3, v, vv;
+    VALUE hash, ary3, v;
+    st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
-	    RARRAY(ary1)->len : RARRAY(ary2)->len);
-    hash = ary_make_hash(ary2, 0);
+    ary3 = rb_ary_new();
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	v = vv = rb_ary_elt(ary1, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (!rb_ary_includes_by_eql(ary2, v)) continue;
+            if (rb_ary_includes_by_eql(ary3, v)) continue;
+            rb_ary_push(ary3, v);
+        }
+        return ary3;
+    }
+
+    hash = ary_make_hash(ary2);
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+        v = RARRAY_AREF(ary1, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_delete(hash, &vv, 0)) {
+            rb_ary_push(ary3, v);
+        }
     }
 
     return ary3;
 }
 
-/* 
+/*
  *  call-seq:
- *     array | other_array     ->  an_array
+ *    intersection(*other_arrays) -> new_array
+ *
+ *  Returns a new array containing each element in +self+ that is +#eql?+
+ *  to at least one element in each of the given +other_arrays+;
+ *  duplicates are omitted:
  *
- *  Set Union---Returns a new array by joining this array with
- *  other_array, removing duplicates.
+ *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
  *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]
- *            #=> [ "a", "b", "c", "d" ]
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Order from +self+ is preserved:
+ *
+ *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments are given.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
-rb_ary_or(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = rb_ary_dup(ary);
+    int i;
+
+    for (i = 0; i < argc; i++) {
+        result = rb_ary_and(result, argv[i]);
+    }
+
+    return result;
+}
+
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+    if (existing) return ST_STOP;
+    *key = *value = (VALUE)arg;
+    return ST_CONTINUE;
+}
+
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE elt = rb_ary_elt(ary, i);
+        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+        rb_ary_push(ary_union, elt);
+    }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
 {
-    VALUE hash, ary3;
-    VALUE v, vv;
     long i;
+    for (i = 0; i < RARRAY_LEN(ary2); i++) {
+        VALUE elt = RARRAY_AREF(ary2, i);
+        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+            RB_OBJ_WRITTEN(hash, Qundef, elt);
+        }
+    }
+}
+
+/*
+ *  call-seq:
+ *    self | other_array -> new_array
+ *
+ *  Returns the union of +self+ and +other_array+;
+ *  duplicates are removed; order is preserved;
+ *  items are compared using <tt>eql?</tt> and <tt>hash</tt>:
+ *
+ *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_or(VALUE ary1, VALUE ary2)
+{
+    VALUE hash;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
-    hash = ary_make_hash(ary1, ary2);
+    if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        VALUE ary3 = rb_ary_new();
+        rb_ary_union(ary3, ary1);
+        rb_ary_union(ary3, ary2);
+        return ary3;
+    }
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	v = vv = rb_ary_elt(ary1, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+    hash = ary_make_hash(ary1);
+    rb_ary_union_hash(hash, ary2);
+
+    return rb_hash_values(hash);
+}
+
+/*
+ *  call-seq:
+ *    union(*other_arrays) -> new_array
+ *
+ *  Returns a new array that is the union of the elements of +self+
+ *  and all given arrays +other_arrays+;
+ *  items are compared using <tt>eql?</tt> and <tt>hash</tt>:
+ *
+ *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ *
+ *  Removes duplicates (preserving the first found):
+ *
+ *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ *
+ *  Preserves order (preserving the position of the first found):
+ *
+ *    [3, 2, 1, 0].union([5, 3], [4, 2]) # => [3, 2, 1, 0, 5, 4]
+ *
+ *  With no arguments given, returns a copy of +self+.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+    int i;
+    long sum;
+    VALUE hash;
+
+    sum = RARRAY_LEN(ary);
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        sum += RARRAY_LEN(argv[i]);
     }
-    for (i=0; i<RARRAY(ary2)->len; i++) {
-	v = vv = rb_ary_elt(ary2, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+
+    if (sum <= SMALL_ARRAY_LEN) {
+        VALUE ary_union = rb_ary_new();
+
+        rb_ary_union(ary_union, ary);
+        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+        return ary_union;
     }
-    return ary3;
+
+    hash = ary_make_hash(ary);
+    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+    return rb_hash_values(hash);
 }
 
 /*
  *  call-seq:
- *     array.uniq! -> array or nil
- *  
- *  Removes duplicate elements from _self_.
- *  Returns <code>nil</code> if no changes are made (that is, no
- *  duplicates are found).
- *     
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   #=> ["a", "b", "c"]
- *     b = [ "a", "b", "c" ]
- *     b.uniq!   #=> nil
+ *    intersect?(other_array) -> true or false
+ *
+ *  Returns whether +other_array+ has at least one element that is +#eql?+ to some element of +self+:
+ *
+ *    [1, 2, 3].intersect?([3, 4, 5]) # => true
+ *    [1, 2, 3].intersect?([4, 5, 6]) # => false
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_uniq_bang(ary)
-    VALUE ary;
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, v, vv;
-    long i, j;
+    VALUE hash, v, result, shorter, longer;
+    st_data_t vv;
+    long i;
 
-    hash = ary_make_hash(ary, 0);
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
 
-    if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
-	return Qnil;
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+        }
+        return Qfalse;
     }
-    for (i=j=0; i<RARRAY(ary)->len; i++) {
-	v = vv = rb_ary_elt(ary, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_store(ary, j++, v);
-	}
+
+    shorter = ary1;
+    longer = ary2;
+    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+        longer = ary1;
+        shorter = ary2;
     }
-    RARRAY(ary)->len = j;
 
-    return ary;
+    hash = ary_make_hash(shorter);
+    result = Qfalse;
+
+    for (i=0; i<RARRAY_LEN(longer); i++) {
+        v = RARRAY_AREF(longer, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_lookup(hash, vv, 0)) {
+            result = Qtrue;
+            break;
+        }
+    }
+
+    return result;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+            vmax = v;
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(v)) {
+            if ((long)vmax < (long)v) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(v)) {
+            if (rb_float_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (STRING_P(v)) {
+            if (rb_str_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
 }
 
 /*
  *  call-seq:
- *     array.uniq   -> an_array
- *  
- *  Returns a new array by removing duplicate values in <i>self</i>.
- *     
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   #=> ["a", "b", "c"]
+ *    max -> element
+ *    max(count) -> new_array
+ *    max {|a, b| ... } -> element
+ *    max(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The maximum-valued element from +self+.
+ *  - A new array of maximum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the maximum value per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].max # => 3
+ *
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].max(3)   # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(3.0) # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(9)   # => [3, 2, 1, 0]
+ *    [1, 0, 3, 2].max(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the maximum value per the block:
+ *
+ *    ['0', '', '000', '00'].max {|a, b| a.size <=> b.size }
+ *    # => "000"
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per the block:
+ *
+ *    ['0', '', '000', '00'].max(2) {|a, b| a.size <=> b.size }
+ *    # => ["000", "00"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 1, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_max_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_max_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_max_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_max_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
 
 static VALUE
-rb_ary_uniq(ary)
-    VALUE ary;
+ary_min_generic(VALUE ary, long i, VALUE vmin)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_uniq_bang(ary);
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+            vmin = v;
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(a)) {
+            if ((long)vmin > (long)a) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(a)) {
+            if (rb_float_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (STRING_P(a)) {
+            if (rb_str_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+/*
+ *  call-seq:
+ *    min -> element
+ *    min(count) -> new_array
+ *    min {|a, b| ... } -> element
+ *    min(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The minimum-valued element from +self+.
+ *  - A new array of minimum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the minimum value per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].min # => 0
+ *
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].min(3)   # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(3.0) # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(9)   # => [0, 1, 2, 3]
+ *    [1, 0, 3, 2].min(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the minimum value per the block:
+ *
+ *    ['0', '', '000', '00'].min {|a, b| a.size <=> b.size }
+ *    # => ""
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per the block:
+ *
+ *    ['0', '', '000', '00'].min(2) {|a, b| a.size <=> b.size }
+ *    # => ["", "0"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 0, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_min_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_min_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_min_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_min_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    minmax -> array
+ *    minmax {|a, b| ... } -> array
+ *
+ *  Returns a 2-element array containing the minimum-valued and maximum-valued
+ *  elements from +self+;
+ *  does not modify +self+.
+ *
+ *  With no block given, the minimum and maximum values are determined using method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].minmax # => [0, 3]
+ *
+ *  With a block given, the block must return a numeric;
+ *  the block is called <tt>self.size - 1</tt> times to compare elements;
+ *  returns the elements having the minimum and maximum values per the block:
+ *
+ *    ['0', '', '000', '00'].minmax {|a, b| a.size <=> b.size }
+ *    # => ["", "000"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+    if (rb_block_given_p()) {
+        return rb_call_super(0, NULL);
+    }
+    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
+}
+
+/*
+ *  call-seq:
+ *    uniq! -> self or nil
+ *    uniq! {|element| ... } -> self or nil
+ *
+ *  Removes duplicate elements from +self+, the first occurrence always being retained;
+ *  returns +self+ if any elements removed, +nil+ otherwise.
+ *
+ *  With no block given, identifies and removes elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare elements:
+ *
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq! # => [0, 1, 2]
+ *    a.uniq! # => nil
+ *
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
+ *
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq! {|element| element.size } # => ["a", "aa", "aaa"]
+ *    a.uniq! {|element| element.size } # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+static VALUE
+rb_ary_uniq_bang(VALUE ary)
+{
+    VALUE hash;
+    long hash_size;
+
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) <= 1)
+        return Qnil;
+    if (rb_block_given_p())
+        hash = ary_make_hash_by(ary);
+    else
+        hash = ary_make_hash(ary);
+
+    hash_size = RHASH_SIZE(hash);
+    if (RARRAY_LEN(ary) == hash_size) {
+        return Qnil;
+    }
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
+    }
+    ary_resize_capa(ary, hash_size);
+    rb_hash_foreach(hash, push_value, ary);
+
     return ary;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.compact!    ->   array  or  nil
+ *    uniq -> new_array
+ *    uniq {|element| ... } -> new_array
+ *
+ *  Returns a new array containing those elements from +self+ that are not duplicates,
+ *  the first occurrence always being retained.
+ *
+ *  With no block given, identifies and omits duplicate elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare elements:
+ *
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq # => [0, 1, 2]
  *
- *  Removes +nil+ elements from array.
- *  Returns +nil+ if no changes were made.
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
  *
- *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- *     [ "a", "b", "c" ].compact!           #=> nil
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
+ *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
-rb_ary_compact_bang(ary)
-    VALUE ary;
+rb_ary_uniq(VALUE ary)
+{
+    VALUE hash, uniq;
+
+    if (RARRAY_LEN(ary) <= 1) {
+        hash = 0;
+        uniq = rb_ary_dup(ary);
+    }
+    else if (rb_block_given_p()) {
+        hash = ary_make_hash_by(ary);
+        uniq = rb_hash_values(hash);
+    }
+    else {
+        hash = ary_make_hash(ary);
+        uniq = rb_hash_values(hash);
+    }
+
+    return uniq;
+}
+
+/*
+ *  call-seq:
+ *    compact! -> self or nil
+ *
+ *  Removes all +nil+ elements from +self+;
+ *  Returns +self+ if any elements are removed, +nil+ otherwise:
+ *
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact! # => [0, false, "", [], {}]
+ *    a          # => [0, false, "", [], {}]
+ *    a.compact! # => nil
+ *
+ *  Related: Array#compact;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+VALUE
+rb_ary_compact_bang(VALUE ary)
 {
     VALUE *p, *t, *end;
+    long n;
 
     rb_ary_modify(ary);
-    p = t = RARRAY(ary)->ptr;
-    end = p + RARRAY(ary)->len;
-    
+    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+    end = p + RARRAY_LEN(ary);
+
     while (t < end) {
-	if (NIL_P(*t)) t++;
-	else *p++ = *t++;
+        if (NIL_P(*t)) t++;
+        else *p++ = *t++;
     }
-    if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
-	return Qnil;
+    n = p - RARRAY_CONST_PTR(ary);
+    if (RARRAY_LEN(ary) == n) {
+        return Qnil;
     }
-    RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
-    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    ary_resize_smaller(ary, n);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.compact     ->  an_array
+ *    compact -> new_array
+ *
+ *  Returns a new array containing only the non-+nil+ elements from +self+;
+ *  element order is preserved:
  *
- *  Returns a copy of _self_ with all +nil+ elements removed.
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact # => [0, false, "", [], {}]
  *
- *     [ "a", nil, "b", nil, "c", nil ].compact
- *                       #=> [ "a", "b", "c" ]
+ *  Related: Array#compact!;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
-rb_ary_compact(ary)
-    VALUE ary;
+rb_ary_compact(VALUE ary)
 {
     ary = rb_ary_dup(ary);
     rb_ary_compact_bang(ary);
@@ -2962,149 +6583,2308 @@ rb_ary_compact(ary)
 
 /*
  *  call-seq:
- *     array.nitems -> int
- *  
- *  Returns the number of non-<code>nil</code> elements in _self_.
- *  May be zero.
- *     
- *     [ 1, nil, 3, nil, 5 ].nitems   #=> 3
+ *    count -> integer
+ *    count(object) -> integer
+ *    count {|element| ... } -> integer
+ *
+ *  Returns a count of specified elements.
+ *
+ *  With no argument and no block, returns the count of all elements:
+ *
+ *    [0, :one, 'two', 3, 3.0].count # => 5
+ *
+ *  With argument +object+ given, returns the count of elements <tt>==</tt> to +object+:
+ *
+ *    [0, :one, 'two', 3, 3.0].count(3) # => 2
+ *
+ *  With no argument and a block given, calls the block with each element;
+ *  returns the count of elements for which the block returns a truthy value:
+ *
+ *    [0, 1, 2, 3].count {|element| element > 1 } # => 2
+ *
+ *  With argument +object+ and a block given, issues a warning, ignores the block,
+ *  and returns the count of elements <tt>==</tt> to +object+.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_nitems(ary)
-    VALUE ary;
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
-    long n = 0;
-    VALUE *p, *pend;
+    long i, n = 0;
 
-    p = RARRAY(ary)->ptr;
-    pend = p + RARRAY(ary)->len;
+    if (rb_check_arity(argc, 0, 1) == 0) {
+        VALUE v;
 
-    while (p < pend) {
-	if (!NIL_P(*p)) n++;
-	p++;
+        if (!rb_block_given_p())
+            return LONG2NUM(RARRAY_LEN(ary));
+
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            v = RARRAY_AREF(ary, i);
+            if (RTEST(rb_yield(v))) n++;
+        }
     }
+    else {
+        VALUE obj = argv[0];
+
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+        }
+    }
+
     return LONG2NUM(n);
 }
 
-static long
-flatten(ary, idx, ary2, memo)
-    VALUE ary;
-    long idx;
-    VALUE ary2, memo;
+static VALUE
+flatten(VALUE ary, int level)
 {
-    VALUE id;
-    long i = idx;
-    long n, lim = idx + RARRAY(ary2)->len;
+    long i;
+    VALUE stack, result, tmp = 0, elt;
+    VALUE memo = Qfalse;
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        elt = RARRAY_AREF(ary, i);
+        tmp = rb_check_array_type(elt);
+        if (!NIL_P(tmp)) {
+            break;
+        }
+    }
+    if (i == RARRAY_LEN(ary)) {
+        return ary;
+    }
+
+    result = ary_new(0, RARRAY_LEN(ary));
+    ary_memcpy(result, 0, i, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(result, i);
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    rb_ary_push(stack, ary);
+    rb_ary_push(stack, LONG2NUM(i + 1));
+
+    if (level < 0) {
+        memo = rb_obj_hide(rb_ident_hash_new());
+        rb_hash_aset(memo, ary, Qtrue);
+        rb_hash_aset(memo, tmp, Qtrue);
+    }
+
+    ary = tmp;
+    i = 0;
+
+    while (1) {
+        while (i < RARRAY_LEN(ary)) {
+            elt = RARRAY_AREF(ary, i++);
+            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+                rb_ary_push(result, elt);
+                continue;
+            }
+            tmp = rb_check_array_type(elt);
+            if (RBASIC(result)->klass) {
+                if (RTEST(memo)) {
+                    rb_hash_clear(memo);
+                }
+                rb_raise(rb_eRuntimeError, "flatten reentered");
+            }
+            if (NIL_P(tmp)) {
+                rb_ary_push(result, elt);
+            }
+            else {
+                if (memo) {
+                    if (rb_hash_aref(memo, tmp) == Qtrue) {
+                        rb_hash_clear(memo);
+                        rb_raise(rb_eArgError, "tried to flatten recursive array");
+                    }
+                    rb_hash_aset(memo, tmp, Qtrue);
+                }
+                rb_ary_push(stack, ary);
+                rb_ary_push(stack, LONG2NUM(i));
+                ary = tmp;
+                i = 0;
+            }
+        }
+        if (RARRAY_LEN(stack) == 0) {
+            break;
+        }
+        if (memo) {
+            rb_hash_delete(memo, ary);
+        }
+        tmp = rb_ary_pop(stack);
+        i = NUM2LONG(tmp);
+        ary = rb_ary_pop(stack);
+    }
+
+    if (memo) {
+        rb_hash_clear(memo);
+    }
+
+    RBASIC_SET_CLASS(result, rb_cArray);
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    flatten!(depth = nil) -> self or nil
+ *
+ *  Returns +self+ as a recursively flattening of +self+ to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  Returns +nil+ if no elements were flattened.
+ *
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a                   # => [0, [1, [2, 3], 4], 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1)   # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1.1) # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(2)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(3)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *
+ *  With +nil+ or negative argument +depth+, flattens all levels:
+ *
+ *    a.dup.flatten!     # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(-1) # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *
+ *  Related: Array#flatten;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
+    rb_ary_modify_check(ary);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return Qnil;
+
+    result = flatten(ary, level);
+    if (result == ary) {
+        return Qnil;
+    }
+    if (!(mod = ARY_EMBED_P(result))) rb_ary_freeze(result);
+    rb_ary_replace(ary, result);
+    if (mod) ARY_SET_EMBED_LEN(result, 0);
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    flatten(depth = nil) -> new_array
+ *
+ *  Returns a new array that is a recursive flattening of +self+
+ *  to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a              # => [0, [1, [2, 3], 4], 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(0)   # => [0, [1, [2, 3], 4], 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(1  ) # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(1.1) # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(2)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(3)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *
+ *  With +nil+ or negative +depth+, flattens all levels.
+ *
+ *    a.flatten     # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *
+ *  Related: Array#flatten!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
+static VALUE
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+    int level = -1;
+    VALUE result;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+        level = NUM2INT(argv[0]);
+        if (level == 0) return ary_make_shared_copy(ary);
+    }
+
+    result = flatten(ary, level);
+    if (result == ary) {
+        result = ary_make_shared_copy(ary);
+    }
+
+    return result;
+}
+
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
+
+static VALUE
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+{
+    long i, len;
+
+    rb_ary_modify(ary);
+    i = len = RARRAY_LEN(ary);
+    RARRAY_PTR_USE(ary, ptr, {
+        while (i > 1) {
+            long j = RAND_UPTO(i);
+            VALUE tmp;
+            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+                rb_raise(rb_eRuntimeError, "modified during shuffle");
+            }
+            tmp = ptr[--i];
+            ptr[i] = ptr[j];
+            ptr[j] = tmp;
+        }
+    }); /* WB: no new reference */
+    return ary;
+}
+
+static VALUE
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_shuffle_bang(ec, ary, randgen);
+    return ary;
+}
+
+static const rb_data_type_t ary_sample_memo_type = {
+    .wrap_struct_name = "ary_sample_memo",
+    .function = {
+        .dfree = (RUBY_DATA_FUNC)st_free_table,
+    },
+    .flags = RUBY_TYPED_WB_PROTECTED | RUBY_TYPED_FREE_IMMEDIATELY
+};
+
+static VALUE
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
+{
+    VALUE result;
+    long n, len, i, j, k, idx[10];
+    long rnds[numberof(idx)];
+    long memo_threshold;
+
+    len = RARRAY_LEN(ary);
+    if (!to_array) {
+        if (len < 2)
+            i = 0;
+        else
+            i = RAND_UPTO(len);
+
+        return rb_ary_elt(ary, i);
+    }
+    n = NUM2LONG(nv);
+    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+    if (n > len) n = len;
+    if (n <= numberof(idx)) {
+        for (i = 0; i < n; ++i) {
+            rnds[i] = RAND_UPTO(len - i);
+        }
+    }
+    k = len;
+    len = RARRAY_LEN(ary);
+    if (len < k && n <= numberof(idx)) {
+        for (i = 0; i < n; ++i) {
+            if (rnds[i] >= len) return rb_ary_new_capa(0);
+        }
+    }
+    if (n > len) n = len;
+    switch (n) {
+      case 0:
+        return rb_ary_new_capa(0);
+      case 1:
+        i = rnds[0];
+        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
+      case 2:
+        i = rnds[0];
+        j = rnds[1];
+        if (j >= i) j++;
+        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+      case 3:
+        i = rnds[0];
+        j = rnds[1];
+        k = rnds[2];
+        {
+            long l = j, g = i;
+            if (j >= i) l = i, g = ++j;
+            if (k >= l && (++k >= g)) ++k;
+        }
+        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+    }
+    memo_threshold =
+        len < 2560 ? len / 128 :
+        len < 5120 ? len / 64 :
+        len < 10240 ? len / 32 :
+        len / 16;
+    if (n <= numberof(idx)) {
+        long sorted[numberof(idx)];
+        sorted[0] = idx[0] = rnds[0];
+        for (i=1; i<n; i++) {
+            k = rnds[i];
+            for (j = 0; j < i; ++j) {
+                if (k < sorted[j]) break;
+                ++k;
+            }
+            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+            sorted[j] = idx[i] = k;
+        }
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+            }
+        });
+    }
+    else if (n <= memo_threshold / 2) {
+        long max_idx = 0;
+        VALUE vmemo = TypedData_Wrap_Struct(0, &ary_sample_memo_type, 0);
+        st_table *memo = st_init_numtable_with_size(n);
+        RTYPEDDATA_DATA(vmemo) = memo;
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                long r = RAND_UPTO(len-i) + i;
+                ptr_result[i] = r;
+                if (r > max_idx) max_idx = r;
+            }
+            len = RARRAY_LEN(ary);
+            if (len <= max_idx) n = 0;
+            else if (n > len) n = len;
+            RARRAY_PTR_USE(ary, ptr_ary, {
+                for (i=0; i<n; i++) {
+                    long j2 = j = ptr_result[i];
+                    long i2 = i;
+                    st_data_t value;
+                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
+                    ptr_result[i] = ptr_ary[j2];
+                }
+            });
+        });
+        RTYPEDDATA_DATA(vmemo) = 0;
+        st_free_table(memo);
+        RB_GC_GUARD(vmemo);
+    }
+    else {
+        result = rb_ary_dup(ary);
+        RBASIC_CLEAR_CLASS(result);
+        RB_GC_GUARD(ary);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                j = RAND_UPTO(len-i) + i;
+                nv = ptr_result[j];
+                ptr_result[j] = ptr_result[i];
+                ptr_result[i] = nv;
+            }
+        });
+        RBASIC_SET_CLASS_RAW(result, rb_cArray);
+    }
+    ARY_SET_LEN(result, n);
+
+    return result;
+}
+
+static VALUE
+ary_sized_alloc(rb_execution_context_t *ec, VALUE self)
+{
+    return rb_ary_new2(RARRAY_LEN(self));
+}
+
+static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+    long mul;
+    VALUE n = Qnil;
+    if (args && (RARRAY_LEN(args) > 0)) {
+        n = RARRAY_AREF(args, 0);
+    }
+    if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
+    mul = NUM2LONG(n);
+    if (mul <= 0) return INT2FIX(0);
+    n = LONG2FIX(mul);
+    return rb_fix_mul_fix(rb_ary_length(self), n);
+}
+
+/*
+ *  call-seq:
+ *    cycle(count = nil) {|element| ... } -> nil
+ *    cycle(count = nil) -> new_enumerator
+ *
+ *  With a block given, may call the block, depending on the value of argument +count+;
+ *  +count+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *
+ *  When +count+ is positive,
+ *  calls the block with each element, then does so repeatedly,
+ *  until it has done so +count+ times; returns +nil+:
+ *
+ *    output = []
+ *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ *    output # => [0, 1, 0, 1]
+ *
+ *  When +count+ is zero or negative, does not call the block:
+ *
+ *    [0, 1].cycle(0) {|element| fail 'Cannot happen' }  # => nil
+ *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
+ *
+ *  When +count+ is +nil+, cycles forever:
+ *
+ *    # Prints 0 and 1 forever.
+ *    [0, 1].cycle {|element| puts element }
+ *    [0, 1].cycle(nil) {|element| puts element }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+    long n, i;
+
+    rb_check_arity(argc, 0, 1);
+
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+    if (argc == 0 || NIL_P(argv[0])) {
+        n = -1;
+    }
+    else {
+        n = NUM2LONG(argv[0]);
+        if (n <= 0) return Qnil;
+    }
+
+    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            rb_yield(RARRAY_AREF(ary, i));
+        }
+    }
+    return Qnil;
+}
+
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
+{
+    const VALUE result = rb_ary_new2(r);
+    long i;
 
-    id = rb_obj_id(ary2);
-    if (rb_ary_includes(memo, id)) {
-	rb_raise(rb_eArgError, "tried to flatten recursive array");
+    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
+    ARY_SET_LEN(result, r);
+    rb_yield(result);
+    return !RBASIC(values)->klass;
+}
+
+/*
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    for (;;) {
+        const char *const unused = memchr(&used[i], 0, n-i);
+        if (!unused) {
+            if (!index) break;
+            i = p[--index];                /* pop index */
+            used[i++] = 0;                 /* index unused */
+        }
+        else {
+            i = unused - used;
+            p[index] = i;
+            used[i] = 1;                   /* mark index used */
+            ++index;
+            if (index < r-1) {             /* if not done yet */
+                p[index] = i = 0;
+                continue;
+            }
+            for (i = 0; i < n; ++i) {
+                if (used[i]) continue;
+                p[index] = i;
+                if (!yield_indexed_values(values, r, p)) {
+                    rb_raise(rb_eRuntimeError, "permute reentered");
+                }
+            }
+            i = p[--index];                /* pop index */
+            used[i] = 0;                   /* index unused */
+            p[index] = ++i;
+        }
+    }
+}
+
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
+static VALUE
+descending_factorial(long from, long how_many)
+{
+    VALUE cnt;
+    if (how_many > 0) {
+        cnt = LONG2FIX(from);
+        while (--how_many > 0) {
+            long v = --from;
+            cnt = rb_int_mul(cnt, LONG2FIX(v));
+        }
     }
-    rb_ary_push(memo, id);
-    rb_ary_splice(ary, idx, 1, ary2);
-    while (i < lim) {
-	VALUE tmp;
+    else {
+        cnt = LONG2FIX(how_many == 0);
+    }
+    return cnt;
+}
 
-	tmp = rb_check_array_type(rb_ary_elt(ary, i));
-	if (!NIL_P(tmp)) {
-	    n = flatten(ary, i, tmp, memo);
-	    i += n; lim += n;
-	}
-	i++;
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+    VALUE r;
+    long i;
+    if (comb > size-comb) {
+        comb = size-comb;
+    }
+    if (comb < 0) {
+        return LONG2FIX(0);
+    }
+    else if (comb == 0) {
+        return LONG2FIX(1);
     }
-    rb_ary_pop(memo);
+    r = LONG2FIX(size);
+    for (i = 1; i < comb; ++i) {
+        r = rb_int_mul(r, LONG2FIX(size - i));
+        r = rb_int_idiv(r, LONG2FIX(i + 1));
+    }
+    return r;
+}
 
-    return lim - idx - 1;	/* returns number of increased items */
+static VALUE
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+
+    return descending_factorial(n, k);
 }
 
 /*
  *  call-seq:
- *     array.flatten! -> array or nil
- *  
- *  Flattens _self_ in place.
- *  Returns <code>nil</code> if no modifications were made (i.e.,
- *  <i>array</i> contains no subarrays.)
- *     
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!   #=> [1, 2, 3, 4, 5]
- *     a.flatten!   #=> nil
- *     a            #=> [1, 2, 3, 4, 5]
+ *    permutation(count = self.size) {|permutation| ... } -> self
+ *    permutation(count = self.size) -> new_enumerator
+ *
+ *  Iterates over permutations of the elements of +self+;
+ *  the order of permutations is indeterminate.
+ *
+ *  With a block and an in-range positive integer argument +count+ (<tt>0 < count <= self.size</tt>) given,
+ *  calls the block with each permutation of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = [0, 1, 2]
+ *    perms = []
+ *    a.permutation(1) {|perm| perms.push(perm) }
+ *    perms # => [[0], [1], [2]]
+ *
+ *    perms = []
+ *    a.permutation(2) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1], [0, 2], [1, 0], [1, 2], [2, 0], [2, 1]]
+ *
+ *    perms = []
+ *    a.permutation(3) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1, 2], [0, 2, 1], [1, 0, 2], [1, 2, 0], [2, 0, 1], [2, 1, 0]]
+ *
+ *  When +count+ is zero, calls the block once with a new empty array:
+ *
+ *    perms = []
+ *    a.permutation(0) {|perm| perms.push(perm) }
+ *    perms # => [[]]
+ *
+ *  When +count+ is out of range (negative or larger than <tt>self.size</tt>),
+ *  does not call the block:
+ *
+ *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ *    a.permutation(4) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
-rb_ary_flatten_bang(ary)
-    VALUE ary;
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
 {
-    long i = 0;
-    int mod = 0;
-    VALUE memo = Qnil;
-
-    while (i<RARRAY(ary)->len) {
-	VALUE ary2 = RARRAY(ary)->ptr[i];
-	VALUE tmp;
-
-	tmp = rb_check_array_type(ary2);
-	if (!NIL_P(tmp)) {
-	    if (NIL_P(memo)) {
-		memo = rb_ary_new();
-	    }
-	    i += flatten(ary, i, tmp, memo);
-	    mod = 1;
-	}
-	i++;
-    }
-    if (mod == 0) return Qnil;
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
+    r = n;
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
+
+    if (r < 0 || n < r) {
+        /* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else {             /* this is the general case */
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+        char *used = (char*)(p + r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
+
+        MEMZERO(used, char, n); /* initialize array */
+
+        permute0(n, r, p, used, ary0); /* compute and yield permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
     return ary;
 }
 
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+    long lev = 0;
+
+    MEMZERO(stack+1, long, n);
+    stack[0] = -1;
+    for (;;) {
+        for (lev++; lev < n; lev++) {
+            stack[lev+1] = stack[lev]+1;
+        }
+        if (!yield_indexed_values(values, n, stack+1)) {
+            rb_raise(rb_eRuntimeError, "combination reentered");
+        }
+        do {
+            if (lev == 0) return;
+            stack[lev--]++;
+        } while (stack[lev+1]+n == len+lev+1);
+    }
+}
+
+static VALUE
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+    return binomial_coefficient(k, n);
+}
+
 /*
  *  call-seq:
- *     array.flatten -> an_array
- *  
- *  Returns a new array that is a one-dimensional flattening of this
- *  array (recursively). That is, for every element that is an array,
- *  extract its elements into the new array.
- *     
- *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
- *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
+ *    combination(count) {|element| ... } -> self
+ *    combination(count) -> new_enumerator
+ *
+ *  When a block and a positive
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  argument +count+ (<tt>0 < count <= self.size</tt>)
+ *  are given, calls the block with each combination of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = %w[a b c]                                   # => ["a", "b", "c"]
+ *    a.combination(2) {|combination| p combination } # => ["a", "b", "c"]
+ *
+ *  Output:
+ *
+ *    ["a", "b"]
+ *    ["a", "c"]
+ *    ["b", "c"]
+ *
+ *  The order of the yielded combinations is not guaranteed.
+ *
+ *  When +count+ is zero, calls the block once with a new empty array:
+ *
+ *    a.combination(0) {|combination| p combination }
+ *    [].combination(0) {|combination| p combination }
+ *
+ *  Output:
+ *
+ *    []
+ *    []
+ *
+ *  When +count+ is negative or larger than +self.size+ and +self+ is non-empty,
+ *  does not call the block:
+ *
+ *    a.combination(-1) {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *    a.combination(4)  {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: Array#permutation;
+ *  see also {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
-rb_ary_flatten(ary)
-    VALUE ary;
+rb_ary_combination(VALUE ary, VALUE num)
+{
+    long i, n, len;
+
+    n = NUM2LONG(num);
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
+    len = RARRAY_LEN(ary);
+    if (n < 0 || len < n) {
+        /* yield nothing */
+    }
+    else if (n == 0) {
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else {
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        volatile VALUE t0;
+        long *stack = ALLOCV_N(long, t0, n+1);
+
+        RBASIC_CLEAR_CLASS(ary0);
+        combinate0(len, n, stack, ary0);
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+        if (++index < r-1) {
+            p[index] = i = 0;
+            continue;
+        }
+        for (i = 0; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated permute reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
+    }
+}
+
+static VALUE
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+    if (k < 0) {
+        return LONG2FIX(0);
+    }
+    if (n <= 0) {
+        return LONG2FIX(!k);
+    }
+    return rb_int_positive_pow(n, (unsigned long)k);
+}
+
+/*
+ *  call-seq:
+ *    repeated_permutation(size) {|permutation| ... } -> self
+ *    repeated_permutation(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated permutation of length +size+
+ *  of the elements of +self+;
+ *  each permutation is an array;
+ *  returns +self+. The order of the permutations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated permutation of the elements of +self+.
+ *  The number of permutations is <tt>self.size**size</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
+ *
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(1) {|permutation| p.push(permutation) }
+ *      p # => [[0], [1], [2]]
+ *
+ *  - +size+ is 2:
+ *
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(2) {|permutation| p.push(permutation) }
+ *      p # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
+ *
+ *  If +size+ is zero, calls the block once with an empty array.
+ *
+ *  If +size+ is negative, does not call the block:
+ *
+ *    [0, 1, 2].repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size);      /* Return Enumerator if no block */
+    r = NUM2LONG(num);                    /* Permutation size from argument */
+
+    if (r < 0) {
+        /* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else {             /* this is the general case */
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
+
+        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+static void
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+        if (++index < r-1) {
+            p[index] = i;
+            continue;
+        }
+        for (; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated combination reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
+    }
+}
+
+static VALUE
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+    if (k == 0) {
+        return LONG2FIX(1);
+    }
+    return binomial_coefficient(k, n + k - 1);
+}
+
+/*
+ *  call-seq:
+ *    repeated_combination(size) {|combination| ... } -> self
+ *    repeated_combination(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated combination of length +size+
+ *  of the elements of +self+;
+ *  each combination is an array;
+ *  returns +self+. The order of the combinations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated combination of the elements of +self+.
+ *  The number of combinations is <tt>(size+1)(size+2)/2</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
+ *
+ *      c = []
+ *      [0, 1, 2].repeated_combination(1) {|combination| c.push(combination) }
+ *      c # => [[0], [1], [2]]
+ *
+ *  - +size+ is 2:
+ *
+ *      c = []
+ *      [0, 1, 2].repeated_combination(2) {|combination| c.push(combination) }
+ *      c # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
+ *
+ *  If +size+ is zero, calls the block once with an empty array.
+ *
+ *  If +size+ is negative, does not call the block:
+ *
+ *    [0, 1, 2].repeated_combination(-1) {|combination| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);                 /* Combination size from argument */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
+    len = RARRAY_LEN(ary);
+    if (n < 0) {
+        /* yield nothing */
+    }
+    else if (n == 0) {
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else if (len == 0) {
+        /* yield nothing */
+    }
+    else {
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, n);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
+
+        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    product(*other_arrays) -> new_array
+ *    product(*other_arrays) {|combination| ... } -> self
+ *
+ *  Computes all combinations of elements from all the arrays,
+ *  including both +self+ and +other_arrays+:
+ *
+ *  - The number of combinations is the product of the sizes of all the arrays,
+ *    including both +self+ and +other_arrays+.
+ *  - The order of the returned combinations is indeterminate.
+ *
+ *  With no block given, returns the combinations as an array of arrays:
+ *
+ *    p = [0, 1].product([2, 3])
+ *    # => [[0, 2], [0, 3], [1, 2], [1, 3]]
+ *    p.size # => 4
+ *    p = [0, 1].product([2, 3], [4, 5])
+ *    # => [[0, 2, 4], [0, 2, 5], [0, 3, 4], [0, 3, 5], [1, 2, 4], [1, 2, 5], [1, 3, 4], [1, 3,...
+ *    p.size # => 8
+ *
+ *  If +self+ or any argument is empty, returns an empty array:
+ *
+ *    [].product([2, 3], [4, 5]) # => []
+ *    [0, 1].product([2, 3], []) # => []
+ *
+ *  If no argument is given, returns an array of 1-element arrays,
+ *  each containing an element of +self+:
+ *
+ *    a.product # => [[0], [1], [2]]
+ *
+ *  With a block given, calls the block with each combination; returns +self+:
+ *
+ *    p = []
+ *    [0, 1].product([2, 3]) {|combination| p.push(combination) }
+ *    p # => [[0, 2], [0, 3], [1, 2], [1, 3]]
+ *
+ *  If +self+ or any argument is empty, does not call the block:
+ *
+ *    [].product([2, 3], [4, 5]) {|combination| fail 'Cannot happen' }
+ *    # => []
+ *    [0, 1].product([2, 3], []) {|combination| fail 'Cannot happen' }
+ *    # => [0, 1]
+ *
+ *  If no argument is given, calls the block with each element of +self+ as a 1-element array:
+ *
+ *    p = []
+ *    [0, 1].product {|combination| p.push(combination) }
+ *    p # => [[0], [1]]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+    int n = argc+1;    /* How many arrays we're operating on */
+    volatile VALUE t0 = rb_ary_hidden_new(n);
+    volatile VALUE t1 = Qundef;
+    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
+    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
+    long i,j;
+    long resultlen = 1;
+
+    RBASIC_CLEAR_CLASS(t0);
+
+    /* initialize the arrays of arrays */
+    ARY_SET_LEN(t0, n);
+    arrays[0] = ary;
+    for (i = 1; i < n; i++) arrays[i] = Qnil;
+    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+    /* initialize the counters for the arrays */
+    for (i = 0; i < n; i++) counters[i] = 0;
+
+    /* Otherwise, allocate and fill in an array of results */
+    if (rb_block_given_p()) {
+        /* Make defensive copies of arrays; exit if any is empty */
+        for (i = 0; i < n; i++) {
+            if (RARRAY_LEN(arrays[i]) == 0) goto done;
+            arrays[i] = ary_make_shared_copy(arrays[i]);
+        }
+    }
+    else {
+        /* Compute the length of the result array; return [] if any is empty */
+        for (i = 0; i < n; i++) {
+            long k = RARRAY_LEN(arrays[i]);
+            if (k == 0) {
+                result = rb_ary_new2(0);
+                goto done;
+            }
+            if (MUL_OVERFLOW_LONG_P(resultlen, k))
+                rb_raise(rb_eRangeError, "too big to product");
+            resultlen *= k;
+        }
+        result = rb_ary_new2(resultlen);
+    }
+    for (;;) {
+        int m;
+        /* fill in one subarray */
+        VALUE subarray = rb_ary_new2(n);
+        for (j = 0; j < n; j++) {
+            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+        }
+
+        /* put it on the result array */
+        if (NIL_P(result)) {
+            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+            rb_yield(subarray);
+            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+                rb_raise(rb_eRuntimeError, "product reentered");
+            }
+            else {
+                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+            }
+        }
+        else {
+            rb_ary_push(result, subarray);
+        }
+
+        /*
+         * Increment the last counter.  If it overflows, reset to 0
+         * and increment the one before it.
+         */
+        m = n-1;
+        counters[m]++;
+        while (counters[m] == RARRAY_LEN(arrays[m])) {
+            counters[m] = 0;
+            /* If the first counter overflows, we are done */
+            if (--m < 0) goto done;
+            counters[m]++;
+        }
+    }
+
+done:
+    ALLOCV_END(t1);
+
+    return NIL_P(result) ? ary : result;
+}
+
+/*
+ *  call-seq:
+ *    take(count) -> new_array
+ *
+ *  Returns a new array containing the first +count+ element of +self+
+ *  (as available);
+ *  +count+ must be a non-negative numeric;
+ *  does not modify +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.take(2)   # => ["a", "b"]
+ *    a.take(2.1) # => ["a", "b"]
+ *    a.take(50)  # => ["a", "b", "c", "d"]
+ *    a.take(0)   # => []
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+    long len = NUM2LONG(n);
+    if (len < 0) {
+        rb_raise(rb_eArgError, "attempt to take negative size");
+    }
+    return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ *  call-seq:
+ *    take_while {|element| ... } -> new_array
+ *    take_while -> new_enumerator
+ *
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops iterating if the block returns +false+ or +nil+;
+ *  returns a new array containing those elements for which the block returned a truthy value:
+ *
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| element < 3 } # => [0, 1, 2]
+ *    a.take_while {|element| true }        # => [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| false }       # => []
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Does not modify +self+.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *    drop(count) -> new_array
+ *
+ *  Returns a new array containing all but the first +count+ element of +self+,
+ *  where +count+ is a non-negative integer;
+ *  does not modify +self+.
+ *
+ *  Examples:
+ *
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ *    a.drop(1) # => [1, 2, 3, 4, 5]
+ *    a.drop(2) # => [2, 3, 4, 5]
+ *    a.drop(9) # => []
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+    VALUE result;
+    long pos = NUM2LONG(n);
+    if (pos < 0) {
+        rb_raise(rb_eArgError, "attempt to drop negative size");
+    }
+
+    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+    if (NIL_P(result)) result = rb_ary_new();
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    drop_while {|element| ... } -> new_array
+ *    drop_while -> new_enumerator
+ *
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops if the block returns +false+ or +nil+;
+ *  returns a new array _omitting_ those elements for which the block returned a truthy value;
+ *  does not modify +self+:
+ *
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *    any? -> true or false
+ *    any?(object) -> true or false
+ *    any? {|element| ... } -> true or false
+ *
+ *  Returns whether for any element of +self+, a given criterion is satisfied.
+ *
+ *  With no block and no argument, returns whether any element of +self+ is truthy:
+ *
+ *    [nil, false, []].any? # => true  # Array object is truthy.
+ *    [nil, false, {}].any? # => true  # Hash object is truthy.
+ *    [nil, false, ''].any? # => true  # String object is truthy.
+ *    [nil, false].any?     # => false # Nil and false are not truthy.
+ *
+ *  With argument +object+ given,
+ *  returns whether <tt>object === ele</tt> for any element +ele+ in +self+:
+ *
+ *    [nil, false, 0].any?(0)          # => true
+ *    [nil, false, 1].any?(0)          # => false
+ *    [nil, false, 'food'].any?(/foo/) # => true
+ *    [nil, false, 'food'].any?(/bar/) # => false
+ *
+ *  With a block given,
+ *  calls the block with each element in +self+;
+ *  returns whether the block returns any truthy value:
+ *
+ *    [0, 1, 2].any? {|ele| ele < 1 } # => true
+ *    [0, 1, 2].any? {|ele| ele < 0 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +false+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    return Qfalse;
+}
+
+/*
+ *  call-seq:
+ *    all? -> true or false
+ *    all?(object) -> true or false
+ *    all? {|element| ... } -> true or false
+ *
+ *  Returns whether for every element of +self+,
+ *  a given criterion is satisfied.
+ *
+ *  With no block and no argument,
+ *  returns whether every element of +self+ is truthy:
+ *
+ *    [[], {}, '', 0, 0.0, Object.new].all? # => true  # All truthy objects.
+ *    [[], {}, '', 0, 0.0, nil].all?        # => false # nil is not truthy.
+ *    [[], {}, '', 0, 0.0, false].all?      # => false # false is not truthy.
+ *
+ *  With argument +object+ given, returns whether <tt>object === ele</tt>
+ *  for every element +ele+ in +self+:
+ *
+ *    [0, 0, 0].all?(0)                    # => true
+ *    [0, 1, 2].all?(1)                    # => false
+ *    ['food', 'fool', 'foot'].all?(/foo/) # => true
+ *    ['food', 'drink'].all?(/foo/)        # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns whether the block returns only truthy values:
+ *
+ *    [0, 1, 2].all? { |ele| ele < 3 } # => true
+ *    [0, 1, 2].all? { |ele| ele < 2 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +true+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    none? -> true or false
+ *    none?(object) -> true or false
+ *    none? {|element| ... } -> true or false
+ *
+ *  Returns +true+ if no element of +self+ meets a given criterion, +false+ otherwise.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ *  +false+ otherwise:
+ *
+ *    [nil, false].none?    # => true
+ *    [nil, 0, false].none? # => false
+ *    [].none?              # => true
+ *
+ *  With argument +object+ given, returns +false+ if for any element +element+,
+ *  <tt>object === element</tt>; +true+ otherwise:
+ *
+ *    ['food', 'drink'].none?(/bar/) # => true
+ *    ['food', 'drink'].none?(/foo/) # => false
+ *    [].none?(/foo/)                # => true
+ *    [0, 1, 2].none?(3)             # => true
+ *    [0, 1, 2].none?(1)             # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ *    [0, 1, 2].none? {|element| element > 3 } # => true
+ *    [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    one? -> true or false
+ *    one? {|element| ... } -> true or false
+ *    one?(object) -> true or false
+ *
+ *  Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ *  +false+ otherwise:
+ *
+ *    [nil, 0].one? # => true
+ *    [0, 0].one? # => false
+ *    [nil, nil].one? # => false
+ *    [].one? # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ *    [0, 1, 2].one? {|element| element > 0 } # => false
+ *    [0, 1, 2].one? {|element| element > 1 } # => true
+ *    [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ *  With argument +object+ given, returns +true+ if for exactly one element +element+, <tt>object === element</tt>;
+ *  +false+ otherwise:
+ *
+ *    [0, 1, 2].one?(0) # => true
+ *    [0, 0, 1].one?(0) # => false
+ *    [1, 1, 2].one?(0) # => false
+ *    ['food', 'drink'].one?(/bar/) # => false
+ *    ['food', 'drink'].one?(/foo/) # => true
+ *    [].one?(/foo/) # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    VALUE result = Qfalse;
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    dig(index, *identifiers) -> object
+ *
+ *  Finds and returns the object in nested object
+ *  specified by +index+ and +identifiers+;
+ *  the nested objects may be instances of various classes.
+ *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ *  Examples:
+ *
+ *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ *    a.dig(1, 2) # => [:bat, :bam]
+ *    a.dig(1, 2, 0) # => :bat
+ *    a.dig(1, 2, 3) # => nil
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    self = rb_ary_at(self, *argv);
+    if (!--argc) return self;
+    ++argv;
+    return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+    if (n != 0)
+        v = rb_fix_plus(LONG2FIX(n), v);
+    if (!UNDEF_P(r)) {
+        v = rb_rational_plus(r, v);
+    }
+    else if (!n && z) {
+        v = rb_fix_plus(LONG2FIX(0), v);
+    }
+    return v;
+}
+
+/*
+ * call-seq:
+ *   sum(init = 0) -> object
+ *   sum(init = 0) {|element| ... } -> object
+ *
+ *  With no block given, returns the sum of +init+ and all elements of +self+;
+ *  for array +array+ and value +init+, equivalent to:
+ *
+ *    sum = init
+ *    array.each {|element| sum += element }
+ *    sum
+ *
+ *  For example, <tt>[e0, e1, e2].sum</tt> returns <tt>init + e0 + e1 + e2</tt>.
+ *
+ *  Examples:
+ *
+ *    [0, 1, 2, 3].sum                 # => 6
+ *    [0, 1, 2, 3].sum(100)            # => 106
+ *    ['abc', 'def', 'ghi'].sum('jkl') # => "jklabcdefghi"
+ *    [[:foo, :bar], ['foo', 'bar']].sum([2, 3])
+ *    # => [2, 3, :foo, :bar, "foo", "bar"]
+ *
+ *  The +init+ value and elements need not be numeric, but must all be <tt>+</tt>-compatible:
+ *
+ *    # Raises TypeError: Array can't be coerced into Integer.
+ *    [[:foo, :bar], ['foo', 'bar']].sum(2)
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  the block's return value (instead of the element itself) is used as the addend:
+ *
+ *    ['zero', 1, :two].sum('Coerced and concatenated: ') {|element| element.to_s }
+ *    # => "Coerced and concatenated: zero1two"
+ *
+ *  Notes:
+ *
+ *  - Array#join and Array#flatten may be faster than Array#sum
+ *    for an array of strings or an array of arrays.
+ *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ *
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE e, v, r;
+    long i, n;
+    int block_given;
+
+    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+    block_given = rb_block_given_p();
+
+    if (RARRAY_LEN(ary) == 0)
+        return v;
+
+    n = 0;
+    r = Qundef;
+
+    if (!FIXNUM_P(v) && !RB_BIGNUM_TYPE_P(v) && !RB_TYPE_P(v, T_RATIONAL)) {
+        i = 0;
+        goto init_is_a_value;
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+        if (FIXNUM_P(e)) {
+            n += FIX2LONG(e); /* should not overflow long type */
+            if (!FIXABLE(n)) {
+                v = rb_big_plus(LONG2NUM(n), v);
+                n = 0;
+            }
+        }
+        else if (RB_BIGNUM_TYPE_P(e))
+            v = rb_big_plus(e, v);
+        else if (RB_TYPE_P(e, T_RATIONAL)) {
+            if (UNDEF_P(r))
+                r = e;
+            else
+                r = rb_rational_plus(r, e);
+        }
+        else
+            goto not_exact;
+    }
+    v = finish_exact_sum(n, r, v, argc!=0);
+    return v;
+
+  not_exact:
+    v = finish_exact_sum(n, r, v, i!=0);
+
+    if (RB_FLOAT_TYPE_P(e)) {
+        /*
+         * Kahan-Babuska balancing compensated summation algorithm
+         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+         */
+        double f, c;
+        double x, t;
+
+        f = NUM2DBL(v);
+        c = 0.0;
+        goto has_float_value;
+        for (; i < RARRAY_LEN(ary); i++) {
+            e = RARRAY_AREF(ary, i);
+            if (block_given)
+                e = rb_yield(e);
+            if (RB_FLOAT_TYPE_P(e))
+              has_float_value:
+                x = RFLOAT_VALUE(e);
+            else if (FIXNUM_P(e))
+                x = FIX2LONG(e);
+            else if (RB_BIGNUM_TYPE_P(e))
+                x = rb_big2dbl(e);
+            else if (RB_TYPE_P(e, T_RATIONAL))
+                x = rb_num2dbl(e);
+            else
+                goto not_float;
+
+            if (isnan(f)) continue;
+            if (isnan(x)) {
+                f = x;
+                continue;
+            }
+            if (isinf(x)) {
+                if (isinf(f) && signbit(x) != signbit(f))
+                    f = NAN;
+                else
+                    f = x;
+                continue;
+            }
+            if (isinf(f)) continue;
+
+            t = f + x;
+            if (fabs(f) >= fabs(x))
+                c += ((f - t) + x);
+            else
+                c += ((x - t) + f);
+            f = t;
+        }
+        f += c;
+        return DBL2NUM(f);
+
+      not_float:
+        v = DBL2NUM(f);
+    }
+
+    goto has_some_value;
+    init_is_a_value:
+    for (; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+      has_some_value:
+        v = rb_funcall(v, idPLUS, 1, e);
+    }
+    return v;
+}
+
+/* :nodoc: */
+static VALUE
+rb_ary_deconstruct(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_flatten_bang(ary);
     return ary;
 }
 
+/*
+ *  An \Array object is an ordered, integer-indexed collection of objects,
+ *  called _elements_;
+ *  the object represents
+ *  an {array data structure}[https://en.wikipedia.org/wiki/Array_(data_structure)].
+ *
+ *  An element may be any object (even another array);
+ *  elements may be any mixture of objects of different types.
+ *
+ *  Important data structures that use arrays include:
+ *
+ *  - {Coordinate vector}[https://en.wikipedia.org/wiki/Coordinate_vector].
+ *  - {Matrix}[https://en.wikipedia.org/wiki/Matrix_(mathematics)].
+ *  - {Heap}[https://en.wikipedia.org/wiki/Heap_(data_structure)].
+ *  - {Hash table}[https://en.wikipedia.org/wiki/Hash_table].
+ *  - {Deque (double-ended queue)}[https://en.wikipedia.org/wiki/Double-ended_queue].
+ *  - {Queue}[https://en.wikipedia.org/wiki/Queue_(abstract_data_type)].
+ *  - {Stack}[https://en.wikipedia.org/wiki/Stack_(abstract_data_type)].
+ *
+ *  There are also array-like data structures:
+ *
+ *  - {Associative array}[https://en.wikipedia.org/wiki/Associative_array] (see Hash).
+ *  - {Directory}[https://en.wikipedia.org/wiki/Directory_(computing)] (see Dir).
+ *  - {Environment}[https://en.wikipedia.org/wiki/Environment_variable] (see ENV).
+ *  - {Set}[https://en.wikipedia.org/wiki/Set_(abstract_data_type)] (see Set).
+ *  - {String}[https://en.wikipedia.org/wiki/String_(computer_science)] (see String).
+ *
+ *  == \Array Indexes
+ *
+ *  \Array indexing starts at 0, as in C or Java.
+ *
+ *  A non-negative index is an offset from the first element:
+ *
+ *  - Index 0 indicates the first element.
+ *  - Index 1 indicates the second element.
+ *  - ...
+ *
+ *  A negative index is an offset, backwards, from the end of the array:
+ *
+ *  - Index -1 indicates the last element.
+ *  - Index -2 indicates the next-to-last element.
+ *  - ...
+ *
+ *
+ *  === In-Range and Out-of-Range Indexes
+ *
+ *  A non-negative index is <i>in range</i> if and only if it is smaller than
+ *  the size of the array.  For a 3-element array:
+ *
+ *  - Indexes 0 through 2 are in range.
+ *  - Index 3 is out of range.
+ *
+ *  A negative index is <i>in range</i> if and only if its absolute value is
+ *  not larger than the size of the array.  For a 3-element array:
+ *
+ *  - Indexes -1 through -3 are in range.
+ *  - Index -4 is out of range.
+ *
+ *  === Effective Index
+ *
+ *  Although the effective index into an array is always an integer,
+ *  some methods (both within class \Array and elsewhere)
+ *  accept one or more non-integer arguments that are
+ *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  == Creating Arrays
+ *
+ *  You can create an \Array object explicitly with:
+ *
+ *  - An {array literal}[rdoc-ref:syntax/literals.rdoc@Array+Literals]:
+ *
+ *      [1, 'one', :one, [2, 'two', :two]]
+ *
+ *  - A {%w or %W string-array Literal}[rdoc-ref:syntax/literals.rdoc@w-and-w-String-Array-Literals]:
+ *
+ *      %w[foo bar baz] # => ["foo", "bar", "baz"]
+ *      %w[1 % *]       # => ["1", "%", "*"]
+ *
+ *  - A {%i or %I symbol-array Literal}[rdoc-ref:syntax/literals.rdoc@i+and-I-Symbol-Array+Literals]:
+ *
+ *      %i[foo bar baz] # => [:foo, :bar, :baz]
+ *      %i[1 % *]       # => [:"1", :%, :*]
+ *
+ *  - Method Kernel#Array:
+ *
+ *      Array(["a", "b"])             # => ["a", "b"]
+ *      Array(1..5)                   # => [1, 2, 3, 4, 5]
+ *      Array(key: :value)            # => [[:key, :value]]
+ *      Array(nil)                    # => []
+ *      Array(1)                      # => [1]
+ *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
+ *
+ *  - Method Array.new:
+ *
+ *      Array.new               # => []
+ *      Array.new(3)            # => [nil, nil, nil]
+ *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ *      Array.new(3, true)      # => [true, true, true]
+ *
+ *    Note that the last example above populates the array
+ *    with references to the same object.
+ *    This is recommended only in cases where that object is a natively immutable object
+ *    such as a symbol, a numeric, +nil+, +true+, or +false+.
+ *
+ *    Another way to create an array with various objects, using a block;
+ *    this usage is safe for mutable objects such as hashes, strings or
+ *    other arrays:
+ *
+ *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
+ *
+ *    Here is a way to create a multi-dimensional array:
+ *
+ *      Array.new(3) {Array.new(3)}
+ *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  A number of Ruby methods, both in the core and in the standard library,
+ *  provide instance method +to_a+, which converts an object to an array.
+ *
+ *  - ARGF#to_a
+ *  - Array#to_a
+ *  - Enumerable#to_a
+ *  - Hash#to_a
+ *  - MatchData#to_a
+ *  - NilClass#to_a
+ *  - OptionParser#to_a
+ *  - Range#to_a
+ *  - Set#to_a
+ *  - Struct#to_a
+ *  - Time#to_a
+ *  - Benchmark::Tms#to_a
+ *  - CSV::Table#to_a
+ *  - Enumerator::Lazy#to_a
+ *  - Gem::List#to_a
+ *  - Gem::NameTuple#to_a
+ *  - Gem::Platform#to_a
+ *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ *  - Gem::SourceList#to_a
+ *  - OpenSSL::X509::Extension#to_a
+ *  - OpenSSL::X509::Name#to_a
+ *  - Racc::ISet#to_a
+ *  - Rinda::RingFinger#to_a
+ *  - Ripper::Lexer::Elem#to_a
+ *  - RubyVM::InstructionSequence#to_a
+ *  - YAML::DBM#to_a
+ *
+ *  == Example Usage
+ *
+ *  In addition to the methods it mixes in through the Enumerable module,
+ *  class \Array has proprietary methods for accessing, searching and otherwise
+ *  manipulating arrays.
+ *
+ *  Some of the more common ones are illustrated below.
+ *
+ *  == Accessing Elements
+ *
+ *  Elements in an array can be retrieved using the Array#[] method.  It can
+ *  take a single integer argument (a numeric index), a pair of arguments
+ *  (start and length) or a range. Negative indices start counting from the end,
+ *  with -1 being the last element.
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr[2]    #=> 3
+ *     arr[100]  #=> nil
+ *     arr[-3]   #=> 4
+ *     arr[2, 3] #=> [3, 4, 5]
+ *     arr[1..4] #=> [2, 3, 4, 5]
+ *     arr[1..-3] #=> [2, 3, 4]
+ *
+ *  Another way to access a particular array element is by using the #at method
+ *
+ *     arr.at(0) #=> 1
+ *
+ *  The #slice method works in an identical manner to Array#[].
+ *
+ *  To raise an error for indices outside of the array bounds or else to
+ *  provide a default value when that happens, you can use #fetch.
+ *
+ *     arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ *     arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ *     arr.fetch(100, "oops") #=> "oops"
+ *
+ *  The special methods #first and #last will return the first and last
+ *  elements of an array, respectively.
+ *
+ *     arr.first #=> 1
+ *     arr.last  #=> 6
+ *
+ *  To return the first +n+ elements of an array, use #take
+ *
+ *     arr.take(3) #=> [1, 2, 3]
+ *
+ *  #drop does the opposite of #take, by returning the elements after +n+
+ *  elements have been dropped:
+ *
+ *     arr.drop(3) #=> [4, 5, 6]
+ *
+ *  == Obtaining Information about an \Array
+ *
+ *  An array keeps track of its own length at all times.  To query an array
+ *  about the number of elements it contains, use #length, #count or #size.
+ *
+ *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ *    browsers.length #=> 5
+ *    browsers.count #=> 5
+ *
+ *  To check whether an array contains any elements at all
+ *
+ *    browsers.empty? #=> false
+ *
+ *  To check whether a particular item is included in the array
+ *
+ *    browsers.include?('Konqueror') #=> false
+ *
+ *  == Adding Items to an \Array
+ *
+ *  Items can be added to the end of an array by using either #push or #<<
+ *
+ *    arr = [1, 2, 3, 4]
+ *    arr.push(5) #=> [1, 2, 3, 4, 5]
+ *    arr << 6    #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  #unshift will add a new item to the beginning of an array.
+ *
+ *     arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ *  With #insert you can add a new element to an array at any position.
+ *
+ *     arr.insert(3, 'apple')  #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ *  Using the #insert method, you can also insert multiple values at once:
+ *
+ *     arr.insert(3, 'orange', 'pear', 'grapefruit')
+ *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ *  == Removing Items from an \Array
+ *
+ *  The method #pop removes the last element in an array and returns it:
+ *
+ *     arr =  [1, 2, 3, 4, 5, 6]
+ *     arr.pop #=> 6
+ *     arr #=> [1, 2, 3, 4, 5]
+ *
+ *  To retrieve and at the same time remove the first item, use #shift:
+ *
+ *     arr.shift #=> 1
+ *     arr #=> [2, 3, 4, 5]
+ *
+ *  To delete an element at a particular index:
+ *
+ *     arr.delete_at(2) #=> 4
+ *     arr #=> [2, 3, 5]
+ *
+ *  To delete a particular element anywhere in an array, use #delete:
+ *
+ *     arr = [1, 2, 2, 3]
+ *     arr.delete(2) #=> 2
+ *     arr #=> [1,3]
+ *
+ *  A useful method if you need to remove +nil+ values from an array is
+ *  #compact:
+ *
+ *     arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact  #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ *  Another common need is to remove duplicate elements from an array.
+ *
+ *  It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ *  == Iterating over an \Array
+ *
+ *  Like all classes that include the Enumerable module, class \Array has an each
+ *  method, which defines what elements should be iterated over and how.  In
+ *  case of Array#each, all elements in +self+ are yielded to
+ *  the supplied block in sequence.
+ *
+ *  Note that this operation leaves the array unchanged.
+ *
+ *     arr = [1, 2, 3, 4, 5]
+ *     arr.each {|a| print a -= 10, " "}
+ *     # prints: -9 -8 -7 -6 -5
+ *     #=> [1, 2, 3, 4, 5]
+ *
+ *  Another sometimes useful iterator is #reverse_each which will iterate over
+ *  the elements in the array in reverse order.
+ *
+ *     words = %w[first second third fourth fifth sixth]
+ *     str = ""
+ *     words.reverse_each {|word| str += "#{word} "}
+ *     p str #=> "sixth fifth fourth third second first "
+ *
+ *  The #map method can be used to create a new array based on the original
+ *  array, but with the values modified by the supplied block:
+ *
+ *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
+ *     arr                   #=> [1, 2, 3, 4, 5]
+ *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
+ *     arr                   #=> [1, 4, 9, 16, 25]
+ *
+ *
+ *  == Selecting Items from an \Array
+ *
+ *  Elements can be selected from an array according to criteria defined in a
+ *  block.  The selection can happen in a destructive or a non-destructive
+ *  manner.  While the destructive operations will modify the array they were
+ *  called on, the non-destructive methods usually return a new array with the
+ *  selected elements, but leave the original array unchanged.
+ *
+ *  === Non-destructive Selection
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.select {|a| a > 3}       #=> [4, 5, 6]
+ *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
+ *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
+ *     arr                          #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  === Destructive Selection
+ *
+ *  #select! and #reject! are the corresponding destructive methods to #select
+ *  and #reject
+ *
+ *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ *  opposite result when supplied with the same block:
+ *
+ *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
+ *     arr                         #=> [4, 5, 6]
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
+ *     arr                       #=> [1, 2, 3]
+ *
+ *  == What's Here
+ *
+ *  First, what's elsewhere. Class \Array:
+ *
+ *  - Inherits from {class Object}[rdoc-ref:Object@Whats-Here].
+ *  - Includes {module Enumerable}[rdoc-ref:Enumerable@Whats-Here],
+ *    which provides dozens of additional methods.
+ *
+ *  Here, class \Array provides methods that are useful for:
+ *
+ *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ *  - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ *  === Methods for Creating an \Array
+ *
+ *  - ::[]: Returns a new array populated with given objects.
+ *  - ::new: Returns a new array.
+ *  - ::try_convert: Returns a new array created from a given object.
+ *
+ *  See also {Creating Arrays}[rdoc-ref:Array@Creating+Arrays].
+ *
+ *  === Methods for Querying
+ *
+ *  - #all?: Returns whether all elements meet a given criterion.
+ *  - #any?: Returns whether any element meets a given criterion.
+ *  - #count: Returns the count of elements that meet a given criterion.
+ *  - #empty?: Returns whether there are no elements.
+ *  - #find_index (aliased as #index): Returns the index of the first element that meets a given criterion.
+ *  - #hash: Returns the integer hash code.
+ *  - #include?: Returns whether any element <tt>==</tt> a given object.
+ *  - #length (aliased as #size): Returns the count of elements.
+ *  - #none?: Returns whether no element <tt>==</tt> a given object.
+ *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ *  - #rindex: Returns the index of the last element that meets a given criterion.
+ *
+ *  === Methods for Comparing
+ *
+ *  - #<=>: Returns -1, 0, or 1, as +self+ is less than, equal to, or greater than a given object.
+ *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element in a given object.
+ *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding element in a given object.
 
-/* Arrays are ordered, integer-indexed collections of any object. 
- * Array indexing starts at 0, as in C or Java.  A negative index is 
- * assumed to be relative to the end of the array---that is, an index of -1 
- * indicates the last element of the array, -2 is the next to last 
- * element in the array, and so on. 
+ *  === Methods for Fetching
+ *
+ *  These methods do not modify +self+.
+ *
+ *  - #[] (aliased as #slice): Returns consecutive elements as determined by a given argument.
+ *  - #assoc: Returns the first element that is an array whose first element <tt>==</tt> a given object.
+ *  - #at: Returns the element at a given offset.
+ *  - #bsearch: Returns an element selected via a binary search as determined by a given block.
+ *  - #bsearch_index: Returns the index of an element selected via a binary search as determined by a given block.
+ *  - #compact: Returns an array containing all non-+nil+ elements.
+ *  - #dig: Returns the object in nested objects that is specified by a given index and additional arguments.
+ *  - #drop: Returns trailing elements as determined by a given index.
+ *  - #drop_while: Returns trailing elements as determined by a given block.
+ *  - #fetch: Returns the element at a given offset.
+ *  - #fetch_values: Returns elements at given offsets.
+ *  - #first: Returns one or more leading elements.
+ *  - #last: Returns one or more trailing elements.
+ *  - #max: Returns one or more maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #min: Returns one or more minimum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #minmax: Returns the minimum-valued and maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #rassoc: Returns the first element that is an array whose second element <tt>==</tt> a given object.
+ *  - #reject: Returns an array containing elements not rejected by a given block.
+ *  - #reverse: Returns all elements in reverse order.
+ *  - #rotate: Returns all elements with some rotated from one end to the other.
+ *  - #sample: Returns one or more random elements.
+ *  - #select (aliased as #filter): Returns an array containing elements selected by a given block.
+ *  - #shuffle: Returns elements in a random order.
+ *  - #sort: Returns all elements in an order determined by <tt>#<=></tt> or a given block.
+ *  - #take: Returns leading elements as determined by a given index.
+ *  - #take_while: Returns leading elements as determined by a given block.
+ *  - #uniq: Returns an array containing non-duplicate elements.
+ *  - #values_at: Returns the elements at given offsets.
+ *
+ *  === Methods for Assigning
+ *
+ *  These methods add, replace, or reorder elements in +self+.
+ *
+ *  - #<<: Appends an element.
+ *  - #[]=: Assigns specified elements with a given object.
+ *  - #concat: Appends all elements from given arrays.
+ *  - #fill: Replaces specified elements with specified objects.
+ *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ *  - #initialize_copy (aliased as #replace): Replaces the content of +self+ with the content of a given array.
+ *  - #insert: Inserts given objects at a given offset; does not replace elements.
+ *  - #push (aliased as #append): Appends elements.
+ *  - #reverse!: Replaces +self+ with its elements reversed.
+ *  - #rotate!: Replaces +self+ with its elements rotated.
+ *  - #shuffle!: Replaces +self+ with its elements in random order.
+ *  - #sort!: Replaces +self+ with its elements sorted, as determined by <tt>#<=></tt> or a given block.
+ *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *  - #unshift (aliased as #prepend): Prepends leading elements.
+ *
+ *  === Methods for Deleting
+ *
+ *  Each of these methods removes elements from +self+:
+ *
+ *  - #clear: Removes all elements.
+ *  - #compact!: Removes all +nil+ elements.
+ *  - #delete: Removes elements equal to a given object.
+ *  - #delete_at: Removes the element at a given offset.
+ *  - #delete_if: Removes elements specified by a given block.
+ *  - #keep_if: Removes elements not specified by a given block.
+ *  - #pop: Removes and returns the last element.
+ *  - #reject!: Removes elements specified by a given block.
+ *  - #select! (aliased as #filter!): Removes elements not specified by a given block.
+ *  - #shift:  Removes and returns the first element.
+ *  - #slice!: Removes and returns a sequence of elements.
+ *  - #uniq!: Removes duplicates.
+ *
+ *  === Methods for Combining
+ *
+ *  - #&: Returns an array containing elements found both in +self+ and a given array.
+ *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ *  - #|: Returns an array containing all element of +self+ and all elements of a given array, duplicates removed.
+ *  - #difference: Returns an array containing all elements of +self+ that are not found in any of the given arrays..
+ *  - #intersection: Returns an array containing elements found both in +self+ and in each given array.
+ *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *  - #reverse: Returns an array containing all elements of +self+ in reverse order.
+ *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays, duplicates removed.
+ *
+ *  === Methods for Iterating
+ *
+ *  - #combination: Calls a given block with combinations of elements of +self+; a combination does not use the same element more than once.
+ *  - #cycle: Calls a given block with each element, then does so again, for a specified number of times, or forever.
+ *  - #each: Passes each element to a given block.
+ *  - #each_index: Passes each element index to a given block.
+ *  - #permutation: Calls a given block with permutations of elements of +self+; a permutation does not use the same element more than once.
+ *  - #repeated_combination: Calls a given block with combinations of elements of +self+; a combination may use the same element more than once.
+ *  - #repeated_permutation: Calls a given block with permutations of elements of +self+; a permutation may use the same element more than once.
+ *  - #reverse_each:  Passes each element, in reverse order, to a given block.
+ *
+ *  === Methods for Converting
+ *
+ *  - #collect (aliased as #map): Returns an array containing the block return-value for each element.
+ *  - #collect! (aliased as #map!): Replaces each element with a block return-value.
+ *  - #flatten: Returns an array that is a recursive flattening of +self+.
+ *  - #inspect (aliased as #to_s): Returns a new String containing the elements.
+ *  - #join: Returns a new String containing the elements joined by the field separator.
+ *  - #to_a: Returns +self+ or a new array containing all elements.
+ *  - #to_ary: Returns +self+.
+ *  - #to_h: Returns a new hash formed from the elements.
+ *  - #transpose: Transposes +self+, which must be an array of arrays.
+ *  - #zip: Returns a new array of arrays containing +self+ and given arrays.
+ *
+ *  === Other Methods
+ *
+ *  - #*: Returns one of the following:
+ *
+ *    - With integer argument +n+, a new array that is the concatenation
+ *      of +n+ copies of +self+.
+ *    - With string argument +field_separator+, a new string that is equivalent to
+ *      <tt>join(field_separator)</tt>.
+ *
+ *  - #pack: Packs the elements into a binary sequence.
+ *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
  */
 
 void
-Init_Array()
+Init_Array(void)
 {
+    fake_ary_flags = init_fake_ary_flags();
+
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
-    rb_define_alloc_func(rb_cArray, ary_alloc);
+    rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
     rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
 
-    rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
     rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+    rb_define_alias(rb_cArray,  "to_s", "inspect");
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
+    rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
-    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -3114,33 +8894,48 @@ Init_Array()
     rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
     rb_define_method(rb_cArray, "at", rb_ary_at, 1);
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
-    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
-    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
-    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+    rb_define_alias(rb_cArray,  "append", "push");
     rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
     rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+    rb_define_alias(rb_cArray,  "prepend", "unshift");
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_alias(rb_cArray,  "size", "length");
+    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
+    rb_define_method(rb_cArray, "find", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "detect", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "rfind", rb_ary_rfind, -1);
+    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
     rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
     rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
     rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
     rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
     rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
     rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
     rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -3168,16 +8963,42 @@ Init_Array()
     rb_define_method(rb_cArray, "&", rb_ary_and, 1);
     rb_define_method(rb_cArray, "|", rb_ary_or, 1);
 
+    rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+    rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
     rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
-    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
-    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
-    rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
-
-    id_cmp = rb_intern("<=>");
-    inspect_key = rb_intern("__inspect_key__");
-
-    rb_cValues  = rb_define_class("Values", rb_cArray);
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+    rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+    rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
+    rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
+
+    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
+
+    rb_cArray_empty_frozen = RB_OBJ_SET_SHAREABLE(rb_ary_freeze(rb_ary_new()));
+    rb_vm_register_global_object(rb_cArray_empty_frozen);
 }
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..7ee4e09a4c
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,307 @@
+class Array
+  # call-seq:
+  #   shuffle!(random: Random) -> self
+  #
+  # Shuffles all elements in +self+ into a random order,
+  # as selected by the object given by the keyword argument +random+.
+  # Returns +self+:
+  #
+  #   a =             [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle! # => [5, 3, 8, 7, 6, 1, 9, 4, 2, 0]
+  #   a.shuffle! # => [9, 4, 0, 6, 2, 8, 1, 5, 3, 7]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =             [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle! # => [1, 0, 0, 1, 1, 0, 1, 0, 0, 1]
+  #   a.shuffle! # => [0, 1, 0, 1, 1, 0, 1, 0, 1, 0]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+  def shuffle!(random: Random)
+    Primitive.rb_ary_shuffle_bang(random)
+  end
+
+  # call-seq:
+  #   shuffle(random: Random) -> new_array
+  #
+  # Returns a new array containing all elements from +self+ in a random order,
+  # as selected by the object given by the keyword argument +random+:
+  #
+  #   a =            [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle # => [0, 8, 1, 9, 6, 3, 4, 7, 2, 5]
+  #   a.shuffle # => [8, 9, 0, 5, 1, 2, 6, 4, 7, 3]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =            [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle # => [1, 0, 1, 1, 0, 0, 1, 0, 0, 1]
+  #   a.shuffle # => [1, 1, 0, 0, 0, 1, 1, 0, 0, 1]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def shuffle(random: Random)
+    Primitive.rb_ary_shuffle(random)
+  end
+
+  # call-seq:
+  #   sample(random: Random) -> object
+  #   sample(count, random: Random) -> new_ary
+  #
+  # Returns random elements from +self+,
+  # as selected by the object given by the keyword argument +random+.
+  #
+  # With no argument +count+ given, returns one random element from +self+:
+  #
+  #   a = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.sample # => 3
+  #   a.sample # => 8
+  #
+  # Returns +nil+ if +self+ is empty:
+  #
+  #   [].sample # => nil
+  #
+  # With a non-negative numeric argument +count+ given,
+  # returns a new array containing +count+ random elements from +self+:
+  #
+  #   a.sample(3) # => [8, 9, 2]
+  #   a.sample(6) # => [9, 6, 0, 3, 1, 4]
+  #
+  # The order of the result array is unrelated to the order of +self+.
+  #
+  # Returns a new empty array if +self+ is empty:
+  #
+  #   [].sample(4) # => []
+  #
+  # May return duplicates in +self+:
+  #
+  #   a = [1, 1, 1, 2, 2, 3]
+  #   a.sample(a.size) # => [1, 1, 3, 2, 1, 2]
+  #
+  # Returns no more than <tt>a.size</tt> elements
+  # (because no new duplicates are introduced):
+  #
+  #   a.sample(50) # => [6, 4, 1, 8, 5, 9, 0, 2, 3, 7]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator:
+  #
+  #   a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+  #   a.sample(random: Random.new(1))     # => 6
+  #   a.sample(4, random: Random.new(1))  # => [6, 10, 9, 2]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def sample(n = (ary = false), random: Random)
+    if Primitive.mandatory_only?
+      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+      Primitive.ary_sample0
+    else
+      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+      Primitive.ary_sample(random, n, ary)
+    end
+  end
+
+  # call-seq:
+  #   first -> object or nil
+  #   first(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; does not modify +self+.
+  #
+  # With no argument given, returns the first element (if available):
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.first # => :foo
+  #   a # => [:foo, "bar", 2]
+  #
+  # If +self+ is empty, returns +nil+.
+  #
+  #   [].first # => nil
+  #
+  # With a non-negative integer argument +count+ given,
+  # returns the first +count+ elements (as available) in a new array:
+  #
+  #   a.first(0)  # => []
+  #   a.first(2)  # => [:foo, "bar"]
+  #   a.first(50) # => [:foo, "bar", 2]
+  #
+  # Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+  def first n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_first(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_first(self) }
+      else
+        Primitive.cexpr! %q{  ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_FIRST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #  last  -> last_object or nil
+  #  last(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; +self+ is not modified.
+  #
+  # With no argument given, returns the last element, or +nil+ if +self+ is empty:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last # => 2
+  #   a # => [:foo, "bar", 2]
+  #   [].last # => nil
+  #
+  #
+  # With non-negative integer argument +count+ given,
+  # returns a new array containing the trailing +count+ elements of +self+, as available:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last(2)  # => ["bar", 2]
+  #   a.last(50) # => [:foo, "bar", 2]
+  #   a.last(0)  # => []
+  #   [].last(3) # => []
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def last n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_last(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_last(self) }
+      else
+        Primitive.cexpr! %q{ ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_LAST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #   fetch_values(*indexes) -> new_array
+  #   fetch_values(*indexes) { |index| ... } -> new_array
+  #
+  # With no block given, returns a new array containing the elements of +self+
+  # at the offsets specified by +indexes+. Each of the +indexes+ must be an
+  # {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]:
+  #
+  #    a = [:foo, :bar, :baz]
+  #    a.fetch_values(2, 0)   # => [:baz, :foo]
+  #    a.fetch_values(2.1, 0) # => [:baz, :foo]
+  #    a.fetch_values         # => []
+  #
+  # For a negative index, counts backwards from the end of the array:
+  #
+  #    a.fetch_values(-2, -1) # [:bar, :baz]
+  #
+  # When no block is given, raises an exception if any index is out of range.
+  #
+  # With a block given, for each index:
+  #
+  # - If the index is in range, uses an element of +self+ (as above).
+  # - Otherwise, calls the block with the index and uses the block's return value.
+  #
+  # Example:
+  #
+  #   a = [:foo, :bar, :baz]
+  #   a.fetch_values(1, 0, 42, 777) { |index| index.to_s }
+  #   # => [:bar, :foo, "42", "777"]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def fetch_values(*indexes, &block)
+    indexes.map! { |i| fetch(i, &block) }
+    indexes
+  end
+
+  with_jit do
+    if Primitive.rb_builtin_basic_definition_p(:each)
+      undef :each
+
+      def each # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+        i = 0
+        until Primitive.rb_jit_ary_at_end(i)
+          yield Primitive.rb_jit_ary_at(i)
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        self
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:map)
+      undef :map
+
+      def map # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        i = 0
+        result = Primitive.ary_sized_alloc
+        until Primitive.rb_jit_ary_at_end(i)
+          value = yield(Primitive.rb_jit_ary_at(i))
+          Primitive.rb_jit_ary_push(result, value)
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:collect)
+        undef :collect
+        alias collect map
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:select)
+      undef :select
+
+      def select # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        i = 0
+        result = Primitive.ary_sized_alloc
+        until Primitive.rb_jit_ary_at_end(i)
+          value = Primitive.rb_jit_ary_at(i)
+          if yield value
+            Primitive.rb_jit_ary_push(result, value)
+          end
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:filter)
+        undef :filter
+        alias filter select
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:find)
+      undef :find
+
+      def find(if_none_proc = nil) # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+        i = 0
+        until Primitive.rb_jit_ary_at_end(i)
+          value = Primitive.rb_jit_ary_at(i)
+          return value if yield(value)
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        if_none_proc&.call
+      end
+    end
+  end
+end
diff --git a/ascii.c b/ascii.c
deleted file mode 100644
index 6ca8a7ad6d..0000000000
--- a/ascii.c
+++ /dev/null
@@ -1,67 +0,0 @@
-/**********************************************************************
-  ascii.c -  Oniguruma (regular expression library)
-**********************************************************************/
-/*-
- * Copyright (c) 2002-2004  K.Kosako  <kosako AT sofnec DOT co DOT jp>
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- *
- * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- */
-
-#include "regenc.h"
-
-static int
-ascii_is_code_ctype(OnigCodePoint code, unsigned int ctype)
-{
-  if (code < 128)
-    return ONIGENC_IS_ASCII_CODE_CTYPE(code, ctype);
-  else
-    return FALSE;
-}
-
-OnigEncodingType OnigEncodingASCII = {
-  onigenc_single_byte_mbc_enc_len,
-  "US-ASCII",  /* name */
-  1,           /* max byte length */
-  1,           /* min byte length */
-  ONIGENC_AMBIGUOUS_MATCH_ASCII_CASE,
-  {
-      (OnigCodePoint )'\\'                       /* esc */
-    , (OnigCodePoint )ONIG_INEFFECTIVE_META_CHAR /* anychar '.'  */
-    , (OnigCodePoint )ONIG_INEFFECTIVE_META_CHAR /* anytime '*'  */
-    , (OnigCodePoint )ONIG_INEFFECTIVE_META_CHAR /* zero or one time '?' */
-    , (OnigCodePoint )ONIG_INEFFECTIVE_META_CHAR /* one or more time '+' */
-    , (OnigCodePoint )ONIG_INEFFECTIVE_META_CHAR /* anychar anytime */
-  },
-  onigenc_is_mbc_newline_0x0a,
-  onigenc_single_byte_mbc_to_code,
-  onigenc_single_byte_code_to_mbclen,
-  onigenc_single_byte_code_to_mbc,
-  onigenc_ascii_mbc_to_normalize,
-  onigenc_ascii_is_mbc_ambiguous,
-  onigenc_ascii_get_all_pair_ambig_codes,
-  onigenc_nothing_get_all_comp_ambig_codes,
-  ascii_is_code_ctype,
-  onigenc_not_support_get_ctype_code_range,
-  onigenc_single_byte_left_adjust_char_head,
-  onigenc_always_true_is_allowed_reverse_match
-};
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..1ddc2b5791
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,1178 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/ruby_parser.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+static VALUE rb_cLocation;
+
+struct ASTNodeData {
+    VALUE ast_value;
+    const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    rb_gc_mark(data->ast_value);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    size_t size = sizeof(struct ASTNodeData);
+    if (data->ast_value) {
+        rb_ast_t *ast = rb_ruby_ast_data_get(data->ast_value);
+        size += rb_ast_memsize(ast);
+    }
+
+    return size;
+}
+
+static const rb_data_type_t rb_node_type = {
+    "AST/node",
+    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+struct ASTLocationData {
+    int first_lineno;
+    int first_column;
+    int last_lineno;
+    int last_column;
+};
+
+static void
+location_gc_mark(void *ptr)
+{
+}
+
+static size_t
+location_memsize(const void *ptr)
+{
+    return sizeof(struct ASTLocationData);
+}
+
+static const rb_data_type_t rb_location_type = {
+    "AST/location",
+    {location_gc_mark, RUBY_TYPED_DEFAULT_FREE, location_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, VALUE ast_value, const NODE *node)
+{
+    struct ASTNodeData *data;
+
+    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+    data->ast_value = ast_value;
+    data->node = node;
+}
+
+static VALUE
+ast_new_internal(VALUE ast_value, const NODE *node)
+{
+    VALUE obj;
+
+    obj = rb_ast_node_alloc(rb_cNode);
+    setup_node(obj, ast_value, node);
+
+    return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+    return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(VALUE ast_value)
+{
+    rb_ast_t *ast = rb_ruby_ast_data_get(ast_value);
+
+    if (!ast->body.root) {
+        rb_ast_dispose(ast);
+        rb_exc_raise(GET_EC()->errinfo);
+    }
+
+    return ast_new_internal(ast_value, (NODE *)ast->body.root);
+}
+
+static VALUE
+setup_vparser(VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
+    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+    return vparser;
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+    StringValue(str);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE f;
+    VALUE ast_value = Qnil;
+    rb_encoding *enc = rb_utf8_encoding();
+
+    f = rb_file_open_str(path, "r");
+    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+    rb_io_close(f);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+
+    array = rb_check_array_type(array);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_array(vparser, Qnil, array, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE node_children(VALUE, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+    VALUE ary;
+    long i;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    if (nd_node_id(data->node) == node_id) return self;
+
+    ary = node_children(data->ast_value, data->node);
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE child = RARRAY_AREF(ary, i);
+
+        if (CLASS_OF(child) == rb_cNode) {
+            VALUE result = node_find(child, node_id);
+            if (RTEST(result)) return result;
+        }
+    }
+
+    return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+    int node_id;
+
+    if (!rb_frame_info_p(location)) {
+        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+    }
+
+    node_id = rb_get_node_id_from_frame_info(location);
+    if (node_id == -1) {
+        return Qnil;
+    }
+
+    return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE node, lines = Qnil;
+    const rb_iseq_t *iseq;
+    int node_id;
+
+    if (rb_frame_info_p(body)) {
+        iseq = rb_get_iseq_from_frame_info(body);
+        node_id = rb_get_node_id_from_frame_info(body);
+    }
+    else {
+        iseq = NULL;
+
+        if (rb_obj_is_proc(body)) {
+            iseq = vm_proc_iseq(body);
+
+            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+        }
+        else {
+            iseq = rb_method_iseq(body);
+        }
+        if (iseq) {
+            node_id = ISEQ_BODY(iseq)->location.node_id;
+        }
+    }
+
+    if (!iseq) {
+        return Qnil;
+    }
+
+    if (ISEQ_BODY(iseq)->prism) {
+        rb_raise(rb_eRuntimeError, "cannot get AST for ISEQ compiled by prism");
+    }
+
+    lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+    VALUE path = rb_iseq_path(iseq);
+    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+    }
+
+    if (!NIL_P(lines)) {
+        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else if (e_option) {
+        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else {
+        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+    }
+
+    return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+    struct ASTNodeData *data;
+    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+    return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast_value, node) (node ? ast_new_internal(ast_value, node) : Qnil)
+
+static VALUE
+rb_ary_new_from_node_args(VALUE ast_value, long n, ...)
+{
+    va_list ar;
+    VALUE ary;
+    long i;
+
+    ary = rb_ary_new2(n);
+
+    va_start(ar, n);
+    for (i=0; i<n; i++) {
+        NODE *node;
+        node = va_arg(ar, NODE *);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node));
+    }
+    va_end(ar);
+    return ary;
+}
+
+static VALUE
+dump_block(VALUE ast_value, const struct RNode_BLOCK *node)
+{
+    VALUE ary = rb_ary_new();
+    do {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    } while (node->nd_next &&
+        nd_type_p(node->nd_next, NODE_BLOCK) &&
+        (node = RNODE_BLOCK(node->nd_next), 1));
+    if (node->nd_next) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+    }
+
+    return ary;
+}
+
+static VALUE
+dump_array(VALUE ast_value, const struct RNode_LIST *node)
+{
+    VALUE ary = rb_ary_new();
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+
+    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+        node = RNODE_LIST(node->nd_next);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    }
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+
+    return ary;
+}
+
+static VALUE
+dump_parser_array(VALUE ast_value, rb_parser_ary_t *p_ary)
+{
+    VALUE ary;
+
+    if (p_ary->data_type != PARSER_ARY_DATA_NODE) {
+        rb_bug("unexpected rb_parser_ary_data_type: %d", p_ary->data_type);
+    }
+
+    ary = rb_ary_new();
+
+    for (long i = 0; i < p_ary->len; i++) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, p_ary->data[i]));
+    }
+
+    return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+    if (!id) return Qnil;
+    if (!rb_id2str(id)) return Qnil;
+    return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+    ID rest;
+    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+    return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(VALUE ast_value, const NODE *rest_arg)
+{
+    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast_value, rest_arg) : no_name_rest();
+}
+
+static ID
+node_colon_name(const NODE *node)
+{
+    switch (nd_type(node)) {
+      case NODE_COLON2:
+        return RNODE_COLON2(node)->nd_mid;
+      case NODE_COLON3:
+        return RNODE_COLON3(node)->nd_mid;
+      default:
+        rb_bug("unexpected node: %s", ruby_node_name(nd_type(node)));
+    }
+}
+
+static VALUE
+node_children(VALUE ast_value, const NODE *node)
+{
+    char name[sizeof("$") + DECIMAL_SIZE_OF(long)];
+
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_BLOCK:
+        return dump_block(ast_value, RNODE_BLOCK(node));
+      case NODE_IF:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IF(node)->nd_cond, RNODE_IF(node)->nd_body, RNODE_IF(node)->nd_else);
+      case NODE_UNLESS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_UNLESS(node)->nd_cond, RNODE_UNLESS(node)->nd_body, RNODE_UNLESS(node)->nd_else);
+      case NODE_CASE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE(node)->nd_head, RNODE_CASE(node)->nd_body);
+      case NODE_CASE2:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE2(node)->nd_head, RNODE_CASE2(node)->nd_body);
+      case NODE_CASE3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE3(node)->nd_head, RNODE_CASE3(node)->nd_body);
+      case NODE_WHEN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_WHEN(node)->nd_head, RNODE_WHEN(node)->nd_body, RNODE_WHEN(node)->nd_next);
+      case NODE_IN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IN(node)->nd_head, RNODE_IN(node)->nd_body, RNODE_IN(node)->nd_next);
+      case NODE_WHILE:
+      case NODE_UNTIL:
+        return rb_ary_push(rb_ary_new_from_node_args(ast_value, 2, RNODE_WHILE(node)->nd_cond, RNODE_WHILE(node)->nd_body),
+                           RBOOL(RNODE_WHILE(node)->nd_state));
+      case NODE_ITER:
+      case NODE_FOR:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ITER(node)->nd_iter, RNODE_ITER(node)->nd_body);
+      case NODE_FOR_MASGN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_FOR_MASGN(node)->nd_var);
+      case NODE_BREAK:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BREAK(node)->nd_stts);
+      case NODE_NEXT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_NEXT(node)->nd_stts);
+      case NODE_RETURN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_RETURN(node)->nd_stts);
+      case NODE_REDO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_RETRY:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_BEGIN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BEGIN(node)->nd_body);
+      case NODE_RESCUE:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_RESCUE(node)->nd_head, RNODE_RESCUE(node)->nd_resq, RNODE_RESCUE(node)->nd_else);
+      case NODE_RESBODY:
+        return rb_ary_new_from_node_args(ast_value, 4, RNODE_RESBODY(node)->nd_args, RNODE_RESBODY(node)->nd_exc_var, RNODE_RESBODY(node)->nd_body, RNODE_RESBODY(node)->nd_next);
+      case NODE_ENSURE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ENSURE(node)->nd_head, RNODE_ENSURE(node)->nd_ensr);
+      case NODE_AND:
+      case NODE_OR:
+        {
+            VALUE ary = rb_ary_new();
+
+            while (1) {
+                rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_1st));
+                if (!RNODE_AND(node)->nd_2nd || !nd_type_p(RNODE_AND(node)->nd_2nd, type))
+                    break;
+                node = RNODE_AND(node)->nd_2nd;
+            }
+            rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_2nd));
+            return ary;
+        }
+      case NODE_MASGN:
+        if (NODE_NAMED_REST_P(RNODE_MASGN(node)->nd_args)) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MASGN(node)->nd_value, RNODE_MASGN(node)->nd_head, RNODE_MASGN(node)->nd_args);
+        }
+        else {
+            return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_value),
+                                        NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_head),
+                                        no_name_rest());
+        }
+      case NODE_LASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_LASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_LASGN(node)->nd_value));
+      case NODE_DASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_DASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_DASGN(node)->nd_value));
+      case NODE_IASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_IASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_IASGN(node)->nd_value));
+      case NODE_CVASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_CVASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CVASGN(node)->nd_value));
+      case NODE_GASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_GASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_GASGN(node)->nd_value));
+      case NODE_CDECL:
+        if (RNODE_CDECL(node)->nd_vid) {
+            return rb_ary_new_from_args(2, ID2SYM(RNODE_CDECL(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+        }
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_else), ID2SYM(node_colon_name(RNODE_CDECL(node)->nd_else)), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(4, NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_recv),
+                                    ID2SYM(RNODE_OP_ASGN1(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_index),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_rvalue));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(5, NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_recv),
+                                    RBOOL(RNODE_OP_ASGN2(node)->nd_aid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_vid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_value));
+      case NODE_OP_ASGN_AND:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_head), ID2SYM(idANDOP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_value));
+      case NODE_OP_ASGN_OR:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_head), ID2SYM(idOROP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_value));
+      case NODE_OP_CDECL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_head),
+                                    ID2SYM(RNODE_OP_CDECL(node)->nd_aid),
+                                    NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_value));
+      case NODE_CALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CALL(node)->nd_recv),
+                                    ID2SYM(RNODE_CALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_CALL(node)->nd_args));
+      case NODE_OPCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_OPCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_args));
+      case NODE_QCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_QCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_args));
+      case NODE_FCALL:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_FCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_FCALL(node)->nd_args));
+      case NODE_VCALL:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_VCALL(node)->nd_mid));
+      case NODE_SUPER:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SUPER(node)->nd_args);
+      case NODE_ZSUPER:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_LIST:
+        return dump_array(ast_value, RNODE_LIST(node));
+      case NODE_ZLIST:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_HASH:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_HASH(node)->nd_head);
+      case NODE_YIELD:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_YIELD(node)->nd_head);
+      case NODE_LVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_LVAR(node)->nd_vid));
+      case NODE_DVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_DVAR(node)->nd_vid));
+      case NODE_IVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_IVAR(node)->nd_vid));
+      case NODE_CONST:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CONST(node)->nd_vid));
+      case NODE_CVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CVAR(node)->nd_vid));
+      case NODE_GVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_GVAR(node)->nd_vid));
+      case NODE_NTH_REF:
+        snprintf(name, sizeof(name), "$%ld", RNODE_NTH_REF(node)->nd_nth);
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_BACK_REF:
+        name[0] = '$';
+        name[1] = (char)RNODE_BACK_REF(node)->nd_nth;
+        name[2] = '\0';
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_MATCH:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_MATCH2:
+        if (RNODE_MATCH2(node)->nd_args) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value, RNODE_MATCH2(node)->nd_args);
+        }
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value);
+      case NODE_MATCH3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH3(node)->nd_recv, RNODE_MATCH3(node)->nd_value);
+      case NODE_STR:
+      case NODE_XSTR:
+        return rb_ary_new_from_args(1, rb_node_str_string_val(node));
+      case NODE_INTEGER:
+        return rb_ary_new_from_args(1, rb_node_integer_literal_val(node));
+      case NODE_FLOAT:
+        return rb_ary_new_from_args(1, rb_node_float_literal_val(node));
+      case NODE_RATIONAL:
+        return rb_ary_new_from_args(1, rb_node_rational_literal_val(node));
+      case NODE_IMAGINARY:
+        return rb_ary_new_from_args(1, rb_node_imaginary_literal_val(node));
+      case NODE_REGX:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_ONCE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_ONCE(node)->nd_body);
+      case NODE_DSTR:
+      case NODE_DXSTR:
+      case NODE_DREGX:
+      case NODE_DSYM:
+        {
+            struct RNode_LIST *n = RNODE_DSTR(node)->nd_next;
+            VALUE head = Qnil, next = Qnil;
+            if (n) {
+                head = NEW_CHILD(ast_value, n->nd_head);
+                next = NEW_CHILD(ast_value, n->nd_next);
+            }
+            return rb_ary_new_from_args(3, rb_node_dstr_string_val(node), head, next);
+        }
+      case NODE_SYM:
+        return rb_ary_new_from_args(1, rb_node_sym_string_val(node));
+      case NODE_EVSTR:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_EVSTR(node)->nd_body);
+      case NODE_ARGSCAT:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSCAT(node)->nd_head, RNODE_ARGSCAT(node)->nd_body);
+      case NODE_ARGSPUSH:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSPUSH(node)->nd_head, RNODE_ARGSPUSH(node)->nd_body);
+      case NODE_SPLAT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SPLAT(node)->nd_head);
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_BLOCK_PASS(node)->nd_head, RNODE_BLOCK_PASS(node)->nd_body);
+      case NODE_DEFN:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_DEFN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFN(node)->nd_defn));
+      case NODE_DEFS:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_recv), ID2SYM(RNODE_DEFS(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_defn));
+      case NODE_ALIAS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ALIAS(node)->nd_1st, RNODE_ALIAS(node)->nd_2nd);
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_VALIAS(node)->nd_alias), ID2SYM(RNODE_VALIAS(node)->nd_orig));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(1, dump_parser_array(ast_value, RNODE_UNDEF(node)->nd_undefs));
+      case NODE_CLASS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_CLASS(node)->nd_cpath, RNODE_CLASS(node)->nd_super, RNODE_CLASS(node)->nd_body);
+      case NODE_MODULE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MODULE(node)->nd_cpath, RNODE_MODULE(node)->nd_body);
+      case NODE_SCLASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_SCLASS(node)->nd_recv, RNODE_SCLASS(node)->nd_body);
+      case NODE_COLON2:
+        return rb_ary_new_from_args(2, NEW_CHILD(ast_value, RNODE_COLON2(node)->nd_head), ID2SYM(RNODE_COLON2(node)->nd_mid));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_COLON3(node)->nd_mid));
+      case NODE_DOT2:
+      case NODE_DOT3:
+      case NODE_FLIP2:
+      case NODE_FLIP3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_DOT2(node)->nd_beg, RNODE_DOT2(node)->nd_end);
+      case NODE_SELF:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_NIL:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_TRUE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_FALSE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ERRINFO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_DEFINED:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_DEFINED(node)->nd_head);
+      case NODE_POSTEXE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_POSTEXE(node)->nd_body);
+      case NODE_ATTRASGN:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_recv), ID2SYM(RNODE_ATTRASGN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_args));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_LAMBDA(node)->nd_body);
+      case NODE_OPT_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_OPT_ARG(node)->nd_body, RNODE_OPT_ARG(node)->nd_next);
+      case NODE_KW_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_KW_ARG(node)->nd_body, RNODE_KW_ARG(node)->nd_next);
+      case NODE_POSTARG:
+        if (NODE_NAMED_REST_P(RNODE_POSTARG(node)->nd_1st)) {
+            return rb_ary_new_from_node_args(ast_value, 2, RNODE_POSTARG(node)->nd_1st, RNODE_POSTARG(node)->nd_2nd);
+        }
+        return rb_ary_new_from_args(2, no_name_rest(),
+                                    NEW_CHILD(ast_value, RNODE_POSTARG(node)->nd_2nd));
+      case NODE_ARGS:
+        {
+            struct rb_args_info *ainfo = &RNODE_ARGS(node)->nd_ainfo;
+            return rb_ary_new_from_args(10,
+                                        INT2NUM(ainfo->pre_args_num),
+                                        NEW_CHILD(ast_value, ainfo->pre_init),
+                                        NEW_CHILD(ast_value, (NODE *)ainfo->opt_args),
+                                        var_name(ainfo->first_post_arg),
+                                        INT2NUM(ainfo->post_args_num),
+                                        NEW_CHILD(ast_value, ainfo->post_init),
+                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+                                            : var_name(ainfo->rest_arg)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, (NODE *)ainfo->kw_args)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, ainfo->kw_rest_arg)),
+                                        (ainfo->no_blockarg ? Qfalse : var_name(ainfo->block_arg)));
+        }
+      case NODE_SCOPE:
+        {
+            rb_ast_id_table_t *tbl = RNODE_SCOPE(node)->nd_tbl;
+            int i, size = tbl ? tbl->size : 0;
+            VALUE locals = rb_ary_new_capa(size);
+            for (i = 0; i < size; i++) {
+                rb_ary_push(locals, var_name(tbl->ids[i]));
+            }
+            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast_value, (NODE *)RNODE_SCOPE(node)->nd_args), NEW_CHILD(ast_value, RNODE_SCOPE(node)->nd_body));
+        }
+      case NODE_ARYPTN:
+        {
+            VALUE rest = rest_arg(ast_value, RNODE_ARYPTN(node)->rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->pre_args),
+                                        rest,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->post_args));
+        }
+      case NODE_FNDPTN:
+        {
+            VALUE pre_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->pre_rest_arg);
+            VALUE post_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->post_rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->nd_pconst),
+                                        pre_rest,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->args),
+                                        post_rest);
+        }
+      case NODE_HSHPTN:
+        {
+            VALUE kwrest = RNODE_HSHPTN(node)->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+                                                                                 NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwrestarg);
+
+            return rb_ary_new_from_args(3,
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwargs),
+                                        kwrest);
+        }
+      case NODE_LINE:
+        return rb_ary_new_from_args(1, rb_node_line_lineno_val(node));
+      case NODE_FILE:
+        return rb_ary_new_from_args(1, rb_node_file_path_val(node));
+      case NODE_ENCODING:
+        return rb_ary_new_from_args(1, rb_node_encoding_val(node));
+      case NODE_ERROR:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+    }
+
+    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_children(data->ast_value, data->node);
+}
+
+static int
+null_loc_p(rb_code_location_t *loc)
+{
+    return (loc->beg_pos.lineno == 0 && loc->beg_pos.column == -1 && loc->end_pos.lineno == 0 && loc->end_pos.column == -1);
+}
+
+static VALUE
+location_new(rb_code_location_t *loc)
+{
+    VALUE obj;
+    struct ASTLocationData *data;
+
+    if (null_loc_p(loc)) return Qnil;
+
+    obj = TypedData_Make_Struct(rb_cLocation, struct ASTLocationData, &rb_location_type, data);
+    data->first_lineno = loc->beg_pos.lineno;
+    data->first_column = loc->beg_pos.column;
+    data->last_lineno = loc->end_pos.lineno;
+    data->last_column = loc->end_pos.column;
+
+    return obj;
+}
+
+static VALUE
+node_locations(VALUE ast_value, const NODE *node)
+{
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_ALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_ALIAS(node)->keyword_loc));
+      case NODE_AND:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_AND(node)->operator_loc));
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BLOCK_PASS(node)->operator_loc));
+      case NODE_BREAK:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BREAK(node)->keyword_loc));
+      case NODE_CASE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE(node)->end_keyword_loc));
+      case NODE_CASE2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE2(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE2(node)->end_keyword_loc));
+      case NODE_CASE3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE3(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE3(node)->end_keyword_loc));
+      case NODE_CLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_CLASS(node)->inheritance_operator_loc),
+                                    location_new(&RNODE_CLASS(node)->end_keyword_loc));
+      case NODE_COLON2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON2(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON2(node)->name_loc));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON3(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON3(node)->name_loc));
+      case NODE_DEFINED:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DEFINED(node)->keyword_loc));
+      case NODE_DOT2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT2(node)->operator_loc));
+      case NODE_DOT3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT3(node)->operator_loc));
+      case NODE_EVSTR:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_EVSTR(node)->opening_loc),
+                                    location_new(&RNODE_EVSTR(node)->closing_loc));
+      case NODE_FLIP2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP2(node)->operator_loc));
+      case NODE_FLIP3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP3(node)->operator_loc));
+      case NODE_FOR:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FOR(node)->for_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->in_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->do_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->end_keyword_loc));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_LAMBDA(node)->operator_loc),
+                                    location_new(&RNODE_LAMBDA(node)->opening_loc),
+                                    location_new(&RNODE_LAMBDA(node)->closing_loc));
+      case NODE_IF:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IF(node)->if_keyword_loc),
+                                    location_new(&RNODE_IF(node)->then_keyword_loc),
+                                    location_new(&RNODE_IF(node)->end_keyword_loc));
+      case NODE_IN:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IN(node)->in_keyword_loc),
+                                    location_new(&RNODE_IN(node)->then_keyword_loc),
+                                    location_new(&RNODE_IN(node)->operator_loc));
+      case NODE_MODULE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_MODULE(node)->module_keyword_loc),
+                                    location_new(&RNODE_MODULE(node)->end_keyword_loc));
+      case NODE_NEXT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_NEXT(node)->keyword_loc));
+      case NODE_OR:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OR(node)->operator_loc));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN1(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->opening_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->closing_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->binary_operator_loc));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN2(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->message_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->binary_operator_loc));
+      case NODE_POSTEXE:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_POSTEXE(node)->keyword_loc),
+                                    location_new(&RNODE_POSTEXE(node)->opening_loc),
+                                    location_new(&RNODE_POSTEXE(node)->closing_loc));
+      case NODE_REDO:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REDO(node)->keyword_loc));
+      case NODE_REGX:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REGX(node)->opening_loc),
+                                    location_new(&RNODE_REGX(node)->content_loc),
+                                    location_new(&RNODE_REGX(node)->closing_loc));
+      case NODE_RETURN:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_RETURN(node)->keyword_loc));
+
+      case NODE_SCLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SCLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_SCLASS(node)->operator_loc),
+                                    location_new(&RNODE_SCLASS(node)->end_keyword_loc));
+
+      case NODE_SPLAT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SPLAT(node)->operator_loc));
+      case NODE_SUPER:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SUPER(node)->keyword_loc),
+                                    location_new(&RNODE_SUPER(node)->lparen_loc),
+                                    location_new(&RNODE_SUPER(node)->rparen_loc));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNDEF(node)->keyword_loc));
+      case NODE_UNLESS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNLESS(node)->keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->then_keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->end_keyword_loc));
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_VALIAS(node)->keyword_loc));
+      case NODE_WHEN:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHEN(node)->keyword_loc),
+                                    location_new(&RNODE_WHEN(node)->then_keyword_loc));
+      case NODE_WHILE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHILE(node)->keyword_loc),
+                                    location_new(&RNODE_WHILE(node)->closing_loc));
+      case NODE_UNTIL:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNTIL(node)->keyword_loc),
+                                    location_new(&RNODE_UNTIL(node)->closing_loc));
+      case NODE_YIELD:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_YIELD(node)->keyword_loc),
+                                    location_new(&RNODE_YIELD(node)->lparen_loc),
+                                    location_new(&RNODE_YIELD(node)->rparen_loc));
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+      default:
+        return rb_ary_new_from_args(1, location_new(nd_code_loc(node)));
+    }
+
+    rb_bug("node_locations: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_locations(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_locations(data->ast_value, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+    long i;
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    rb_parser_ary_t *parser_tokens;
+    rb_parser_ast_token_t *parser_token;
+    VALUE str, loc, token, all_tokens;
+
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+
+    parser_tokens = ast->node_buffer->tokens;
+    if (parser_tokens == NULL) {
+        return Qnil;
+    }
+
+    all_tokens = rb_ary_new2(parser_tokens->len);
+    for (i = 0; i < parser_tokens->len; i++) {
+        parser_token = parser_tokens->data[i];
+        str = rb_str_new(parser_token->str->ptr, parser_token->str->len);
+        loc = rb_ary_new_from_args(4,
+            INT2FIX(parser_token->loc.beg_pos.lineno),
+            INT2FIX(parser_token->loc.beg_pos.column),
+            INT2FIX(parser_token->loc.end_pos.lineno),
+            INT2FIX(parser_token->loc.end_pos.column)
+        );
+        token = rb_ary_new_from_args(4, INT2FIX(parser_token->id), ID2SYM(rb_intern(parser_token->type_name)), str, loc);
+        rb_ary_push(all_tokens, token);
+    }
+    rb_ary_freeze(all_tokens);
+
+    return all_tokens;
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+                node_type_to_str(data->node),
+                nd_first_lineno(data->node), nd_first_column(data->node),
+                nd_last_lineno(data->node), nd_last_column(data->node));
+
+    return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+    rb_parser_ary_t *ret = ast->body.script_lines;
+    return rb_parser_build_script_lines_from(ret);
+}
+
+static VALUE
+ast_location_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_lineno);
+}
+
+static VALUE
+ast_location_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_column);
+}
+
+static VALUE
+ast_location_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_lineno);
+}
+
+static VALUE
+ast_location_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_column);
+}
+
+static VALUE
+ast_location_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":@%d:%d-%d:%d>",
+                data->first_lineno, data->first_column,
+                data->last_lineno, data->last_column);
+
+    return str;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+    rb_cLocation = rb_define_class_under(rb_mAST, "Location", rb_cObject);
+    rb_undef_alloc_func(rb_cNode);
+    rb_undef_alloc_func(rb_cLocation);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..6380621780
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,332 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _prism_ gem, which is the official
+# Ruby API to parse Ruby code.
+#
+module RubyVM::AbstractSyntaxTree
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #  Parses the given _string_ into an abstract syntax tree,
+  #  returning the root node of that tree.
+  #
+  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+  #
+  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+  #  source is associated with nodes and is available via Node#script_lines.
+  #
+  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+  #
+  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+  #  will produce a tree where expressions with syntax errors would be represented by
+  #  Node with <tt>type=:ERROR</tt>.
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+  #     # x = 1; p(x; y=2
+  #     #           ^
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+  #     # (SCOPE@1:0-1:15
+  #     #  tbl: [:x, :y]
+  #     #  args: nil
+  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+  #     root.children.last.children
+  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+  #     #  (ERROR@1:7-1:11),
+  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+  #
+  #  Note that parsing continues even after the errored expression.
+  #
+  def self.parse string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Reads the file from _pathname_, then parses it like ::parse,
+  #   returning the root node of the abstract syntax tree.
+  #
+  #   SyntaxError is raised if _pathname_'s contents are not
+  #   valid Ruby syntax.
+  #
+  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.parse_file pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
+  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Returns AST nodes of the given _proc_ or _method_.
+  #
+  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+  #
+  #     def hello
+  #       puts "hello, world"
+  #     end
+  #
+  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.of body, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
+  #
+  #   Returns the node id for the given backtrace location.
+  #
+  #     begin
+  #       raise
+  #     rescue =>  e
+  #       loc = e.backtrace_locations.first
+  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+  #     end # => 0
+  def self.node_id_for_backtrace_location backtrace_location
+    Primitive.node_id_for_backtrace_location backtrace_location
+  end
+
+  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+  # RubyVM::AbstractSyntaxTree.
+  #
+  # This class is MRI specific.
+  #
+  class Node
+
+    #  call-seq:
+    #     node.type -> symbol
+    #
+    #  Returns the type of this node as a symbol.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+    #    root.type # => :SCOPE
+    #    lasgn = root.children[2]
+    #    lasgn.type # => :LASGN
+    #    call = lasgn.children[1]
+    #    call.type # => :OPCALL
+    def type
+      Primitive.ast_node_type
+    end
+
+    #  call-seq:
+    #     node.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_node_first_lineno
+    end
+
+    #  call-seq:
+    #     node.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_node_first_column
+    end
+
+    #  call-seq:
+    #     node.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_node_last_lineno
+    end
+
+    #  call-seq:
+    #     node.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_node_last_column
+    end
+
+    #  call-seq:
+    #     node.tokens -> array
+    #
+    #  Returns tokens corresponding to the location of the node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+    #
+    #  Token is an array of:
+    #
+    #  - id
+    #  - token type
+    #  - source code text
+    #  - location [ first_lineno, first_column, last_lineno, last_column ]
+    def tokens
+      return nil unless all_tokens
+
+      all_tokens.each_with_object([]) do |token, a|
+        loc = token.last
+        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
+           a << token
+        end
+      end
+    end
+
+    #  call-seq:
+    #     node.all_tokens -> array
+    #
+    #  Returns all tokens for the input script regardless the receiver node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    def all_tokens
+      Primitive.ast_node_all_tokens
+    end
+
+    #  call-seq:
+    #     node.children -> array
+    #
+    #  Returns AST nodes under this one.  Each kind of node
+    #  has different children, depending on what kind of node it is.
+    #
+    #  The returned array may contain other nodes or <code>nil</code>.
+    def children
+      Primitive.ast_node_children
+    end
+
+    #  call-seq:
+    #     node.inspect -> string
+    #
+    #  Returns debugging information about this node as a string.
+    def inspect
+      Primitive.ast_node_inspect
+    end
+
+    #  call-seq:
+    #     node.node_id -> integer
+    #
+    #  Returns an internal node_id number.
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def node_id
+      Primitive.ast_node_node_id
+    end
+
+    #  call-seq:
+    #     node.script_lines -> array
+    #
+    #  Returns the original source code as an array of lines.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def script_lines
+      Primitive.ast_node_script_lines
+    end
+
+    #  call-seq:
+    #     node.source -> string
+    #
+    #  Returns the code fragment that corresponds to this AST.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    #
+    #  Also note that this API may return an incomplete code fragment
+    #  that does not parse; for example, a here document following
+    #  an expression may be dropped.
+    def source
+      lines = script_lines
+      if lines
+        lines = lines[first_lineno - 1 .. last_lineno - 1]
+        lines[-1] = lines[-1].byteslice(0...last_column)
+        lines[0] = lines[0].byteslice(first_column..-1)
+        lines.join
+      else
+        nil
+      end
+    end
+
+    #  call-seq:
+    #     node.locations -> array
+    #
+    #  Returns location objects associated with the AST node.
+    #  The returned array contains RubyVM::AbstractSyntaxTree::Location.
+    def locations
+      Primitive.ast_node_locations
+    end
+  end
+
+  # RubyVM::AbstractSyntaxTree::Location instances are created by
+  # RubyVM::AbstractSyntaxTree::Node#locations.
+  #
+  # This class is MRI specific.
+  #
+  class Location
+
+    #  call-seq:
+    #     location.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_location_first_lineno
+    end
+
+    #  call-seq:
+    #     location.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_location_first_column
+    end
+
+    #  call-seq:
+    #     location.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_location_last_lineno
+    end
+
+    #  call-seq:
+    #     location.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_location_last_column
+    end
+
+    #  call-seq:
+    #     location.inspect -> string
+    #
+    #  Returns debugging information about this location as a string.
+    def inspect
+      Primitive.ast_location_inspect
+    end
+  end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..6cbc5dddab
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,22 @@
+#!/bin/sh
+
+# Clear PWD to force commands to recompute working directory
+PWD=
+
+# Figure out the source directory for this script
+# configure.ac should be in the same place
+case "$0" in
+    */* )  srcdir=`dirname "$0"` ;; # Called with path
+    *   )  srcdir="";; # Otherwise
+esac
+
+# If install-only is explicitly requested, disable symlink flags
+case " $* " in
+    *" -i "* | *" --install"* ) symlink_flags="" ;;
+    *                         ) symlink_flags="--install --symlink" ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} \
+     $symlink_flags \
+     "$@" \
+     $srcdir
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+  load './rbconfig.rb'
+  ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+  print "#{ruby} is not found.\n"
+  print "Try `make' first, then `make test', please.\n"
+  exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+  ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+  if line =~ /^end of test/
+    print "\ntest succeeded\n"
+    exit true
+  end
+  error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..711e4f4ab3
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2367 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+  def initialize
+    @color = nil
+    @tty = nil
+    @quiet = nil
+    @verbose = nil
+    ARGV.each do |arg|
+      case arg
+      when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+        warn "unknown --color argument: #$3" if $3
+        @color = $1 ? nil : !$2
+      when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+        warn "unknown --tty argument: #$3" if $3
+        @tty = !$1 || !$2
+        true
+      when /\A-(q|-quiet)\z/
+        @quiet = true
+      when /\A-(v|-verbose)\z/
+        @verbose = true
+      end
+    end
+    @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+    @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+    case @color
+    when nil
+      @color = @tty
+    end
+    if @color
+      # dircolors-like style
+      colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+      begin
+        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+          colors[n] ||= c
+        end
+      rescue
+      end
+      @passed = "\e[;#{colors["pass"] || "32"}m"
+      @failed = "\e[;#{colors["fail"] || "31"}m"
+      @reset = "\e[m"
+    else
+      @passed = @failed = @reset = ""
+    end
+    extend(Rotator) if @tty
+  end
+
+  def passed_string
+    "."
+  end
+  def failed_string
+    "#{@failed}F#{@reset}"
+  end
+  def init_string
+  end
+  def finish_string
+    if @quiet
+      @eol
+    else
+      "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+    end
+  end
+  def pass
+    STDERR.print passed_string
+  end
+  def fail
+    @ok = false
+    STDERR.print failed_string
+  end
+  def init
+    @ok = true
+    STDERR.print init_string
+  end
+  def finish
+    STDERR.print finish_string
+  end
+
+  module Rotator
+    ROTATOR = %w[- \\ | /]
+    BS = "\b" * ROTATOR[0].size
+    def passed_string
+      "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+    end
+    def failed_string
+      "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+    end
+    def init_string
+      @count = 0
+      " "
+    end
+    def finish_string
+      s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+      s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+      s
+    end
+  end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+  unless $ntest.zero?
+    PROGRESS.finish
+  end
+  STDERR.print "#{$0}:#{what} "
+  PROGRESS.init
+  $what = what
+  $testnum = 0
+end
+
+def test_ok(cond,n=1)
+  $testnum+=1
+  $ntest+=1
+  where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+  if cond
+    PROGRESS.pass
+    printf "ok %d (%s)\n", $testnum, where
+  else
+    PROGRESS.fail
+    printf "not ok %s %d -- %s\n", $what, $testnum, where
+    $failed+=1
+  end
+  STDOUT.flush
+  STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1      ) == [1,42,[  ]] )
+test_ok(f.call(1,43   ) == [1,43,[  ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8      )     == [8,24,[  ],nil] )
+test_ok(f.call(8,43   )     == [8,43,[  ],nil] )
+test_ok(f.call(8,43,44)     == [8,43,[44],nil] )
+test_ok(f.call(8      ){45} == [8,24,[  ],45 ] )
+test_ok(f.call(8,43   ){45} == [8,43,[  ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1      ,99) == [1,42,[  ],99] )
+test_ok(f.call(1,43   ,99) == [1,43,[  ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8   )     == [8,24,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8   ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1   ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call(     )     == [42,[  ],nil] )
+test_ok(f.call(43   )     == [43,[  ],nil] )
+test_ok(f.call(43,44)     == [43,[44],nil] )
+test_ok(f.call(     ){45} == [42,[  ],45 ] )
+test_ok(f.call(43   ){45} == [43,[  ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call(      99) == [42,[  ],99] )
+test_ok(f.call(43   ,99) == [43,[  ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call(  )     == [42,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(  ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call(   99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+  $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+  test_ok(false)
+when 5
+  test_ok(true)
+end
+
+case 5
+when 5
+  test_ok(true)
+when 1..10
+  test_ok(false)
+end
+
+case 5
+when 1..10
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case 5
+when 5
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+  break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  next if /vt100/ =~ line
+  $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  lastline = line
+  line = line.gsub(/vt100/, 'VT100')
+  if lastline != line
+    line.gsub!('VT100', 'Vt100')
+    redo
+  end
+  $bad = 1 if /vt100/ =~ line
+  $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+  sum += i
+  i -= 1
+  if i > 0
+    redo
+  end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  break if 3
+  case line
+  when /vt100/, /Amiga/, /paper/
+    $bad = true
+  end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+  i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+  raise "this must be handled"
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  raise "this must be handled no.2"
+rescue
+  if $bad
+    $bad = false
+    retry
+    test_ok(false)
+  end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+  begin
+    raise "exception in rescue clause"
+  rescue
+    raise $string
+  end
+  test_ok(false)
+rescue => e
+  test_ok($! == e)
+  test_ok(e.message == $string)
+  test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+  begin
+    raise "this must be handled no.4"
+  ensure
+    raise "exception in ensure clause"
+  end
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.5"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.6"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+  begin
+    break
+  ensure
+    $bad = false
+  end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+     loop do
+       loop do
+	 throw :foo, true
+	 break
+       end
+       break
+       test_ok(false)			# should not reach here
+     end
+     false
+   })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b}		# sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a}		# reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = +"The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c  d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+     for k,v in $x
+       raise if k*2 != v
+     end
+     true
+   rescue
+     false
+   end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+  $z = k
+  self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+  $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+  1.upto(10) {|i|
+    yield i
+  }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+  yield 1
+end
+
+def tt3(&block)
+  tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+  tt3{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+  tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+  tt4{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+  break
+  done = false			# should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  next
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  redo
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+  $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+  def iter_test1
+    collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+  end
+  def iter_test2
+    a = collect{|e| [e, yield(e)]}
+    a.sort{|a,b|a[1]<=>b[1]}
+  end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+  def initialize(e); @body = e; end
+
+  def each0(&block); @body.each(&block); end
+  def each1(&block); @body.each {|*x| block.call(*x) } end
+  def each2(&block); @body.each {|*x| block.call(x) } end
+  def each3(&block); @body.each {|x| block.call(*x) } end
+  def each4(&block); @body.each {|x| block.call(x) } end
+  def each5; @body.each {|*x| yield(*x) } end
+  def each6; @body.each {|*x| yield(x) } end
+  def each7; @body.each {|x| yield(*x) } end
+  def each8; @body.each {|x| yield(x) } end
+
+  def f(a)
+    a
+  end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+  v
+end
+
+def m1
+  m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+  m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+  include Enumerable
+  def initialize
+    @a = [1,2,3]
+  end
+  def each(&block)
+    @a.each(&block)
+  end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+  test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue ArgumentError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+  block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+  Proc.new {
+    return 55
+  }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+  lambda {
+    return 55
+  }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+  b.call
+end
+def proc_yield()
+  yield
+end
+def proc_return1
+  lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+  ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+  proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+  proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue LocalJumpError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+  block.call
+rescue LocalJumpError
+  $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+              block_get{break 55}.call
+            rescue LocalJumpError
+              $!.exit_value
+            end)
+
+def block_call(&block)
+  block.call
+end
+
+def test_b1
+  block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+  begin
+    yield
+  rescue LocalJumpError => e
+    r if /from proc-closure/ =~ e.message
+  end
+end
+
+def test_b2
+  ljump_rescue(22) do
+    block_get{break 21}.call
+  end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+  ljump_rescue(33) do
+    Proc.new{break 31}.yield
+  end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+  lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+  ljump_rescue(55) do
+    b = block_get{break 54}
+    block_call(&b)
+  end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+  b = lambda{break 67}
+  block_call(&b)
+  66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+  block_get{break 78}
+end
+
+def test_b7
+  b = util_r7()
+  ljump_rescue(77) do
+    block_call(&b)
+  end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+  block_call(&block)
+end
+
+def test_b8
+  util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+  lambda{block.call; 98}.call
+end
+
+def test_b9
+  util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+  util_b9{break 100}
+end
+
+def test_b10
+  util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+  ljump_rescue(111) do
+    loop do
+      Proc.new{break 110}.yield
+      break 112
+    end
+  end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+  loop do
+    break lambda{break 122}.call
+    break 121
+  end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+  ljump_rescue(133) do
+    while true
+      Proc.new{break 130}.yield
+      break 131
+    end
+  end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+  while true
+    break lambda{break 144}.call
+    break 143
+  end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+  [0].each {|c| yield 1 }
+  156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+  method = method(m)
+  test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+class ITER_TEST1
+   def a
+     block_given?
+   end
+end
+
+class ITER_TEST2 < ITER_TEST1
+   def a
+     test_ok(super)
+     super
+   end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+  def foo x
+    return yield if block_given?
+    x
+  end
+end
+
+class ITER_TEST4 < ITER_TEST3
+  def foo x
+    test_ok(super == yield)
+    test_ok(super(x, &nil) == x)
+  end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+   def tt(aa)
+     aa
+   end
+
+   def uu(a)
+      class << self
+         define_method(:tt) do |sym|
+            super(sym)
+         end
+      end
+   end
+
+   def xx(*x)
+     x.size
+   end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+   def xx(*a)
+      a << 12
+      super
+   end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+  test_ok(x != y)
+  test_ok((x < y) == false)
+  test_ok((x > y) == false)
+  test_ok((x <= y) == false)
+  test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+  return 1 if n == 0
+  f = 1
+  while n>0
+    f *= n
+    n -= 1
+  end
+  return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+  $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+  $good = false if ((1 << i) != n1)
+  n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+  n1 = n1 / 2
+  n2 = n2 >> 1
+  $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+  n1 = 1 << i;
+  if (n1**2-1) / (n1+1) != (n1-1)
+    $good = false
+  end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+  b = a / (2 ** 32)
+  c = a >> 32
+  test_ok(b == c)
+
+  b = a * (2 ** 32)
+  c = a << 32
+  test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = +<<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".dup.upcase![0] == ?A)
+test_ok("A".dup.downcase![0] == ?a)
+test_ok("abc".dup.tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".dup.tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".dup.squeeze!("a-z") == "abc")
+test_ok("abcd".dup.delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+  if i.chr != $y.shift
+    $bad = true
+    break
+  end
+}
+test_ok(!$bad)
+
+s = +"a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+  ch = [n].pack("C")
+  a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+  res = [a, b]
+  res += rest if rest
+  return res
+end
+
+# not enough argument
+begin
+  aaa()				# need at least 1 arg
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+begin
+  aaa				# no arg given (exception raised)
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+  iii=5				# nested local variable
+  $proc = Proc.new{|i|
+    iii = i
+  }
+  $proc2 = Proc.new {
+    $x = iii			# nested variables shared by procs
+  }
+  # scope of nested variables
+  test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii))		# out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+  iii = 10
+  def dyna_var_check
+    loop {
+      test_ok(!defined?(iii))
+      break
+    }
+  end
+  dyna_var_check
+  break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+  test_check "signal"
+
+  $x = 0
+  trap "SIGINT", Proc.new{|sig| $x = 2}
+  Process.kill "SIGINT", $$
+  100.times {
+    sleep 0.1
+    break if $x != 0
+  }
+  test_ok($x == 2)
+
+  trap "SIGINT", Proc.new{raise "Interrupt"}
+
+  x = false
+  begin
+    Process.kill "SIGINT", $$
+    sleep 0.1
+  rescue
+    x = $!
+  end
+  test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+  eval $foo
+rescue
+  test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+  local1 = "local1"
+  lambda {
+    local2 = "local2"
+    return binding
+  }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+  p eval("local1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+  EVTEST1 = 25
+  evtest2 = 125
+  $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25)	# constant in module
+test_ok(eval("evtest2", $x) == 125)	# local var in module
+$bad = true
+begin
+  eval("EVTEST1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+  p = binding
+  eval "foo11 = 1", p
+  foo22 = 5
+  Proc.new{foo11=22}.call
+  Proc.new{foo22=55}.call
+  test_ok(eval("foo11", p) == eval("foo11"))
+  test_ok(eval("foo11") == 1)
+  test_ok(eval("foo22", p) == eval("foo22"))
+  test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+  tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+  if $_.to_i % 5 != 0
+    done = false
+    break
+  end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+  TEST3 = 3
+  TEST4 = 4
+end
+
+module Const2
+  TEST3 = 6
+  TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+  "test"
+end
+bar = foo.clone
+def bar.test2
+  "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+  foo.test2
+  test_ok false
+rescue NoMethodError
+  test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+  a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+  ma = Marshal.dump(a)
+  b = Marshal.load(ma)
+  test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric.  This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+  $$ = 5
+  test_ok false
+rescue NameError
+  test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+  @@rule = "Uranus"
+  def ruler0
+    @@rule
+  end
+
+  def self.ruler1		# <= per method definition style
+    @@rule
+  end
+  class << self			# <= multiple method definition style
+    def ruler2
+      @@rule
+    end
+  end
+end
+
+module Olympians
+  @@rule ="Zeus"
+  def ruler3
+    @@rule
+  end
+end
+
+class Titans < Gods
+  @@rule = "Cronus"		# modifies @@rule in Gods
+  include Olympians
+  def ruler4
+    @@rule
+  end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+begin
+  atlas.ruler4
+rescue RuntimeError => e
+  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+  test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x))		# global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo))		# local variable
+
+test_ok(defined?(Array))	# constant
+test_ok(defined?(Object.new))	# method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2))	# operator expression
+
+class Foo
+  def foo
+    p :foo
+  end
+  protected :foo
+  def bar(f)
+    test_ok(defined?(self.foo))
+    test_ok(defined?(f.foo))
+  end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+  return !defined?(yield)
+end
+
+test_ok(defined_test)		# not iterator
+test_ok(!defined_test{})	# called as iterator
+
+test_check "alias"
+class Alias0
+  def foo; "foo" end
+end
+class Alias1 < Alias0
+  alias bar foo
+  def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+  alias baz foo
+  undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+  def foo
+    defined? super
+  end
+  def bar
+    defined? super
+  end
+  def quux
+    defined? super
+  end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+  test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+  test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+  dosish = true
+when %r'\A//'
+  test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+  test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+  dosish = true
+else
+  test_ok(File.expand_path(".", "/") == "/")
+  test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+  test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+  test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+  test_ok(File.expand_path("/", "z:/sub") == "z:/")
+  test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+  begin
+    b = o.binding
+    eval 'self', b
+  rescue ArgumentError
+  end
+}
+
+test_check "gc"
+begin
+  1.upto(10000) {
+    tmp = [0,1,2,3,4,5,6,7,8,9]
+  }
+  tmp = nil
+  test_ok true
+rescue
+  test_ok false
+end
+class S
+  def initialize(a)
+    @a = a
+  end
+end
+l=nil
+100000.times {
+  l = S.new(l)
+}
+GC.start
+test_ok true   # reach here or dumps core
+l = []
+100000.times {
+  l.push([l])
+}
+GC.start
+test_ok true   # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+  o.class.name
+}
+
+test_ok true   # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+  printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+  printf "end of test(test: %d)\n", $ntest
+end
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
deleted file mode 100644
index 700b23fc81..0000000000
--- a/bcc32/Makefile.sub
+++ /dev/null
@@ -1,476 +0,0 @@
-# -*- makefile -*-
-
-SHELL = $(COMSPEC)
-MKFILES = Makefile
-
-#### Start of system configuration section. ####
-OS = bccwin32
-RT = $(OS)
-
-## variables may be overridden by $(compile_dir)/Makefile
-!ifndef srcdir
-srcdir = ..
-!endif
-!ifndef RUBY_INSTALL_NAME
-RUBY_INSTALL_NAME = ruby
-!endif
-!ifndef RUBYW_INSTALL_NAME
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!endif
-!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
-!endif
-!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
-!endif
-!ifndef icondirs
-!ifdef ICONDIRS
-icondirs=$(ICONDIRS)
-!endif
-!endif
-!ifdef icondirs
-icondirs=$(icondirs:\=/)
-iconinc=-I$(icondirs: = -I)
-!endif
-###############
-
-VPATH = $(srcdir):$(srcdir)/missing
-.SUFFIXES: .y
-
-!ifndef CC
-CC = bcc32
-!endif
-!ifndef CPP
-CPP = cpp32
-!endif
-!ifndef RC
-RC = brcc32
-!endif
-!ifndef YACC
-YACC = bison
-YFLAGS = -o y.tab.c
-!endif
-!ifndef AR
-AR = tlib
-!endif
-
-PURIFY =
-AUTOCONF = autoconf
-RM = $(srcdir:/=\)\win32\rm.bat
-
-!if !defined(PROCESSOR_ARCHITECTURE)
-PROCESSOR_ARCHITECTURE = x86
-!endif
-MACHINE = $(PROCESSOR_ARCHITECTURE)
-!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
-!ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = 5
-!endif
-!if 6 < $(PROCESSOR_LEVEL)
-PROCESSOR_LEVEL = 6
-!endif
-PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
-CPU = i$(PROCESSOR_LEVEL)86
-ARCH = i386
-!else
-CPU = $(PROCESSOR_ARCHITECTURE)
-ARCH = $(PROCESSOR_ARCHITECTURE)
-!endif
-!ifndef DEBUGFLAGS
-DEBUGFLAGS = 
-!endif
-!ifndef OPTFLAGS
-OPTFLAGS = -O
-!endif
-
-!ifndef prefix
-prefix = /usr
-!endif
-!ifndef exec_prefix
-exec_prefix = $(prefix)
-!endif
-!ifndef libdir
-libdir = $(exec_prefix)/lib
-!endif
-!if !defined(datadir)
-datadir = $(prefix)/share
-!endif
-!ifndef EXTOUT
-EXTOUT = .ext
-!endif
-!ifndef RIDATADIR
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-!endif
-!ifndef TESTUI
-TESTUI = console
-!endif
-!ifndef TESTS
-TESTS =
-!endif
-!ifndef RDOCTARGET
-RDOCTARGET = install-doc
-!endif
-
-OUTFLAG       = -o
-!ifndef CFLAGS
-CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-!endif
-!ifndef CPPFLAGS
-CPPFLAGS = -I. -I$(srcdir) -I$(srcdir)missing
-!endif
-!ifndef LDFLAGS
-LDFLAGS = -S:$(STACK)
-!endif
-!ifndef RFLAGS
-RFLAGS = $(iconinc)
-!endif
-!ifndef EXTLIBS
-EXTLIBS =
-!endif
-LIBS = cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj crypt.obj erf.obj win32.obj
-
-!ifndef STACK
-STACK = 0x2000000
-!endif
-
-XCFLAGS = -DRUBY_EXPORT
-
-ARFLAGS = /a
-LD = ilink32 -q -Gn
-LDSHARED  = $(LD)
-XLDFLAGS  = -Tpe c0x32.obj
-WLDFLAGS  = -aa -Tpe c0w32.obj
-DLDFLAGS  = -Tpd c0d32.obj
-LIBRUBY_LDSHARED = $(LDSHARED)
-LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
-LDOBJECTS = $(MAINOBJ)
-
-SOLIBS = 
-
-EXEEXT = .exe
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
-RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT)
-RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)runruby.rb" --extout="$(EXTOUT)" --
-
-ORGLIBPATH = $(LIB)
-
-#### End of system configuration section. ####
-
-LIBRUBY_A     = $(RUBY_SO_NAME)-static.lib
-LIBRUBY_SO    = $(RUBY_SO_NAME).dll
-LIBRUBY       = $(RUBY_SO_NAME).lib
-LIBRUBYARG    = $(LIBRUBY)
-
-PREP          = miniruby$(EXEEXT)
-
-DMYOBJS       = dmyext.obj
-OBJEXT        = obj
-
-WINMAINOBJ    = winmain.$(OBJEXT)
-
-.path.c = .;$(srcdir);$(srcdir)win32;$(srcdir)missing
-.path.h = .;$(srcdir);$(srcdir)win32;$(srcdir)missing
-.path.y = $(srcdir)
-.path. = $(srcdir)
-
-.c.obj:
-	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
-
-.rc.res:
-	$(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)win32 $(RFLAGS) -fo$@ $(<:/=\)
-
-.y.c:
-	$(YACC) $(YFLAGS) $(<:\=/)
-	sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
-	@del y.tab.c
-
-all: $(srcdir)bcc32/Makefile.sub $(srcdir)common.mk
-
-ruby: $(PROGRAM)
-rubyw: $(WPROGRAM)
-
-!include $(srcdir)/common.mk
-
-PHONY: Makefile
-
-config: config.h config.status
-
-config.h:
-	@echo Creating $(@:.\=)
-	@type > $@ &&|
-\#define HAVE_SYS_TYPES_H 1
-\#define HAVE_SYS_STAT_H 1
-\#define HAVE_STDLIB_H 1
-\#define HAVE_STRING_H 1
-\#define HAVE_MEMORY_H 1
-\#define HAVE_OFF_T 1
-\#define SIZEOF_INT 4
-\#define SIZEOF_SHORT 2
-\#define SIZEOF_LONG 4
-\#define SIZEOF_LONG_LONG 0
-\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 4
-\#define SIZEOF_VOIDP 4
-\#define SIZEOF_FLOAT 4
-\#define SIZEOF_DOUBLE 8
-\#define SIZEOF_TIME_T 4
-\#define HAVE_PROTOTYPES 1
-\#define TOKEN_PASTE(x,y) x\#\#y
-\#define HAVE_STDARG_PROTOTYPES 1
-\#define NORETURN(x) x
-\#define HAVE_DECL_SYS_NERR 1
-\#define HAVE_LIMITS_H 1
-\#define HAVE_FCNTL_H 1
-\#define HAVE_UTIME_H 1
-\#define HAVE_FLOAT_H 1
-\#define HAVE_STRUCT_STAT_ST_RDEV 1
-\#define HAVE_ST_RDEV 1
-\#define GETGROUPS_T int
-\#define RETSIGTYPE void
-\#define HAVE_ALLOCA 1
-\#define HAVE_DUP2 1
-\#define HAVE_MEMMOVE 1
-\#define HAVE_MKDIR 1
-\#define HAVE_STRCASECMP 1
-\#define HAVE_STRNCASECMP 1
-\#define HAVE_STRERROR 1
-\#define HAVE_STRFTIME 1
-\#define HAVE_STRCHR 1
-\#define HAVE_STRSTR 1
-\#define HAVE_STRTOD 1
-\#define HAVE_STRTOL 1
-\#define HAVE_STRTOUL 1
-\#define HAVE_ISNAN 1
-\#define HAVE_FINITE 1
-\#define HAVE_FMOD 1
-\#define HAVE_WAITPID 1
-\#define HAVE_FSYNC 1
-\#define HAVE_GETCWD 1
-\#define HAVE_CHSIZE 1
-\#define HAVE_TIMES 1
-\#define HAVE_FCNTL 1
-\#define HAVE_LINK 1
-\#define HAVE_TELLDIR 1
-\#define HAVE_SEEKDIR 1
-\#define HAVE_COSH 1
-\#define HAVE_SINH 1
-\#define HAVE_TANH 1
-\#define RSHIFT(x,y) ((x)>>(int)y)
-\#define FILE_COUNT level
-\#define FILE_READPTR curp
-\#define inline __inline
-\#define NEED_IO_SEEK_BETWEEN_RW 1
-\#define STACK_GROW_DIRECTION -1
-\#define DEFAULT_KCODE KCODE_NONE
-\#define DLEXT ".so"
-\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
-\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-|
-
-config.status: $(MKFILES) $(srcdir)bcc32/Makefile.sub $(srcdir)common.mk
-	@echo Creating $@
-	@type > $@ &&|
-# Generated automatically by Makefile.sub.
-s,@SHELL@,$$(COMSPEC),;t t
-s,@PATH_SEPARATOR@,;,;t t
-s,@CFLAGS@,$(CFLAGS),;t t
-s,@CPPFLAGS@,$(CPPFLAGS),;t t
-s,@CXXFLAGS@,$(CXXFLAGS),;t t
-s,@FFLAGS@,$(FFLAGS),;t t
-s,@LDFLAGS@,,;t t
-s,@LIBS@,$(LIBS),;t t
-s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,$(prefix),;t t
-s,@program_transform_name@,s,,,,;t t
-s,@bindir@,$${exec_prefix}/bin,;t t
-s,@sbindir@,$${exec_prefix}/sbin,;t t
-s,@libexecdir@,$${exec_prefix}/libexec,;t t
-s,@datadir@,$${prefix}/share,;t t
-s,@sysconfdir@,$${prefix}/etc,;t t
-s,@sharedstatedir@,/etc,;t t
-s,@localstatedir@,/var,;t t
-s,@libdir@,$${exec_prefix}/lib,;t t
-s,@includedir@,$${prefix}/include,;t t
-s,@oldincludedir@,/usr/include,;t t
-s,@infodir@,$${prefix}/info,;t t
-s,@mandir@,$${prefix}/man,;t t
-s,@build@,$(CPU)-pc-$(OS),;t t
-s,@build_alias@,$(CPU)-$(OS),;t t
-s,@build_cpu@,$(CPU),;t t
-s,@build_vendor@,pc,;t t
-s,@build_os@,$(OS),;t t
-s,@host@,$(CPU)-pc-$(OS),;t t
-s,@host_alias@,$(CPU)-$(OS),;t t
-s,@host_cpu@,$(CPU),;t t
-s,@host_vendor@,pc,;t t
-s,@host_os@,$(OS),;t t
-s,@target@,$(ARCH)-pc-$(OS),;t t
-s,@target_alias@,$(ARCH)-$(OS),;t t
-s,@target_cpu@,$(ARCH),;t t
-s,@target_vendor@,pc,;t t
-s,@target_os@,$(OS),;t t
-s,@CC@,$(CC),;t t
-s,@CPP@,cpp32,;t t
-s,@YACC@,$(YACC),;t t
-s,@RANLIB@,,;t t
-s,@AR@,$(AR),;t t
-s,@ARFLAGS@,$(ARFLAGS) ,;t t
-s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,$(SET_MAKE),;t t
-s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
-s,@ALLOCA@,$(ALLOCA),;t t
-s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
-s,@EXEEXT@,.exe,;t t
-s,@OBJEXT@,obj,;t t
-s,@XCFLAGS@,$(XCFLAGS),;t t
-s,@XLDFLAGS@,$(XLDFLAGS),;t t
-s,@DLDFLAGS@,$(DLDFLAGS),;t t
-s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
-s,@STATIC@,$(STATIC),;t t
-s,@CCDLFLAGS@,,;t t
-s,@LDSHARED@,$(LDSHARED),;t t
-s,@DLEXT@,so,;t t
-s,@LIBEXT@,lib,;t t
-s,@STRIP@,$(STRIP),;t t
-s,@EXTSTATIC@,$(EXTSTATIC),;t t
-s,@setup@,Setup,;t t
-s,@MINIRUBY@,$(MINIRUBY),;t t
-s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
-s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
-s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
-s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
-s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
-s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
-s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
-s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
-s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
-s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
-s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
-s,@SOLIBS@,$(SOLIBS),;t t
-s,@DLDLIBS@,$(DLDLIBS),;t t
-s,@ENABLE_SHARED@,yes,;t t
-s,@OUTFLAG@,$(OUTFLAG),;t t
-s,@CPPOUTFILE@,,;t t
-s,@LIBPATHFLAG@, -L"%s",;t t
-s,@RPATHFLAG@,,;t t
-s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
-s,@COMPILE_C@,$$(CC) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
-s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: .%s.%s:,;t t
-s,@COMMON_LIBS@,m,;t t
-s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN;t t
-s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
-s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
-s,@EXPORT_PREFIX@,_,;t t
-s,@arch@,$(ARCH)-$(OS),;t t
-s,@sitearch@,$(ARCH)-$(OS),;t t
-s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
-s,@configure_args@,--enable-shared $(configure_args),;t t
-s,@configure_input@,$$configure_input,;t t
-s,@srcdir@,$(srcdir),;t t
-s,@top_srcdir@,$(srcdir),;t t
-|
-
-miniruby$(EXEEXT):
-		@echo $(LIBS)
-		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBY_A) $(LIBS)
-
-$(PROGRAM):	$(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
-		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
-
-$(WPROGRAM):	$(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
-		$(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
-
-$(LIBRUBY_A):	$(OBJS) dmyext.obj
-		@-if exist $@ del $@
-		$(AR) $(ARFLAGS) "$@" $(OBJS) dmyext.obj
-
-# $(LIBRUBY):	$(LIBRUBY_SO)
-#		implib $@ $(LIBRUBY_SO)
-
-$(LIBRUBY_SO): $(LIBRUBY_A) $(EXTOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
-		@echo $(EXTOBJS)
-		$(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(EXTOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
-
-$(LIBRUBY): $(LIBRUBY_SO)
-
-$(RUBYDEF):	$(LIBRUBY_A) $(PREP)
-		$(MINIRUBY) $(srcdir)bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
-		@$(MINIRUBY) $(srcdir)win32/resource.rb \
-			-ruby_name=$(RUBY_INSTALL_NAME) \
-			-rubyw_name=$(RUBYW_INSTALL_NAME) \
-			-so_name=$(RUBY_SO_NAME) \
-			. $(icondirs) $(srcdir)win32
-
-clean-local::
-		@$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
-		@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
-
-distclean-local::
-		@$(RM) ext\config.cache $(RBCONFIG:/=\)
-		@$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
-		@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
-
-ext/extinit.obj: ext/extinit.c $(SETUP)
-	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
-
-main.$(OBJEXT): win32.h
-ascii.$(OBJEXT): win32.h
-array.$(OBJEXT): win32.h
-bignum.$(OBJEXT): win32.h
-class.$(OBJEXT): win32.h
-compar.$(OBJEXT): win32.h
-dir.$(OBJEXT): dir.h win32.h
-dln.$(OBJEXT): win32.h
-enum.$(OBJEXT): win32.h
-error.$(OBJEXT): win32.h
-euc_jp.$(OBJEXT): win32.h
-eval.$(OBJEXT): win32.h
-file.$(OBJEXT): win32.h
-gc.$(OBJEXT): win32.h
-hash.$(OBJEXT): win32.h
-inits.$(OBJEXT): win32.h
-io.$(OBJEXT): win32.h
-marshal.$(OBJEXT): win32.h
-math.$(OBJEXT): win32.h
-numeric.$(OBJEXT): win32.h
-object.$(OBJEXT): win32.h
-pack.$(OBJEXT): win32.h
-parse.$(OBJEXT): win32.h
-process.$(OBJEXT): win32.h
-prec.$(OBJEXT): win32.h
-random.$(OBJEXT): win32.h
-range.$(OBJEXT): win32.h
-re.$(OBJEXT): win32.h
-regcomp.$(OBJEXT): win32.h
-regenc.$(OBJEXT): win32.h
-regerror.$(OBJEXT): win32.h
-regexec.$(OBJEXT): win32.h
-reggnu.$(OBJEXT): win32.h
-regparse.$(OBJEXT): win32.h
-ruby.$(OBJEXT): win32.h
-signal.$(OBJEXT): win32.h
-sjis.$(OBJEXT): win32.h
-sprintf.$(OBJEXT): win32.h
-st.$(OBJEXT): win32.h
-string.$(OBJEXT): win32.h
-struct.$(OBJEXT): win32.h
-time.$(OBJEXT): win32.h
-utf8.$(OBJEXT): win32.h
-util.$(OBJEXT): win32.h
-variable.$(OBJEXT): win32.h
-version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
deleted file mode 100644
index 31809e314b..0000000000
--- a/bcc32/README.bcc32
+++ /dev/null
@@ -1,130 +0,0 @@
-=begin
-
-= How to build ruby using Borland C++
-
-== Requirement
-
-(1) Borland C++ 5.0 or later.
-
-(2) Please set environment variable (({INCLUDE})), (({LIB})), (({PATH}))
-    to run required commands properly from the command line.
-
-    Note: building ruby requires following commands.
-     * make
-     * bcc
-     * tlib
-     * ilink
-
-(3) If you want to build from CVS source, following commands are required.
-     * bison
-     * sed
-
-== How to compile and install
-
-(1) Execute bcc32\configure.bat on your build directory.
-     ex. c:\src\ruby> bcc32\configure.bat
-    You can specify the target platform as an argument.
-    For example, run `((%configure i686-bccwin32%))'
-    You can also specify the install directory.
-    For example, run `((%configure --prefix=<install_directory>%))'
-    Default of the install directory is /usr .
-     
-(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
-    if you want to change the name of the executable files. 
-    And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
-    executable without console window if also you want.
-
-(3) Run `((%make%))'
-
-(4) Run `((%make test%))'
-
-(5) Run `((%make install%))'
-
-    This command will create following directories and install files onto them.
-      * <install_directory>\bin
-      * <install_directory>\lib
-      * <install_directory>\lib\ruby
-      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
-      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
-      * <install_directory>\lib\ruby\site_ruby
-      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
-      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
-      * <install_directory>\man\man1
-    If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
-    The default ((|<PLATFORM>|)) is `(({i386-bccwin32}))'.
-
-== Icons
-
-Any icon files(*.ico) in the build directory, directories specified with
-((|icondirs|)) make variable and (({win32})) directory under the ruby
-source directory will be included in DLL or executable files, according
-to their base names.
-    $(RUBY_INSTALL_NAME).ico or ruby.ico   --> $(RUBY_INSTALL_NAME).exe
-    $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
-    the others                             --> $(RUBY_SO_NAME).dll
-
-Although no icons are distributed with the ruby source or in the official 
-site, you can use anything you like. For example, followings are written 
-in Japanese, but you can download at least.
-
-* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
-  ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
-* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
-  ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
-
-== Build examples
-
-* Build on the ruby source directory.
-
-  ex.)
-    ruby source directory:  C:\ruby
-    build directory:        C:\ruby
-    install directory:      C:\usr\local
-
-    C:
-    cd \ruby
-    bcc32\configure --prefix=/usr/local
-    make
-    make test
-    make install
-
-* Build on the relative directory from the ruby source directory and CPU type 
-  i386.
-
-  ex.)
-    ruby source directory:  C:\ruby
-    build directory:        C:\ruby\bccwin32
-    install directory:      C:\usr\local
-    CPU                     i386
-    
-    C:
-    cd \ruby
-    mkdir bccwin32
-    cd bccwin32
-    ..\bcc32\configure --prefix=/usr/local
-    make
-    make test
-    make install
-
-* Build on the different drive.
-
-  ex.)
-    ruby source directory:  C:\src\ruby
-    build directory:        D:\build\ruby
-    install directory:      C:\usr\local
-
-    D:
-    cd D:\build\ruby
-    C:\src\ruby\bcc32\configure --prefix=C:/usr/local
-    make
-    make test
-    make install
-
-== Bugs
-
-You can ((*NOT*)) use a path name contains any white space characters as
-the ruby source directory, this restriction comes from the behavior of
-(({!INCLUDE})) directives of (({MAKE})).
-((- you may call it a bug. -))
-
-=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
deleted file mode 100644
index 717104af18..0000000000
--- a/bcc32/configure.bat
+++ /dev/null
@@ -1,86 +0,0 @@
-@echo off

-::: Don't set environment variable in batch file other than autoexec.bat

-::: to avoid "Out of environment space" problem on Windows 95/98.

-::: set TMPMAKE=~tmp~.mak

-

-echo> ~tmp~.mak ####

-echo>> ~tmp~.mak conf = %0

-echo>> ~tmp~.mak $(conf:\=/): nul

-echo>> ~tmp~.mak 	@del ~tmp~.mak

-echo>> ~tmp~.mak 	@-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \

-:loop

-if "%1" == "" goto :end

-if "%1" == "--prefix" goto :prefix

-if "%1" == "--srcdir" goto :srcdir

-if "%1" == "srcdir" goto :srcdir

-if "%1" == "--target" goto :target

-if "%1" == "target" goto :target

-if "%1" == "--with-static-linked-ext" goto :extstatic

-if "%1" == "--program-suffix" goto :suffix

-if "%1" == "--program-name" goto :progname

-if "%1" == "--enable-install-doc" goto :enable-rdoc

-if "%1" == "--disable-install-doc" goto :disable-rdoc

-if "%1" == "-h" goto :help

-if "%1" == "--help" goto :help

-  echo>> ~tmp~.mak 	"%1" \

-  shift

-goto :loop

-:srcdir

-  echo>> ~tmp~.mak 	-D"srcdir=%2" \

-  shift

-  shift

-goto :loop

-:prefix

-  echo>> ~tmp~.mak 	-D"prefix=%2" \

-  shift

-  shift

-goto :loop

-:suffix

-  echo>> ~tmp~.mak 	-D"RUBY_SUFFIX=%2" \

-  shift

-  shift

-goto :loop

-:installname

-  echo>> ~tmp~.mak 	-D"RUBY_INSTALL_NAME=%2" \

-  shift

-  shift

-goto :loop

-:soname

-  echo>> ~tmp~.mak 	-D"RUBY_SO_NAME=%2" \

-  shift

-  shift

-goto :loop

-:target

-  echo>> ~tmp~.mak 	"%2" \

-  shift

-  shift

-goto :loop

-:extstatic

-  echo>> ~tmp~.mak 	-D"EXTSTATIC=static" \

-  shift

-goto :loop

-:enable-rdoc

-  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-doc" \

-  shift

-goto :loop

-:disable-rdoc

-  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-nodoc" \

-  shift

-goto :loop

-:help

-  echo Configuration:

-  echo   --help                  display this help

-  echo   --srcdir=DIR            find the sources in DIR [configure dir or `..']

-  echo Installation directories:

-  echo   --prefix=PREFIX         install files in PREFIX [/usr]

-  echo System types:

-  echo   --target=TARGET         configure for TARGET [i386-bccwin32]

-  echo Optional Package:

-  echo   --with-static-linked-ext link external modules statically

-  echo   --disable-install-doc   do not install rdoc indexes during install

-  del ~tmp~.mak

-goto :exit

-:end

-echo>> ~tmp~.mak 	bcc32dir="$(@D)"

-make -s -f ~tmp~.mak

-:exit

diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
deleted file mode 100644
index e34b441e2f..0000000000
--- a/bcc32/mkexports.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-#!./miniruby -s
-
-SYM = {}
-STDIN.reopen(open("nul"))
-ARGV.each do |obj|
-  IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
-    next unless /(?:PUBDEF|PUBD32)/ =~ l
-    SYM[$1] = true if /'(.*?)'/ =~ l
-  end
-end
-
-exports = []
-if $name
-  exports << "Name " + $name
-elsif $library
-  exports << "Library " + $library
-end
-exports << "Description " + $description.dump if $description
-exports << "EXPORTS" << SYM.keys.sort
-
-if $output
-  open($output, 'w') {|f| f.puts exports.join("\n")}
-else
-  puts exports.join("\n")
-end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
deleted file mode 100644
index 991239a428..0000000000
--- a/bcc32/setup.mak
+++ /dev/null
@@ -1,96 +0,0 @@
-# -*- makefile -*-
-
-!if "$(srcdir)" != ""
-bcc32dir = $(srcdir)bcc32/
-!elseif "$(bcc32dir)" == "bcc32/"
-srcdir = ./
-!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
-srcdir = $(bcc32dir:/bcc32/=/)
-!else
-srcdir = $(bcc32dir)../
-!endif
-!if "$(prefix)" == ""
-prefix = /usr
-!endif
-OS = bccwin32
-RT = $(OS)
-INCLUDE = !include
-APPEND = echo>>$(MAKEFILE)
-!ifdef MAKEFILE
-MAKE = $(MAKE) -f $(MAKEFILE)
-!else
-MAKEFILE = Makefile
-!endif
-
-all: Makefile
-Makefile: -prologue- -generic- -epilogue-
-i386-$(OS): -prologue- -i386- -epilogue-
-i486-$(OS): -prologue- -i486- -epilogue-
-i586-$(OS): -prologue- -i586- -epilogue-
-i686-$(OS): -prologue- -i686- -epilogue-
-alpha-$(OS): -prologue- -alpha- -epilogue-
-
--prologue-: nul
-	@echo Creating $(MAKEFILE)
-	@type > $(MAKEFILE) &&|
-\#\#\# Makefile for ruby $(OS) \#\#\#
-srcdir = $(srcdir:\=/)
-prefix = $(prefix:\=/)
-EXTSTATIC = $(EXTSTATIC)
-!if defined(RDOCTARGET)
-RDOCTARGET = $(RDOCTARGET)
-!endif
-|
-	@cpp32 -I$(srcdir) -P- -DRUBY_EXTERN="//" -o$(MAKEFILE) > nul &&|
-\#include "version.h"
-MAJOR = RUBY_VERSION_MAJOR
-MINOR = RUBY_VERSION_MINOR
-TEENY = RUBY_VERSION_TEENY
-|
-	@type $(MAKEFILE).i >> $(MAKEFILE)
-	@del $(MAKEFILE).i
-
--generic-: nul
-!if defined(PROCESSOR_ARCHITECTURE) ||  defined(PROCESSOR_LEVEL)
-	@type >> $(MAKEFILE) &&|
-!if defined(PROCESSOR_ARCHITECTURE)
-PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
-!endif
-!if defined(PROCESSOR_LEVEL)
-PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
-!endif
-
-|
-!endif
-
--alpha-: nul
-	@$(APPEND) PROCESSOR_ARCHITECTURE = alpha
--ix86-: nul
-	@$(APPEND) PROCESSOR_ARCHITECTURE = x86
-
--i386-: -ix86-
-	@$(APPEND) PROCESSOR_LEVEL = 3
--i486-: -ix86-
-	@$(APPEND) PROCESSOR_LEVEL = 4
--i586-: -ix86-
-	@$(APPEND) PROCESSOR_LEVEL = 5
--i686-: -ix86-
-	@$(APPEND) PROCESSOR_LEVEL = 6
-
--epilogue-: nul
-	@type >> $(MAKEFILE) &&|
-
-\# OS = $(OS)
-\# RT = $(RT)
-\# RUBY_INSTALL_NAME = ruby
-\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
-\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
-\# STACK = 0x2000000
-\# LDFLAGS = -S:$$(STACK)
-\# RFLAGS = $$(iconinc)
-\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
-$(INCLUDE) $$(srcdir)bcc32/Makefile.sub
-|
-	@$(srcdir:/=\)\win32\rm.bat config.h config.status
-	@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..9f9192685e
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,75 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+benchmark-driver --help
+Usage: benchmark-driver [options] RUBY|YAML...
+    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
+    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
+    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
+        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
+        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
+        --bundler                    Install and use gems specified in Gemfile
+        --filter REGEXP              Filter out benchmarks with given regexp
+        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
+        --timeout SECONDS            Timeout ruby command execution with timeout(1)
+    -v, --verbose                    Verbose mode. Multiple -v options increase visibility (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/app_answer.rb b/benchmark/app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..c1546e08ab
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def orthoBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    orthoBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+  # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  # $fp = fp
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n")
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+benchmark:
+  app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
new file mode 100644
index 0000000000..e61bc8aa32
--- /dev/null
+++ b/benchmark/app_fib.rb
@@ -0,0 +1,10 @@
+def fib(n)
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+#   "Understanding Computation" by Tom Stuart
+#   http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST     = -> l { LEFT[RIGHT[l]] }
+IF        = -> b { b }
+LEFT      = -> p { p[-> x { -> y { x } } ] }
+RIGHT     = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY  = LEFT
+REST      = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+  proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+  IF[proc][true][false]
+end
+
+def to_array(proc)
+  array = []
+
+  until to_boolean(IS_EMPTY[proc])
+    array.push(FIRST[proc])
+    proc = REST[proc]
+  end
+
+  array
+end
+
+def to_char(c)
+  '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+  to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+  to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i += 1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+  i += 1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i += 1
+end
diff --git a/benchmark/app_tak.rb b/benchmark/app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/app_tarai.rb b/benchmark/app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/app_uri.rb b/benchmark/app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+  small_flat_ary = 5.times.to_a
+  large_flat_ary = 100.times.to_a
+  small_pairs_ary = [[1, 2]] * 5
+  large_pairs_ary = [[1, 2]] * 100
+  mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+  small_flat_ary.flatten: small_flat_ary.flatten
+  small_flat_ary.flatten!: small_flat_ary.flatten!
+  large_flat_ary.flatten: large_flat_ary.flatten
+  large_flat_ary.flatten!: large_flat_ary.flatten!
+  small_pairs_ary.flatten: small_pairs_ary.flatten
+  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+  large_pairs_ary.flatten: large_pairs_ary.flatten
+  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+  mostly_flat_ary.flatten: mostly_flat_ary.flatten
+  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+  small1 = [1, 2, 3]
+  small2 = [1, 2, 3, 4, 5]
+  small3 = [2, 3, 4, 5]
+  small4 = [2]
+  big1 = [1, 2, 3, 4] * 64
+  big2 = [1, 2, 3] * 64
+  big3 = [1, 2] * 64
+
+benchmark:
+  small-&: small1 & small2 & small3 & small4
+  small-intersection: small1.intersection(small2, small3, small4)
+  big-&: big1 & big2 & big3
+  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
new file mode 100644
index 0000000000..423d68391f
--- /dev/null
+++ b/benchmark/array_large_literal.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def def_array(size)
+    Object.class_eval(<<-END)
+      def array_#{size}
+        x = 1
+        [#{(['x'] * size).join(',')}]
+      end
+    END
+  end
+  def_array(100)
+  def_array(1000)
+  def_array(10000)
+  def_array(100000)
+benchmark:
+  array_100: array_100
+  array_1000: array_1000
+  array_10000: array_10000
+  array_100000: array_100000
+
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_f).shuffle
+  ary10 = 10.times.map(&:to_f).shuffle
+  ary100 = 100.times.map(&:to_f).shuffle
+  ary500 = 500.times.map(&:to_f).shuffle
+  ary1000 = 1000.times.map(&:to_f).shuffle
+  ary2000 = 2500.times.map(&:to_f).shuffle
+  ary3000 = 2500.times.map(&:to_f).shuffle
+  ary5000 = 5000.times.map(&:to_f).shuffle
+  ary10000 = 10000.times.map(&:to_f).shuffle
+  ary20000 = 20000.times.map(&:to_f).shuffle
+  ary50000 = 50000.times.map(&:to_f).shuffle
+  ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+  ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_s).shuffle
+  ary10 = 10.times.map(&:to_s).shuffle
+  ary100 = 100.times.map(&:to_s).shuffle
+  ary500 = 500.times.map(&:to_s).shuffle
+  ary1000 = 1000.times.map(&:to_s).shuffle
+  ary2000 = 2500.times.map(&:to_s).shuffle
+  ary3000 = 2500.times.map(&:to_s).shuffle
+  ary5000 = 5000.times.map(&:to_s).shuffle
+  ary10000 = 10000.times.map(&:to_s).shuffle
+  ary20000 = 20000.times.map(&:to_s).shuffle
+  ary50000 = 50000.times.map(&:to_s).shuffle
+  ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.min: ary2.min
+  ary10.min: ary10.min
+  ary100.min: ary100.min
+  ary500.min: ary500.min
+  ary1000.min: ary1000.min
+  ary2000.min: ary2000.min
+  ary3000.min: ary3000.min
+  ary5000.min: ary5000.min
+  ary10000.min: ary10000.min
+  ary20000.min: ary20000.min
+  ary50000.min: ary50000.min
+  ary100000.min: ary100000.min
+  ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+  - ary.sample
+  - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+  [10_000,1_000_000,100_000_000].each do |n|
+    ary = Array.new(n,0)
+    GC.start
+    x.report("#{n}:shift"){ ary.shift }
+    (0..4).each do |i|
+      ary = Array.new(n,0)
+      GC.start
+      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+    end
+  end
+end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 & arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 - arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 | arr2
+    end
+  end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+  ary2.sort: ary2.sort
+  ary10.sort: ary10.sort
+  ary100.sort: ary100.sort
+  ary1000.sort: ary1000.sort
+  ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+  class C
+    attr_accessor :x
+    def initialize
+      @x = nil
+    end
+    class_eval <<-END
+      def ar
+        #{'x;'*256}
+      end
+      def aw
+        #{'self.x = nil;'*256}
+      end
+      def arm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def awm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+    END
+  end
+  obj = C.new
+benchmark:
+  attr_reader: "obj.ar"
+  attr_writer: "obj.aw"
+  attr_reader_method: "obj.arm"
+  attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  array = string.bytes
+  buffer = IO::Buffer.for(string)
+benchmark:
+  string.each_byte: |
+    upcased = String.new
+    string.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
+  array.each: |
+    upcased = String.new
+    array.each do |byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each: |
+    upcased = String.new
+    buffer.each(:U8) do |offset, byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each_byte: |
+    upcased = String.new
+    buffer.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  buffer = IO::Buffer.for(string)
+  format = [:U32, :U32, :U32, :U32]
+benchmark:
+  string.unpack1: |
+    [
+      string.unpack1("N"),
+      string.unpack1("N", offset: 4),
+      string.unpack1("N", offset: 8),
+      string.unpack1("N", offset: 12),
+    ]
+  buffer.get_value: |
+    [
+      buffer.get_value(:U32, 0),
+      buffer.get_value(:U32, 4),
+      buffer.get_value(:U32, 8),
+      buffer.get_value(:U32, 12),
+    ]
+  buffer.get_values: |
+    buffer.get_values(format, 0)
+  string.unpack: |
+    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'cgi/escape'
+benchmark:
+  - script: CGI.escapeHTML("")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcde")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcd<")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: CGI.escapeHTML(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: CGI.escapeHTML(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: CGI.escapeHTML(example_html)
+    loop_count: 1000000
diff --git a/benchmark/class_superclass.yml b/benchmark/class_superclass.yml
new file mode 100644
index 0000000000..847ff811f1
--- /dev/null
+++ b/benchmark/class_superclass.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class SimpleClass; end
+  class OneModuleClass
+    1.times { include Module.new }
+  end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+benchmark:
+  object_class_superclass: |
+    Object.superclass
+  simple_class_superclass: |
+    SimpleClass.superclass
+  one_module_class: |
+    OneModuleClass.superclass
+  medium_class_superclass: |
+    MediumClass.superclass
+  large_class_superclass: |
+    LargeClass.superclass
+loop_count: 20000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+  constants
+
+  # With previous behavior, this would cause all of the constant caches
+  # associated with the constant lookups listed above to invalidate, meaning
+  # they would all have to be fetched again. With current behavior, it only
+  # invalidates when a name matches, so the following constant set shouldn't
+  # impact the constant lookups listed above.
+  INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+  max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/dir_pwd.yml b/benchmark/dir_pwd.yml
new file mode 100644
index 0000000000..c435d3ac5e
--- /dev/null
+++ b/benchmark/dir_pwd.yml
@@ -0,0 +1,2 @@
+benchmark:
+  pwd: Dir.pwd
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+  num = (1..).lazy.take(100)
+  ary2 = [[1,2]].cycle.lazy.take(10)
+  ary10 = [[*1..10]].cycle.lazy.take(10)
+  ary20 = [[*1..20]].cycle.lazy.take(10)
+  ary50 = [[*1..50]].cycle.lazy.take(10)
+  ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+  num3: num.flat_map {|x| x}.take(3).to_a
+  num10: num.flat_map {|x| x}.take(3).to_a
+  ary2:  ary2.flat_map {|x| x}.take(3).to_a
+  ary10: ary10.flat_map {|x| x}.take(3).to_a
+  ary20: ary20.flat_map {|x| x}.take(3).to_a
+  ary50: ary50.flat_map {|x| x}.take(3).to_a
+  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+  a = (1..3).lazy
+  b = a.map {|x| x}
+
+benchmark:
+  first_ary: a.zip(["a", "b", "c"]).first
+  first_nonary: a.zip("a".."c").first
+  first_noarg: a.zip.first
+
+  take3_ary: a.zip(["a", "b", "c"]).take(3).force
+  take3_nonary: a.zip("a".."c").take(3).force
+  take3_noarg: a.zip.take(3).force
+
+  chain-first_ary: b.zip(["a", "b", "c"]).first
+  chain-first_nonary: b.zip("a".."c").first
+  chain-first_noarg: b.zip.first
+
+  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+  chain-take3_nonary: b.zip("a".."c").take(3).force
+  chain-take3_noarg: b.zip.take(3).force
+
+  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.min: set2.min
+  set10.min: set10.min
+  set100.min: set100.min
+  set1000.min: set1000.min
+  set10000.min: set10000.min
+  set2.max: set2.max
+  set10.max: set10.max
+  set100.max: set100.max
+  set1000.max: set1000.max
+  set10000.max: set10000.max
+  set2.minmax: set2.minmax
+  set10.minmax: set10.minmax
+  set100.minmax: set100.minmax
+  set1000.minmax: set1000.minmax
+  set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.sort_by: set2.sort_by { 0 }
+  set10.sort_by: set10.sort_by { 0 }
+  set100.sort_by: set100.sort_by { 0 }
+  set1000.sort_by: set1000.sort_by { 0 }
+  set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
new file mode 100644
index 0000000000..d386353888
--- /dev/null
+++ b/benchmark/enum_sort_by.yml
@@ -0,0 +1,53 @@
+prelude: |
+  array_length = 2
+  fixnum_array2 = array_length.times.to_a.map {rand(10000)}
+  float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array2 =array_length.times.to_a.map {0}
+
+  array_length = 10
+  fixnum_array10 = array_length.times.to_a.map {rand(10000)}
+  float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array10 =array_length.times.to_a.map {0}
+
+  array_length = 1000
+  fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
+  float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array1000 =array_length.times.to_a.map {0}
+
+  array_length = 100000
+  fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
+  float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array100000 =array_length.times.to_a.map {0}
+
+benchmark:
+  fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
+  float_array2.sort_by:  float_array2.sort_by {|a| a}
+  string_length2.sort_by: string_array2.sort_by {|a| a.length}
+  mix_array2.sort_by:  mix_array2.sort_by {|a| a}
+  all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
+
+  fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
+  float_array10.sort_by:  float_array10.sort_by {|a| a}
+  string_length10.sort_by: string_array10.sort_by {|a| a.length}
+  mix_array10.sort_by:  mix_array10.sort_by {|a| a}
+  all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
+
+  fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
+  float_array1000.sort_by:  float_array1000.sort_by {|a| a}
+  string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
+  mix_array1000.sort_by:  mix_array1000.sort_by {|a| a}
+  all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
+
+  fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
+  float_array100000.sort_by:  float_array100000.sort_by {|a| a}
+  string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
+  mix_array100000.sort_by:  mix_array100000.sort_by {|a| a}
+  all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+  list = ("aaa".."zzz").to_a*10
+benchmark:
+  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'erb'
+benchmark:
+  - script: ERB::Util.html_escape("")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcde")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcd<")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: ERB::Util.html_escape(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: ERB::Util.html_escape(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: ERB::Util.html_escape(example_html)
+    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+
+  src = "def self.render(title, content); #{ERB.new(data).src}; end"
+  mod = Module.new
+  mod.instance_eval(src, "(ERB)")
+benchmark:
+  erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+  def make_link(previous)
+    Fiber.new do
+      while message = previous.resume
+        Fiber.yield(message)
+      end
+    end
+  end
+
+  def make_chain(length = 1000, &block)
+    chain = Fiber.new(&block)
+
+    (length - 1).times do
+      chain = make_link(chain)
+    end
+
+    return chain
+  end
+
+  message = "Hello World!"
+
+  chain = make_chain do
+    while true
+      Fiber.yield(message)
+    end
+  end
+benchmark:
+  make_chain: |
+    make_chain(100) do
+      while true
+        Fiber.yield(message)
+      end
+    end
+  resume_chain: |
+    chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+  th = Thread.current
+  th[:key] = :val
+benchmark:
+  key?: th.key?(:key)
+  []: th[:key]
+  keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_basename.yml b/benchmark/file_basename.yml
new file mode 100644
index 0000000000..fbd78785aa
--- /dev/null
+++ b/benchmark/file_basename.yml
@@ -0,0 +1,6 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  long: File.basename("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+  long_name: File.basename("Users_george_src_github.com_ruby_ruby_benchmark_file_dirname.yml")
+  withext: File.basename("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml", ".yml")
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+  File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_dirname.yml b/benchmark/file_dirname.yml
new file mode 100644
index 0000000000..43a81c9371
--- /dev/null
+++ b/benchmark/file_dirname.yml
@@ -0,0 +1,6 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  long: File.dirname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+  short: File.dirname("foo/bar")
+  n_4: File.dirname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml", 4)
diff --git a/benchmark/file_expand_path.yml b/benchmark/file_expand_path.yml
new file mode 100644
index 0000000000..9e503ab003
--- /dev/null
+++ b/benchmark/file_expand_path.yml
@@ -0,0 +1,4 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  expand_path: File.expand_path("../../foo.txt", __FILE__)
diff --git a/benchmark/file_extname.yml b/benchmark/file_extname.yml
new file mode 100644
index 0000000000..fb16e55840
--- /dev/null
+++ b/benchmark/file_extname.yml
@@ -0,0 +1,6 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  long: File.extname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+  long_name: File.extname("Users_george_src_github.com_ruby_ruby_benchmark_file_dirname.yml")
+  short: File.extname("foo/bar")
diff --git a/benchmark/file_join.yml b/benchmark/file_join.yml
new file mode 100644
index 0000000000..845257cf1e
--- /dev/null
+++ b/benchmark/file_join.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  two_strings: File.join(__FILE__, "path")
+  many_strings: File.join(__FILE__, "path", "a", "b", "c", "d")
+  array: File.join([__FILE__, "path", "a", "b", "c", "d"])
+  mixed: File.join(__FILE__, "path", "a", "b", ["c", "d"])
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+  File.rename(a, b)
+  File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  to_f: |
+    flo.to_f
+  abs: |
+    flo.abs
+  magnitude: |
+    flo.magnitude
+  -@: |
+    -flo
+  zero?: |
+    flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  negative?: |
+    flo.negative?
+  positive?: |
+    flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_predicate.yml b/benchmark/float_predicate.yml
new file mode 100644
index 0000000000..b946937666
--- /dev/null
+++ b/benchmark/float_predicate.yml
@@ -0,0 +1,12 @@
+prelude: |
+  floats = [1.0, -1.0, 0.0, Float::NAN, Float::INFINITY, -Float::INFINITY]
+
+benchmark:
+  float_nan?: floats.each { |f| f.nan? }
+  float_finite?: floats.each { |f| f.finite? }
+  float_infinite?: floats.each { |f| f.infinite? }
+  float_zero?: floats.each { |f| f.zero? }
+  float_positive?: floats.each { |f| f.positive? }
+  float_negative?: floats.each { |f| f.negative? }
+
+loop_count: 1000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+  floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+  to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..275f58b924
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..83347cdd20
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..23d0b91c6c
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,57 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = false
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+  GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+  load script
+}
+
+gc_time = 0
+
+if $gcprof
+  gc_time = GC::Profiler.total_time
+  GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+  GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+  puts
+  puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts "         (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+  h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+  ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+  h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..8ebdff7d1d
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../app_pentomino'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+  dir = File.join(d, 'rdocbench')
+  args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+  args << '--op' << dir
+
+  r = RDoc::RDoc.new
+  r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+  class Node
+    attr_accessor :color
+    attr_accessor :key
+    attr_accessor :left
+    attr_accessor :right
+    attr_accessor :parent
+
+    RED = :red
+    BLACK = :black
+    COLORS = [RED, BLACK].freeze
+
+    def initialize(key, color = RED)
+      raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+      @color = color
+      @key = key
+      @left = @right = @parent = NilNode.instance
+    end
+
+    def black?
+      return color == BLACK
+    end
+
+    def red?
+      return color == RED
+    end
+  end
+
+  class NilNode < Node
+    class << self
+      private :new
+
+      # it's not thread safe
+      def instance
+        @instance ||= begin
+          def instance
+            return @instance
+          end
+
+          new
+        end
+      end
+    end
+
+    def initialize
+      self.color = BLACK
+      self.key = 0
+      self.left = nil
+      self.right = nil
+      self.parent = nil
+    end
+
+    def nil?
+      return true
+    end
+  end
+
+  include Enumerable
+
+  attr_accessor :root
+  attr_accessor :size
+
+  def initialize
+    self.root = NilNode.instance
+    self.size = 0
+  end
+
+  def add(key)
+    insert(Node.new(key))
+  end
+
+  def insert(x)
+    insert_helper(x)
+
+    x.color = Node::RED
+    while x != root && x.parent.color == Node::RED
+      if x.parent == x.parent.parent.left
+        y = x.parent.parent.right
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.right
+            x = x.parent
+            left_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          right_rotate(x.parent.parent)
+        end
+      else
+        y = x.parent.parent.left
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.left
+            x = x.parent
+            right_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          left_rotate(x.parent.parent)
+        end
+      end
+    end
+    root.color = Node::BLACK
+  end
+
+  alias << insert
+
+  def delete(z)
+    y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+    x = y.left.nil? ? y.right : y.left
+    x.parent = y.parent
+
+    if y.parent.nil?
+      self.root = x
+    else
+      if y == y.parent.left
+        y.parent.left = x
+      else
+        y.parent.right = x
+      end
+    end
+
+    z.key = y.key if y != z
+
+    if y.color == Node::BLACK
+      delete_fixup(x)
+    end
+
+    self.size -= 1
+    return y
+  end
+
+  def minimum(x = root)
+    while !x.left.nil?
+      x = x.left
+    end
+    return x
+  end
+
+  def maximum(x = root)
+    while !x.right.nil?
+      x = x.right
+    end
+    return x
+  end
+
+  def successor(x)
+    if !x.right.nil?
+      return minimum(x.right)
+    end
+    y = x.parent
+    while !y.nil? && x == y.right
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def predecessor(x)
+    if !x.left.nil?
+      return maximum(x.left)
+    end
+    y = x.parent
+    while !y.nil? && x == y.left
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def inorder_walk(x = root)
+    x = self.minimum
+    while !x.nil?
+      yield x.key
+      x = successor(x)
+    end
+  end
+
+  alias each inorder_walk
+
+  def reverse_inorder_walk(x = root)
+    x = self.maximum
+    while !x.nil?
+      yield x.key
+      x = predecessor(x)
+    end
+  end
+
+  alias reverse_each reverse_inorder_walk
+
+  def search(key, x = root)
+    while !x.nil? && x.key != key
+      key < x.key ? x = x.left : x = x.right
+    end
+    return x
+  end
+
+  def empty?
+    return self.root.nil?
+  end
+
+  def black_height(x = root)
+    height = 0
+    while !x.nil?
+      x = x.left
+      height +=1 if x.nil? || x.black?
+    end
+    return height
+  end
+
+private
+
+  def left_rotate(x)
+    raise "x.right is nil!" if x.right.nil?
+    y = x.right
+    x.right = y.left
+    y.left.parent = x if !y.left.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.left = x
+    x.parent = y
+  end
+
+  def right_rotate(x)
+    raise "x.left is nil!" if x.left.nil?
+    y = x.left
+    x.left = y.right
+    y.right.parent = x if !y.right.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.right = x
+    x.parent = y
+  end
+
+  def insert_helper(z)
+    y = NilNode.instance
+    x = root
+    while !x.nil?
+      y = x
+      z.key < x.key ? x = x.left : x = x.right
+    end
+    z.parent = y
+    if y.nil?
+      self.root = z
+    else
+      z.key < y.key ? y.left = z : y.right = z
+    end
+    self.size += 1
+  end
+
+  def delete_fixup(x)
+    while x != root && x.color == Node::BLACK
+      if x == x.parent.left
+        w = x.parent.right
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          left_rotate(x.parent)
+          w = x.parent.right
+        end
+        if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.right.color == Node::BLACK
+            w.left.color = Node::BLACK
+            w.color = Node::RED
+            right_rotate(w)
+            w = x.parent.right
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.right.color = Node::BLACK
+          left_rotate(x.parent)
+          x = root
+        end
+      else
+        w = x.parent.left
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          right_rotate(x.parent)
+          w = x.parent.left
+        end
+        if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.left.color == Node::BLACK
+            w.right.color = Node::BLACK
+            w.color = Node::RED
+            left_rotate(w)
+            w = x.parent.left
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.left.color = Node::BLACK
+          right_rotate(x.parent)
+          x = root
+        end
+      end
+    end
+    x.color = Node::BLACK
+  end
+end
+
+def rbt_bm
+  n = 100_000
+  a1 = []; n.times { a1 << rand(999_999) }
+  a2 = []; n.times { a2 << rand(999_999) }
+
+  start = Time.now
+
+  tree = RedBlackTree.new
+
+  n.times {|i| tree.add(i) }
+  n.times { tree.delete(tree.root) }
+
+  tree = RedBlackTree.new
+  a1.each {|e| tree.add(e) }
+  a2.each {|e| tree.search(e) }
+  tree.inorder_walk {|key| key + 1 }
+  tree.reverse_inorder_walk {|key| key + 1 }
+  n.times { tree.minimum }
+  n.times { tree.maximum }
+
+  return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+  # puts rbt_bm.to_f
+  rbt_bm.to_f
+  # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+  attr_reader :next_ring
+  def initialize n = nil
+    @next_ring = n
+  end
+
+
+  def size
+    s = 1
+    ring = self
+    while ring.next_ring
+      s += 1
+      ring = ring.next_ring
+    end
+    s
+  end
+end
+
+ring = Ring.new
+
+max.times{
+  ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
new file mode 100644
index 0000000000..ed8142bcf1
--- /dev/null
+++ b/benchmark/hash_aref_str_lit.yml
@@ -0,0 +1,20 @@
+prelude: |
+  # frozen_string_literal: true
+  hash = 10.times.to_h do |i|
+    [i, i]
+  end
+  dyn_sym = "dynamic_symbol".to_sym
+  binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
+  iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
+
+  hash[:some_symbol] = 1
+  hash[dyn_sym] = 2
+  hash["small"] = 3
+  hash["frozen_string_literal"] = 4
+  hash[iseq_literal_string] = 5
+benchmark:
+  symbol: hash[:some_symbol]
+  dyn_symbol: hash[dyn_sym]
+  small_lit: hash["small"]
+  frozen_lit: hash["frozen_string_literal"]
+  iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned  others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+  h = Hash.new { :foo }
+benchmark:
+  default_aref: h[1]
+  default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+  small_hash = { a: 1 }
+  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+  dup_small: small_hash.dup
+  dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+  hash1 = 1_000_000.times.to_h { [rand, true]}
+  hash2 = hash1.dup
+  hash2.keys[1..100_000].each { hash2.delete _1 }
+  hash2.delete hash2.first[0]
+
+benchmark:
+  hash1: hash1.first
+  hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+1000.times do
+  h.flatten
+end
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
new file mode 100644
index 0000000000..cab4cf9ca4
--- /dev/null
+++ b/benchmark/hash_key.yml
@@ -0,0 +1,5 @@
+prelude: |
+  obj = Object.new
+  hash = { obj => true }
+benchmark: hash.key?(obj)
+loop_count: 30000000
diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.keys
+end
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
new file mode 100644
index 0000000000..9d8e34187f
--- /dev/null
+++ b/benchmark/hash_new.yml
@@ -0,0 +1,16 @@
+prelude: |
+  has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
+  strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
+  strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
+benchmark:
+  new: Hash.new
+  new_with_capa_1k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
+    strings_1k.each do |x|
+      h[x] = true
+    end
+  new_with_capa_100k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
+    strings_100k.each do |x|
+      h[x] = true
+    end
diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+50000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.values
+end
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/int_to_s.yml b/benchmark/int_to_s.yml
new file mode 100644
index 0000000000..000dae9612
--- /dev/null
+++ b/benchmark/int_to_s.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  N1   = 5
+  N2   = 42
+  N3   = 400
+  N5   = 12345
+  N10  = 1_234_567_890
+  N19  = 4_611_686_018_427_387_903
+  NEG  = -1_234_567_890
+  BIG20  = 10 ** 19 + 12_345_678_901_234_567
+  BIG40  = 10 ** 39 + 123_456_789_012_345
+  BIG100 = 10 ** 99 + 42
+benchmark:
+  fix_1digit:   "N1.to_s"
+  fix_2digit:   "N2.to_s"
+  fix_3digit:   "N3.to_s"
+  fix_5digit:   "N5.to_s"
+  fix_10digit:  "N10.to_s"
+  fix_19digit:  "N19.to_s"
+  fix_negative: "NEG.to_s"
+  big_20digit:  "BIG20.to_s"
+  big_40digit:  "BIG40.to_s"
+  big_100digit: "BIG100.to_s"
+  interp_id:    '"id=#{N10}"'
+  interp_mixed: '"a=#{N2},b=#{N5},c=#{N10}"'
diff --git a/benchmark/integer_predicate.yml b/benchmark/integer_predicate.yml
new file mode 100644
index 0000000000..7c05ff2587
--- /dev/null
+++ b/benchmark/integer_predicate.yml
@@ -0,0 +1,9 @@
+prelude: |
+  nums = (0..9).to_a
+
+benchmark:
+  integer_zero?: nums.each { |n| n.zero? }
+  integer_even?: nums.each { |n| n.even? }
+  integer_odd?: nums.each { |n| n.odd? }
+
+loop_count: 1000000
diff --git a/benchmark/io_close.yml b/benchmark/io_close.yml
new file mode 100644
index 0000000000..a552872884
--- /dev/null
+++ b/benchmark/io_close.yml
@@ -0,0 +1,13 @@
+prelude: |
+  ios = 1000.times.map do
+    100.times.map{IO.pipe}
+  end
+benchmark:
+  # Close IO
+  io_close: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 100
diff --git a/benchmark/io_close_contended.yml b/benchmark/io_close_contended.yml
new file mode 100644
index 0000000000..1d9e4e0d0f
--- /dev/null
+++ b/benchmark/io_close_contended.yml
@@ -0,0 +1,21 @@
+prelude: |
+  ios = 100.times.map do
+    10.times.map do
+      pipe = IO.pipe.tap do |r, w|
+        Thread.new do
+          r.read
+        rescue IOError
+          # Ignore
+        end
+      end
+    end
+  end
+benchmark:
+  # Close IO
+  io_close_contended: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 10
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  src = Zero.new
+  dst = File.open(IO::NULL, 'wb')
+  n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+  # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  require 'socket'
+  src = Zero.new
+  rd, wr = UNIXSocket.pair
+  pid = fork do
+    wr.close
+    buf = String.new
+    while rd.read(16384, buf)
+    end
+  end
+  rd.close
+  IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+  # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+  wr.close if wr
+  Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, noex)
+    r.read_nonblock(1, buf, noex)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+  i += 1
+  w.write(src)
+  r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+  while i.read(1024)
+  end
+end
+
+100.times do
+  o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'irb/color'
+  code = <<~'CODE'
+    def self.foo # bar
+      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+    end
+  CODE
+benchmark:
+  irb_color_complete: |
+    IRB::Color.colorize_code(code, complete: true)
+  irb_color_incomplete: |
+    IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'rbconfig'
+  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+  irb_exec: |
+    IO.popen(irb_f, 'w') do |io|
+      io.write('exit')
+    end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+  define_method = RubyVM::InstructionSequence.compile(%{
+    def foo; end
+    def bar; end
+    def baz; end
+    def egg; end
+    def spam; end
+  }).to_binary
+
+  all = RubyVM::InstructionSequence.compile(%{
+    module Foo; def foo; :foo; end; end
+    module Bar; def bar; :bar; end; end
+    module Baz; def baz; :baz; end; end
+    class Egg; def egg; :egg; end; end
+    class Spaml; def spam; :spam; end; end
+  }).to_binary
+
+benchmark:
+  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+  all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class Embedded
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+    end
+  end
+
+  class Extended
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+      @d = 1
+      @e = 1
+      @f = 1
+    end
+  end
+benchmark:
+  embedded: Embedded.new
+  extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+  clone: "object.clone"
+  clone_true: "object.clone(freeze: true)"
+  clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+  float: "Float(42)"
+  float_true: "Float(42, exception: true)"
+  float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+  x = nil
+benchmark:
+  kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+  kernel_then: 1.then { |i| i + 1 }
+  kernel_then_enum: 1.then
+  kernel_yield_self: 1.yield_self { |i| i + 1 }
+  kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+  h = {a: 1}
+  def kw(a: 1) a end
+  def kws(**kw) kw end
+benchmark:
+  kw_to_kw: "kw(a: 1)"
+  kw_splat_to_kw: "kw(**h)"
+  kw_to_kw_splat: "kws(a: 1)"
+  kw_splat_to_kw_splat: "kws(**h)"
+  kw_and_splat_to_kw: "kw(a: 1, **h)"
+  kw_splats_to_kw: "kw(**h, **h)"
+  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+  def initialize(*)
+    super
+    @stdout = $stdout
+    @strio  = StringIO.new
+    $stdout = IOMultiplexer.new(@stdout, @strio)
+  end
+
+  def with_benchmark(*)
+    super
+  ensure
+    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+    puts "\nLog file: #{logfile}"
+
+    $stdout = @stdout
+    File.write(logfile, @strio.tap(&:rewind).read)
+  end
+
+  class IOMultiplexer
+    def initialize(io1, io2)
+      @io1 = io1
+      @io2 = io2
+    end
+
+    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+      define_method(method) do |*args|
+        @io1.send(method, *args)
+        @io2.send(method, *args)
+      end
+    end
+  end
+  private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cstime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cutime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      jobs = jobs.map do |job|
+        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+      end
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => value }, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render) do |path|
+        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+        if $?.success?
+          Integer(f.read)
+        else
+          $stdout.print(output)
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def target
+    'peak'
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def metric
+    METRIC
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    def render
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+  key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+  key = ms.respond_to?(:rss) ? :rss : :size
+else
+  raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      end
+
+      if times > 1
+        <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+        RUBY
+      else
+        content
+      end
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..fd9c2dd4db
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob) do
+    attr_accessor :ractor
+  end
+
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+    def parse(ractor: 1, **kwargs)
+      super(**kwargs).each do |job|
+        job.ractor = ractor
+      end
+    end
+  })
+
+  private
+
+  unless private_instance_methods.include?(:run_benchmark)
+    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+  end
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    results = job.ractor.times.map do
+      Tempfile.open('benchmark_driver_result')
+    end
+    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+      success = execute(*context.executable.command, path, exception: false)
+      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+        value
+      else
+        BenchmarkDriver::Result::ERROR
+      end
+    end
+    results.each(&:close)
+
+    value_duration(
+      loop_count: job.loop_count,
+      duration: duration,
+    )
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(results:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+  __bmdv_loop_before = 0
+  __bmdv_loop_after = 0
+else
+  __bmdv_loop_before = Time.new
+  #{while_loop('', loop_count, id: 0)}
+  __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+  __bmdv_time = Time
+  __bmdv_script_before = __bmdv_time.new
+  #{while_loop(script, loop_count, id: 1)}
+  __bmdv_script_after = __bmdv_time.new
+
+  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:value)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+      RUBY
+    end
+
+    private
+
+    # id is to prevent:
+    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+    def while_loop(content, times, id:)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+  #{content}
+  __bmdv_i#{id} += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Peak#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Peak#target
+  def target
+    'size'
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :stime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      raise 'missing loop_count is not supported in Ruby repository'
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render(result: f.path, target: target)) do |path|
+        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+        if $?.success?
+          Float(f.read)
+        else
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # This method is overridden by some subclasses
+  def metric
+    METRIC
+  end
+
+  # This method is overridden by some subclasses
+  def target
+    :total
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(result:, target:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+  #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :utime
+  end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+#   1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+  x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+  x.report %q{
+    h = {a: 1, b: 2, c: 3, d: 4}
+  }
+}
+=end
+#
+#  2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
new file mode 100644
index 0000000000..1c757185a8
--- /dev/null
+++ b/benchmark/loop_each.yml
@@ -0,0 +1,4 @@
+prelude: |
+  arr = [nil] * 30_000_000
+benchmark:
+  loop_each: arr.each{|e|}
diff --git a/benchmark/loop_for.rb b/benchmark/loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
new file mode 100644
index 0000000000..6a3194b670
--- /dev/null
+++ b/benchmark/loop_generator.rb
@@ -0,0 +1,14 @@
+max = 6000000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/loop_times.rb b/benchmark/loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
new file mode 100644
index 0000000000..f9343ba897
--- /dev/null
+++ b/benchmark/loop_times_megamorphic.yml
@@ -0,0 +1,7 @@
+prelude: |
+  eval(<<~EOS)
+    def loop_times_megamorphic
+      #{"1.times {|i|};" * 1000}
+    end
+  EOS
+benchmark: loop_times_megamorphic
diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+end
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+  i += 1
+end
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+  @a = :a
+  @b = :b
+  @c = :c
+end
+100000.times do
+  a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+  smallint_array = 1000.times.map { |x| x }
+  bigint32_array = 1000.times.map { |x| x + 2**32 }
+  bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+  smallint_dump = Marshal.dump(smallint_array)
+  bigint32_dump = Marshal.dump(bigint32_array)
+  bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+  marshal_dump_integer_small: |
+    Marshal.dump(smallint_array)
+  marshal_dump_integer_over_32_bit: |
+    Marshal.dump(bigint32_array)
+  marshal_dump_integer_over_64_bit: |
+    Marshal.dump(bigint64_array)
+  marshal_load_integer_small: |
+    Marshal.load(smallint_dump)
+  marshal_load_integer_over_32_bit: |
+    Marshal.load(bigint32_dump)
+  marshal_load_integer_over_64_bit: |
+    Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+  a = [nil] * 3
+  b = Class.new{attr_writer :a, :b, :c}.new
+  c = d = e = f = g = h = i = nil
+benchmark:
+  array2_2: "c = (a[0], a[1] = 1, 2)"
+  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+  attr2_2: "c = (b.a, b.b = 1, 2)"
+  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+  lvar2_2: "c = (d, e = 1, 2)"
+  lvar2_3: "c = (d, e = 1, 2, 3)"
+  lvar3_2: "c = (d, e, f = 1, 2)"
+  lvar3_3: "c = (d, e, f = 1, 2, 3)"
+  array2_2p: "(a[0], a[1] = 1, 2; nil)"
+  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+  attr2_2p: "(b.a, b.b = 1, 2; nil)"
+  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+  lvar2_2p: "(d, e = 1, 2; nil)"
+  lvar2_3p: "(d, e = 1, 2, 3; nil)"
+  lvar3_2p: "(d, e, f = 1, 2; nil)"
+  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+  array2_2lv: "c = (a[0], a[1] = g, h)"
+  array2_ilv: "c = (a[0], a[1] = g, h, i)"
+  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+  attr2_2lv: "c = (b.a, b.b = g, h)"
+  attr2_ilv: "c = (b.a, b.b = g, h, i)"
+  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+  lvar2_2lv: "c = (d, e = g, h)"
+  lvar2_ilv: "c = (d, e = g, h, i)"
+  lvari_2lv: "c = (d, e, f = g, h)"
+  lvari_ilv: "c = (d, e, f = g, h, i)"
+  array2_2plv: "(a[0], a[1] = g, h; nil)"
+  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+  attr2_2plv: "(b.a, b.b = g, h; nil)"
+  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+  lvar2_2plv: "(d, e = g, h; nil)"
+  lvar2_iplv: "(d, e = g, h, i; nil)"
+  lvari_2plv: "(d, e, f = g, h; nil)"
+  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+  named_module = Kernel
+
+  module FakeName
+    def self.name
+      "NotMyame".freeze
+    end
+  end
+
+  MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+  fastpath: MOD_NAME.bind_call(Kernel)
+  slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..2f9c490d92
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,32 @@
+prelude: |
+  module SomeModule; end
+  class SimpleClass; end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+  class HugeClass
+    300.times { include Module.new }
+  end
+  SimpleObj = SimpleClass.new
+  MediumObj = MediumClass.new
+  LargeObj = LargeClass.new
+  HugeObj = HugeClass.new
+benchmark:
+  simple_class_eqq_simple_obj: |
+    SimpleClass === SimpleObj
+  medium_class_eqq_simple_obj: |
+    MediumClass === SimpleObj
+  simple_class_eqq_medium_obj: |
+    SimpleClass === MediumObj
+  simple_class_eqq_large_obj: |
+    SimpleClass === LargeObj
+  simple_class_eqq_huge_obj: |
+    SimpleClass === HugeObj
+  simple_class_eqq_module: |
+    SimpleClass === HugeObj
+  module_eqq_module: |
+    SomeModule === HugeObj
+loop_count: 10000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+  class Niller; def nil?; true; end; end
+  xnil, notnil = nil, Object.new
+  niller = Niller.new
+benchmark:
+  - xnil.nil?
+  - notnil.nil?
+  - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..66234c4cdf
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def a = nil
+benchmark:
+  rationalize:
+    nil.rationalize
+  to_c: |
+    nil.to_c
+  to_i: |
+    nil.to_i
+  to_f: |
+    nil.to_f
+  to_r: |
+    nil.to_r
+  splat: |
+    a(*nil)
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+  - 0.zero?
+  - 1.zero?
+  - 0r.zero?
+  - 1r.zero?
+  - 0i.zero?
+  - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+  int = 42
+  flo = 4.2
+benchmark:
+  real?: |
+    int.real?
+  integer?: |
+    flo.integer?
+  finite?: |
+    int.finite?
+  infinite?: |
+    int.infinite?
+  integer_real: |
+    int.real
+  float_real: |
+    flo.real
+  integr_imag: |
+    int.imag
+  float_imag: |
+    flo.imag
+  integer_conj: |
+    int.conj
+  float_conj: |
+    flo.conj
+  integer_numerator: |
+    int.numerator
+  integer_denominator: |
+    int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..c6269923f0
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,49 @@
+prelude: |
+  class Eight
+    8.times { include(Module.new) }
+  end
+  class ThirtyTwo
+    32.times { include(Module.new) }
+  end
+  class SixtyFour
+    64.times { include(Module.new) }
+  end
+  class OneTwentyEight
+    128.times { include(Module.new) }
+  end
+  class OnePositional
+    def initialize a; end
+  end
+  class TwoPositional
+    def initialize a, b; end
+  end
+  class ThreePositional
+    def initialize a, b, c; end
+  end
+  class FourPositional
+    def initialize a, b, c, d; end
+  end
+  class KWArg
+    def initialize a:, b:, c:, d:
+    end
+  end
+  class Mixed
+    def initialize a, b, c:, d:
+    end
+  end
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  allocate_8_deep: Eight.new
+  allocate_32_deep: ThirtyTwo.new
+  allocate_64_deep: SixtyFour.new
+  allocate_128_deep: OneTwentyEight.new
+  allocate_1_positional_params: OnePositional.new(1)
+  allocate_2_positional_params: TwoPositional.new(1, 2)
+  allocate_3_positional_params: ThreePositional.new(1, 2, 3)
+  allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
+  allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
+  allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
+  allocate_no_params: "Object.new"
+  allocate_allocate: "Object.allocate"
+loop_count: 100000
diff --git a/benchmark/object_class.yml b/benchmark/object_class.yml
new file mode 100644
index 0000000000..1e5409d1e2
--- /dev/null
+++ b/benchmark/object_class.yml
@@ -0,0 +1,40 @@
+prelude: |
+  def get_class(obj)
+    i = 10_000
+    while i > 0
+      i -= 1
+      # 100 times per loop
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+    end
+  end
+
+  class Obj
+  end
+  obj = Obj.new
+
+  singleton = Obj.new
+  def singleton.bar
+  end
+
+  extended = Obj.new
+  2.times do
+    extended.extend Module.new
+  end
+
+  immediate = 1.4
+benchmark:
+  obj: get_class(obj)
+  extended: get_class(extended)
+  singleton: get_class(singleton)
+  immediate: get_class(immediate)
+loop_count: 1000
diff --git a/benchmark/object_id.yml b/benchmark/object_id.yml
new file mode 100644
index 0000000000..2bd52b923f
--- /dev/null
+++ b/benchmark/object_id.yml
@@ -0,0 +1,4 @@
+benchmark:
+  baseline: "Object.new"
+  object_id: "Object.new.object_id"
+# loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'objspace'
+  require 'tempfile'
+  $objs = 1_000.times.map { Object.new }
+  $strings = 1_000.times.map { |i| "string #{i}" }
+  $file = Tempfile.new('heap')
+  $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+  dump_all_string: "ObjectSpace.dump_all(output: :string)"
+  dump_all_file: "ObjectSpace.dump_all(output: $file)"
+  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+		    : Ack($_[0]-1, 1))
+	: $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+    if (not M):
+        return( N + 1 )
+    if (not N):
+        return( Ack(M-1, 1) )
+    return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+    NUM = 9
+    sys.setrecursionlimit(10000)
+    Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+  (cond ((zero? m) (+ n 1))
+	((zero? n) (ack (- m 1) 1))
+	(else      (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+  loop
+  ack
+  fib
+  tak
+  fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+  ruby-cyg
+  ../../../test6/miniruby
+  perl
+  python
+  gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+  .rb
+  .rb
+  .pl
+  .py
+  .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+  m = Benchmark.measure{
+    #p cmd
+    system(cmd)
+  }
+  [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+  r = []
+  Lang.each_with_index{|l, idx|
+    cmd = "#{l} #{b}#{Ext[idx]}"
+    r << bench(cmd)
+  }
+  Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+  my $n = @_[0];
+  if($n < 2){
+    return 1;
+  }
+  else{
+    return $n * fact($n-1);
+  }
+}
+
+for($i=0; $i<10000; $i++){
+  &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..1ce9f76275
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+	r = 1
+	for x in range(2, n+1):
+		r *= x
+	return r
+
+def factR(n):
+	if n < 2:
+		return 1
+	else:
+		return n * factR(n-1)
+
+for i in range(10000):
+	factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..6cedc752cd
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+  if n < 2
+    1
+  else
+    n * fact(n-1)
+  end
+end
+
+i = 0
+while i<10000
+  i += 1
+  fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+        (if (< n 2)
+            1
+          (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+  (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+  my $n = $_[0];
+  if($n < 3){
+    return 1;
+  }
+  else{
+    return fib($n-1) + fib($n-2);
+  }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+  if n < 3:
+    return 1
+  else:
+    return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+        (if (< n 3)
+            1
+          (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+	pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..b367b9dbf3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30000000
+  i += 1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+    local($x, $y, $z) = @_;
+    if (!($y < $x)) {
+	return $z;
+    } else {
+	return &tak(&tak($x - 1, $y, $z),
+		    &tak($y - 1, $z, $x),
+		    &tak($z - 1, $x, $y));
+    }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+	if not(y<x):
+		return z
+	else:
+		return tak(tak(x-1, y, z),
+		           tak(y-1, z, x),
+		           tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+        (if (not (< y x))
+            z
+          (tak (tak (- x 1) y z)
+               (tak (- y 1) z x)
+               (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/pathname.yml b/benchmark/pathname.yml
new file mode 100644
index 0000000000..bcf3011eab
--- /dev/null
+++ b/benchmark/pathname.yml
@@ -0,0 +1,15 @@
+prelude: |
+  abs = Pathname("/a")
+  rel = Pathname("a")
+  p1 = Pathname.new('foo/././././bar')
+  p2 = Pathname.new('foo/bar/./../..')
+  p3 = Pathname.new('foo/bar/zot')
+benchmark:
+  p1+p2: p1+p2
+  abs.root?: abs.root?
+  rel.root?: rel.root?
+  abs.absolute?: abs.absolute?
+  rel.absolute?: rel.absolute?
+  p1.cleanpath: p1.cleanpath
+  p2.cleanpath: p2.cleanpath
+  relative_path_from: p3.relative_path_from('foo/bar/qux/quax')
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def call(*val)
+    case val
+      in [String => body]
+        [200, {}, [body]]
+      in [Integer => status]
+        [status, {}, [""]]
+      in [Integer, String] => response
+        [response[0], {}, [response[1]]]
+      in [Integer, Hash, String] => response
+        [response[0], response[1], [response[2]]]
+    end
+  end
+
+benchmark:
+  first_match: call("ok")
+  second_match: call(401)
+  third_match: call(200, "ok")
+  fourth_match: call(201, {}, "created")
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+  FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+  ractor_float_to_s: |
+    FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/ractor_string_fstring.yml b/benchmark/ractor_string_fstring.yml
new file mode 100644
index 0000000000..14b92d8fd8
--- /dev/null
+++ b/benchmark/ractor_string_fstring.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  ractor_fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -str
+      i += 1
+    end
+loop_count: 1
+ractor: 4
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
new file mode 100644
index 0000000000..5730c93fcf
--- /dev/null
+++ b/benchmark/range_bsearch_bignum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 2**100
+  last = 2**1000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
new file mode 100644
index 0000000000..8d7bedb662
--- /dev/null
+++ b/benchmark/range_bsearch_endpointless.yml
@@ -0,0 +1,21 @@
+prelude: |
+  re = (1..)
+  rb = (..0)
+
+benchmark:
+  'endless 10**0': re.bsearch { |x| x >= 1 }
+  'endless 10**1': re.bsearch { |x| x >= 10 }
+  'endless 10**2': re.bsearch { |x| x >= 100 }
+  'endless 10**3': re.bsearch { |x| x >= 1000 }
+  'endless 10**4': re.bsearch { |x| x >= 10000 }
+  'endless 10**5': re.bsearch { |x| x >= 100000 }
+  'endless 10**10': re.bsearch { |x| x >= 10000000000 }
+  'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
+  'beginless -10**0': rb.bsearch { |x| x >= -1 }
+  'beginless -10**1': rb.bsearch { |x| x >= -10 }
+  'beginless -10**2': rb.bsearch { |x| x >= -100 }
+  'beginless -10**3': rb.bsearch { |x| x >= -1000 }
+  'beginless -10**4': rb.bsearch { |x| x >= -10000 }
+  'beginless -10**5': rb.bsearch { |x| x >= -100000 }
+  'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
+  'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
new file mode 100644
index 0000000000..59416531b9
--- /dev/null
+++ b/benchmark/range_bsearch_fixnum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 1
+  last = 10000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
new file mode 100644
index 0000000000..58f53a0236
--- /dev/null
+++ b/benchmark/range_count.yml
@@ -0,0 +1,11 @@
+prelude: |
+  r_1 = 1..1
+  r_1k = 1..1000
+  r_1m = 1..1000000
+  r_str = 'a'..'z'
+
+benchmark:
+  'int 1': r_1.count
+  'int 1K': r_1k.count
+  'int 1M': r_1m.count
+  string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - (1..1_000_000).last(100)
+  - (1..1_000_000).last(1000)
+  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+  - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
new file mode 100644
index 0000000000..700a00053c
--- /dev/null
+++ b/benchmark/range_overlap.yml
@@ -0,0 +1,19 @@
+prelude: |
+  class Range
+    unless method_defined?(:overlap?)
+      def overlap?(other)
+        other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
+      end
+    end
+  end
+
+benchmark:
+  - (2..3).overlap?(1..1)
+  - (2..3).overlap?(2..4)
+  - (2..3).overlap?(4..5)
+  - (2..3).overlap?(2..1)
+  - (2..3).overlap?(0..1)
+  - (2..3).overlap?(...1)
+  - (2...3).overlap?(..2)
+  - (2...3).overlap?(3...)
+  - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
new file mode 100644
index 0000000000..a32efeccc6
--- /dev/null
+++ b/benchmark/range_reverse_each.yml
@@ -0,0 +1,16 @@
+prelude: |
+  rf_1 = 0..1
+  rf_1k = 0..1000
+  rf_1m = 0..1000000
+  big = 2**1000
+  rb_1 = big..big+1
+  rb_1k = big..big+1000
+  rb_1m = big..big+1000000
+
+benchmark:
+  "Fixnum 1": rf_1.reverse_each { _1 }
+  "Fixnum 1K": rf_1k.reverse_each { _1 }
+  "Fixnum 1M": rf_1m.reverse_each { _1 }
+  "Bignum 1": rb_1.reverse_each { _1 }
+  "Bignum 1K": rb_1k.reverse_each { _1 }
+  "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..6b6a4836b0
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,33 @@
+prelude: |
+  f = File
+  pwd = Dir.pwd
+  Dir.mkdir('b') unless f.directory?('b')
+  f.write('b/a', '') unless f.file?('b/a')
+
+  relative = 'b/a'
+  absolute = File.join(pwd, relative)
+  dir = 'b'
+  file = 'a'
+
+  relative_dir = 'b/c'
+  absolute_dir = File.join(pwd, relative_dir)
+  file_dir = 'c'
+teardown: |
+  require 'fileutils'
+  FileUtils.rm_rf('b')
+benchmark:
+  relative_nil: "f.realpath(relative, nil)"
+  absolute_nil: "f.realpath(absolute, nil)"
+  relative_relative: "f.realpath(file, dir)"
+  absolute_relative: "f.realpath(absolute, dir)"
+  relative_absolute: "f.realpath(relative, pwd)"
+  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+  relative_relative_dir: "f.realdirpath(file_dir, dir)"
+  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
new file mode 100644
index 0000000000..52f89991cd
--- /dev/null
+++ b/benchmark/regexp_dup.yml
@@ -0,0 +1,6 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
new file mode 100644
index 0000000000..bc9ab3ca21
--- /dev/null
+++ b/benchmark/regexp_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  string: Regexp.new(str)
+  regexp: Regexp.new(re)
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    1.upto(10000) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require_thread: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    i=0
+    t = Thread.new do
+      while true
+        i = i+1 # dummy loop
+      end
+    end
+
+    1.upto(100) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+    t.kill
+loop_count: 1
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
new file mode 100644
index 0000000000..62ad1d6862
--- /dev/null
+++ b/benchmark/scan.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "test"
+  reg = /test/
+benchmark:
+  check(reg): |
+    scanner.check(reg)
+  check(str): |
+    scanner.check(str)
+  match?(reg): |
+    scanner.match?(reg)
+  match?(str): |
+    scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
new file mode 100644
index 0000000000..42a50c90e6
--- /dev/null
+++ b/benchmark/search.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "string"
+  reg = /string/
+benchmark:
+  check_until(reg): |
+    scanner.check_until(reg)
+  check_until(str): |
+    scanner.check_until(str)
+  exist?(reg): |
+    scanner.exist?(reg)
+  exist?(str): |
+    scanner.exist?(str)
diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+  SecureRandom.random_number(100)
+end
diff --git a/benchmark/set.yml b/benchmark/set.yml
new file mode 100644
index 0000000000..061509cb1f
--- /dev/null
+++ b/benchmark/set.yml
@@ -0,0 +1,261 @@
+prelude: |
+  # First 1000 digits of pi
+  pi = <<~END.gsub(/\D/, '')
+    31415926535897932384626433832795028841971693993751058209749445923078164062862089
+    98628034825342117067982148086513282306647093844609550582231725359408128481117450
+    28410270193852110555964462294895493038196442881097566593344612847564823378678316
+    52712019091456485669234603486104543266482133936072602491412737245870066063155881
+    74881520920962829254091715364367892590360011330530548820466521384146951941511609
+    43305727036575959195309218611738193261179310511854807446237996274956735188575272
+    48912279381830119491298336733624406566430860213949463952247371907021798609437027
+    70539217176293176752384674818467669405132000568127145263560827785771342757789609
+    17363717872146844090122495343014654958537105079227968925892354201995611212902196
+    08640344181598136297747713099605187072113499999983729780499510597317328160963185
+    95024459455346908302642522308253344685035261931188171010003137838752886587533208
+    38142061717766914730359825349042875546873115956286388235378759375195778185778053
+    21712268066130019278766111959092164201989380952572010654505906988788448549
+  END
+  array1 = 10.times.flat_map do |i|
+    pi[i...].chars.each_slice(10).map(&:join)
+  end
+  array2 = array1.map(&:reverse)
+  array1.map!(&:to_i)
+  array2.map!(&:to_i)
+  a1 = array1[...10]
+  a2 = array1[...100]
+  a3 = array1
+  oa1 = array2[...10]
+  oa2 = array2[...100]
+  oa3 = array2
+  s0 = Set.new
+  s0 = Set.new
+  s1 = Set.new(a1)
+  s2 = Set.new(a2)
+  s3 = Set.new(a3)
+  o0 = Set.new
+  o1 = Set.new(array2[...10])
+  o2 = Set.new(array2[...100])
+  o3 = Set.new(array2)
+  d0 = s0.dup
+  d1 = s1.dup
+  d2 = s2.dup
+  d3 = s3.dup
+  ss1 = s1 - a1[-1..-1]
+  ss2 = s2 - a2[-1..-1]
+  ss3 = s3 - a3[-1..-1]
+  os1 = o1 - oa1[-1..-1]
+  os2 = o2 - oa2[-1..-1]
+  os3 = o3 - oa3[-1..-1]
+  member = a1.first
+  cbi = s0.dup.compare_by_identity
+  ns = Set[s3, o3, d3]
+  set_subclass = Class.new(Set)
+
+benchmark:
+  new_0: Set.new
+  new_10: Set.new(a1)
+  new_100: Set.new(a2)
+  new_1000: Set.new(a3)
+  aref_0: Set[]
+  aref_10: Set[*a1]
+  aref_100: Set[*a2]
+  aref_1000: Set[*a3]
+  amp_0: s0 & o0
+  amp_10: s1 & o1
+  amp_100: s2 & o2
+  amp_1000: s3 & o3
+  amp_same_0: s0 & d0
+  amp_same_10: s1 & d1
+  amp_same_100: s2 & d2
+  amp_same_1000: s3 & d3
+  minus_0: s0 - o0
+  minus_10: s1 - o1
+  minus_100: s2 - o2
+  minus_1000: s3 - o3
+  minus_same_0: s0 - d0
+  minus_same_10: s1 - d1
+  minus_same_100: s2 - d2
+  minus_same_1000: s3 - d3
+  spaceship_0: s0 <=> o0
+  spaceship_diff_10: s1 <=> o1
+  spaceship_diff_100: s2 <=> o2
+  spaceship_diff_1000: s2 <=> o3
+  spaceship_sub_10: s1 <=> ss1
+  spaceship_sub_100: s2 <=> ss2
+  spaceship_sub_1000: s2 <=> ss3
+  spaceship_sup_10: ss1 <=> s1
+  spaceship_sup_100: ss2 <=> s2
+  spaceship_sup_1000: ss2 <=> s3
+  eq_0: s0 == o0
+  eq_10: s1 == o1
+  eq_100: s2 == o2
+  eq_1000: s3 == o3
+  eq_same_0: s0 == d0
+  eq_same_10: s1 == d1
+  eq_same_100: s2 == d2
+  eq_same_1000: s3 == d3
+  xor_0: s0 ^ o0
+  xor_10: s1 ^ o1
+  xor_100: s2 ^ o2
+  xor_1000: s3 ^ o3
+  xor_same_0: s0 ^ d0
+  xor_same_10: s1 ^ d1
+  xor_same_100: s2 ^ d2
+  xor_same_1000: s3 ^ d3
+  pipe_0: s0 | o0
+  pipe_10: s1 | o1
+  pipe_100: s2 | o2
+  pipe_1000: s3 | o3
+  pipe_same_0: s0 | d0
+  pipe_same_10: s1 | d1
+  pipe_same_100: s2 | d2
+  pipe_same_1000: s3 | d3
+  add: a3.each { s0.add(it) }
+  add_exist: a3.each { s3.add(it) }
+  addq: a3.each { s0.add?(it) }
+  addq_exist: a3.each { s3.add?(it) }
+  classify_0: s0.classify { it }
+  classify_10: s1.classify { it & 2 }
+  classify_100: s2.classify { it & 8 }
+  classify_1000: s3.classify { it & 32 }
+  clear: s0.clear
+  collect_0: s0.collect! { it }
+  collect_10: s1.collect! { it }
+  collect_100: s2.collect! { it }
+  collect_1000: s3.collect! { it }
+  compare_by_identity_0: s0.dup.compare_by_identity
+  compare_by_identity_10: s1.dup.compare_by_identity
+  compare_by_identity_100: s2.dup.compare_by_identity
+  compare_by_identity_1000: s3.dup.compare_by_identity
+  compare_by_identityq_false: s0.compare_by_identity?
+  compare_by_identityq_true: cbi.compare_by_identity?
+  clone_0: s0.clone
+  clone_10: s1.clone
+  clone_100: s2.clone
+  clone_1000: s3.clone
+  delete: a3.each { s3.delete(it) }
+  delete_not_exist: a3.each { o3.delete(it) }
+  deleteq: a3.each { s3.delete?(it) }
+  deleteq_not_exist: a3.each { o3.delete?(it) }
+  delete_if_0: s0.delete_if { it }
+  delete_if_10: s1.delete_if { it & 2 == 0 }
+  delete_if_100: s2.delete_if { it & 2 == 0 }
+  delete_if_1000: s3.delete_if { it & 2 == 0 }
+  disjoint_0: s0.disjoint? o0
+  disjoint_10: s1.disjoint? o1
+  disjoint_100: s2.disjoint? o2
+  disjoint_1000: s3.disjoint? o3
+  disjoint_same_0: s0.disjoint? d0
+  disjoint_same_10: s1.disjoint? d1
+  disjoint_same_100: s2.disjoint? d2
+  disjoint_same_1000: s3.disjoint? d3
+  divide_1arity_0: s0.divide { true }
+  divide_1arity_10: s1.divide { it & 2 }
+  divide_1arity_100: s2.divide { it & 8 }
+  divide_1arity_1000: s3.divide { it & 32 }
+  divide_2arity_0: s0.divide { true }
+  divide_2arity_10: s1.divide { (_1 & 2) == (_2 & 2) }
+  divide_2arity_100: s2.divide { (_1 & 8) == (_2 & 8) }
+  divide_2arity_1000: s3.divide { (_1 & 32) == (_2 & 32) }
+  dup_0: s0.dup
+  dup_10: s1.dup
+  dup_100: s2.dup
+  dup_1000: s3.dup
+  each_0: s0.each { it }
+  each_10: s1.each { it }
+  each_100: s2.each { it }
+  each_1000: s3.each { it }
+  empty_true: s0.empty?
+  empty_false: s3.empty?
+  flatten: ns.flatten
+  flattenb: ns.flatten!
+  include_true_0: s0.include? member
+  include_true_10: s1.include? member
+  include_true_100: s2.include? member
+  include_true_1000: s3.include? member
+  include_false_0: s0.include?(-1)
+  include_false_10: s1.include?(-1)
+  include_false_100: s2.include?(-1)
+  include_false_1000: s3.include?(-1)
+  intersect_0: s0.intersect? o0
+  intersect_10: s1.intersect? o1
+  intersect_100: s2.intersect? o2
+  intersect_1000: s3.intersect? o3
+  intersect_same_0: s0.intersect? d0
+  intersect_same_10: s1.intersect? d1
+  intersect_same_100: s2.intersect? d2
+  intersect_same_1000: s3.intersect? d3
+  join_0: s0.join
+  join_10: s1.join
+  join_100: s2.join
+  join_1000: s3.join
+  join_arg_0: s0.join ""
+  join_arg_10: s1.join ""
+  join_arg_100: s2.join ""
+  join_arg_1000: s3.join ""
+  keep_if_0: s0.keep_if { it }
+  keep_if_10: s1.keep_if { it & 2 == 0 }
+  keep_if_100: s2.keep_if { it & 2 == 0 }
+  keep_if_1000: s3.keep_if { it & 2 == 0 }
+  merge_set: s0.dup.merge(s3, o3)
+  merge_enum: s0.dup.merge(array1, array2)
+  proper_subset_0: s0.proper_subset? s0
+  proper_subset_10: s1.proper_subset? ss1
+  proper_subset_100: s2.proper_subset? ss2
+  proper_subset_1000: s3.proper_subset? ss3
+  proper_subset_false_10: s1.proper_subset? os1
+  proper_subset_false_100: s2.proper_subset? os2
+  proper_subset_false_1000: s3.proper_subset? os3
+  proper_superset_0: s0.proper_superset? s0
+  proper_superset_10: ss1.proper_superset? s1
+  proper_superset_100: ss2.proper_superset? s2
+  proper_superset_1000: ss3.proper_superset? s3
+  proper_superset_false_10: os1.proper_superset? s1
+  proper_superset_false_100: os2.proper_superset? s2
+  proper_superset_false_1000: os3.proper_superset? s3
+  reject_0: s0.reject! { it }
+  reject_10: s1.reject! { it & 2 == 0 }
+  reject_100: s2.reject! { it & 2 == 0 }
+  reject_1000: s3.reject! { it & 2 == 0 }
+  replace_0: s = Set.new; array1.each { s.replace(s0) }
+  replace_10: s = Set.new; array1.each { s.replace(s1) }
+  replace_100: s = Set.new; array1.each { s.replace(s2) }
+  replace_1000: s = Set.new; array1.each { s.replace(s3) }
+  reset_0: s0.reset
+  reset_10: s1.reset
+  reset_100: s2.reset
+  reset_1000: s3.reset
+  select_0: s0.select! { it }
+  select_10: s1.select! { it & 2 == 0 }
+  select_100: s2.select! { it & 2 == 0 }
+  select_1000: s3.select! { it & 2 == 0 }
+  size_0: s0.size
+  size_10: s1.size
+  size_100: s2.size
+  size_1000: s3.size
+  subtract_set: s3.dup.subtract(os3)
+  subtract_enum: s3.dup.subtract(oa3)
+  subtract_same_set: s3.dup.subtract(s3)
+  subtract_same_enum: s3.dup.subtract(a3)
+  subset_0: s0.subset? s0
+  subset_10: s1.subset? ss1
+  subset_100: s2.subset? ss2
+  subset_1000: s3.subset? ss3
+  subset_false_10: s1.subset? os1
+  subset_false_100: s2.subset? os2
+  subset_false_1000: s3.subset? os3
+  superset_0: s0.superset? s0
+  superset_10: ss1.superset? s1
+  superset_100: ss2.superset? s2
+  superset_1000: ss3.superset? s3
+  superset_false_10: os1.superset? s1
+  superset_false_100: os2.superset? s2
+  superset_false_1000: os3.superset? s3
+  to_a_0: s0.to_a
+  to_a_10: s1.to_a
+  to_a_100: s2.to_a
+  to_a_1000: s3.to_a
+  to_set_0: s0.to_set
+  to_set_10: s1.to_set
+  to_set_100: s2.to_set
+  to_set_1000: s3.to_set
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+  # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..f7322a8541
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,66 @@
+prelude: |
+  #!/usr/bin/ruby
+
+  wc_input_base = <<EOS
+  Subject:      Re: Who was Izchak Miller?
+  From:         "Jane D. Anonymous" <nobody@yale.edu>
+  Date:         1996/04/28
+  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+  To:           75176.2330@compuserve.com
+  Content-Type: text/plain; charset=us-ascii
+  Organization: Yale University
+  X-Url:        news:4lk6vl$gde@ns.oar.net
+  Mime-Version: 1.0
+  Newsgroups:   rec.games.roguelike.nethack
+  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+  Hello there,  Izchak Miller was my  father.  When I was  younger I spent
+  many  a night,  hunched over  the keyboard  with a  cup of  tea, playing
+  nethack with him and my brother.  my dad was a philosopher with a strong
+  weakness for fantasy/sci fi.  I remember when he started to get involved
+  with the  Nethack team- my  brother's Dungeons and Dragons  monster book
+  found a regular place beside my dad's  desk. it's nice to see him living
+  on in the game he loved so much :-).
+                                                                    Tamar Miller
+
+  The following is a really long word of 5000 characters:
+
+  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+  EOS
+
+  # prepare 'wc.input'
+
+  def prepare_wc_input(wcbase)
+    wcinput = File.join(File.dirname($0), 'wc.input')
+    unless FileTest.exist?(wcinput)
+      data = wcbase.dup
+      13.times{
+        data << data
+      }
+      File.write(wcinput, data)
+    end
+    at_exit {File.unlink(wcinput) rescue nil}
+  end
+
+  prepare_wc_input(wc_input_base)
+
+benchmark:
+  so_count_words: |
+    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+    # http://www.bagley.org/~doug/shootout/
+    # with help from Paul Brannan
+
+    nl = nw = nc = 0
+    File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
+      while tmp = input.read(4096)
+        data = tmp << (input.gets || "")
+        nc += data.length
+        nl += data.count("\n")
+        ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+        nw += data.count(" ") + 1
+      end
+    end
+    # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_k_nucleotide
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(100_000)
+    script: |
+      # The Computer Language Shootout
+      # http://shootout.alioth.debian.org
+      #
+      # contributed by jose fco. gonzalez
+      # modified by Sokolov Yura
+
+      seq = String.new
+
+      def frecuency( seq,length )
+          n, table = seq.length - length + 1, Hash.new(0)
+          f, i = nil, nil
+          (0 ... length).each do |f|
+              (f ... n).step(length) do |i|
+                  table[seq[i,length]] += 1
+              end
+          end
+          [n,table]
+
+      end
+
+      def sort_by_freq( seq,length )
+          n,table = frecuency( seq,length )
+          a, b, v = nil, nil, nil
+          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+          end
+          puts
+      end
+
+      def find_seq( seq,s )
+          n,table = frecuency( seq,s.length )
+          puts "#{table[s].to_s}\t#{s.upcase}"
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+      line = input.gets while line !~ /^>THREE/
+      line = input.gets
+
+      while (line !~ /^>/) & line do
+          seq << line.chomp
+          line = input.gets
+      end
+
+      [1,2].each {|i| sort_by_freq( seq,i ) }
+
+      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+    loop_count: 1
diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i += 1
+  result = test_lists()
+end
+
+result
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..d8c8e3ab9c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminish over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+  def initialize(x, y, z, vx, vy, vz, mass)
+    @x, @y, @z = x, y, z
+    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+    @mass = mass * SOLAR_MASS
+  end
+
+  def move_from_i(bodies, nbodies, dt, i)
+    while i < nbodies
+      b2 = bodies[i]
+      dx = @x - b2.x
+      dy = @y - b2.y
+      dz = @z - b2.z
+
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      mag = dt / (distance * distance * distance)
+      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+      @vx -= dx * b2_mass_mag
+      @vy -= dy * b2_mass_mag
+      @vz -= dz * b2_mass_mag
+      b2.vx += dx * b_mass_mag
+      b2.vy += dy * b_mass_mag
+      b2.vz += dz * b_mass_mag
+      i += 1
+    end
+
+    @x += dt * @vx
+    @y += dt * @vy
+    @z += dt * @vz
+  end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/so_nsieve.rb b/benchmark/so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/so_partial_sums.rb b/benchmark/so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize(q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/so_random.rb b/benchmark/so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+  (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+  i +=1
+  gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_reverse_complement
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(2_500_000)
+    script: |
+      # The Great Computer Language Shootout
+      # http://shootout.alioth.debian.org/
+      #
+      # Contributed by Peter Bjarke Olsen
+      # Modified by Doug King
+
+      seq=Array.new
+
+      def revcomp(seq)
+        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+        stringlen=seq.length
+        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+      while input.gets
+        if $_ =~ />/
+          if seq.length != 0
+            revcomp(seq.join)
+            seq=Array.new
+          end
+          puts $_
+        else
+          $_.sub(/\n/,'')
+          seq.push $_
+        end
+      end
+      revcomp(seq.join)
+    loop_count: 1
diff --git a/benchmark/so_sieve.rb b/benchmark/so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+  k += 1
+  count = 0
+  flags = flags0.dup
+  i = 2
+  while i<8192
+    i += 1
+    if flags[i]
+      # remove all multiples of prime: i
+      j = i*i
+      while j < 8192
+        j += i
+        flags[j] = nil
+      end
+      count += 1
+    end
+  end
+end
+count
diff --git a/benchmark/so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+  str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  capitalize-1: str1.capitalize
+  capitalize-10: str10.capitalize
+  capitalize-100: str100.capitalize
+  capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..88a3555c8a
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,28 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp-1: lstr1.casecmp(ustr1)
+  casecmp-10: lstr10.casecmp(ustr10)
+  casecmp-100: lstr100.casecmp(ustr100)
+  casecmp-1000: lstr1000.casecmp(ustr1000)
+  casecmp-1000vs10: lstr1000.casecmp(ustr10)
+  casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+  casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+  casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+  casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
+  casecmp-nonascii1000vs10: lnonascii1000.casecmp(unonascii10)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp_p-1: lstr1.casecmp?(ustr1)
+  casecmp_p-10: lstr10.casecmp?(ustr10)
+  casecmp_p-100: lstr100.casecmp?(ustr100)
+  casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+  casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+  casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+  casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+  casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_codepoints.yml b/benchmark/string_codepoints.yml
new file mode 100644
index 0000000000..6a07db7ce1
--- /dev/null
+++ b/benchmark/string_codepoints.yml
@@ -0,0 +1,9 @@
+prelude: |
+  mixed_ascii64 = ("a" * 63 + "\u{100}") * 2048
+  mixed_ascii256 = ("a" * 255 + "\u{100}") * 512
+  utf8_2byte = "\u{100}" * 65536
+
+benchmark:
+  codepoints_mixed_ascii64: mixed_ascii64.codepoints
+  codepoints_mixed_ascii256: mixed_ascii256.codepoints
+  codepoints_utf8_2byte: utf8_2byte.codepoints
diff --git a/benchmark/string_coderange_scan.yml b/benchmark/string_coderange_scan.yml
new file mode 100644
index 0000000000..d47bbd2b30
--- /dev/null
+++ b/benchmark/string_coderange_scan.yml
@@ -0,0 +1,10 @@
+prelude: |
+  def unknown(s) = s.b.force_encoding("UTF-8")
+  multibyte   = unknown("\u{00e9}" * 16384)   # best case: every byte non-ASCII
+  alternating = unknown("\u{00e9}a" * 10922)  # worst case: non-ASCII then ASCII
+  ascii       = unknown("a" * 32768)          # baseline
+
+benchmark:
+  coderange_multibyte:   multibyte.dup.valid_encoding?
+  coderange_alternating: alternating.dup.valid_encoding?
+  coderange_ascii:       ascii.dup.valid_encoding?
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..c07fd21013
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,51 @@
+prelude: |
+  CHUNK = "a" * 64
+  UCHUNK = "é" * 32
+  SHORT = "a" * (GC.stat_heap(0, :slot_size) / 2)
+  LONG = "a" * (GC.stat_heap(0, :slot_size) * 2)
+  GC.disable # GC causes a lot of variance
+benchmark:
+  binary_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_UTF8: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+  interpolation: |
+    buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
+  interpolation_same_heap: |
+    buffer = "#{SHORT}#{SHORT}"
+  interpolation_switching_heaps: |
+    buffer = "#{SHORT}#{LONG}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  downcase-1: str1.upcase
+  downcase-10: str10.upcase
+  downcase-100: str100.upcase
+  downcase-1000: str1000.upcase
+  downcase-nonascii1: nonascii1.downcase
+  downcase-nonascii10: nonascii10.downcase
+  downcase-nonascii100: nonascii100.downcase
+  downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_dup.yml b/benchmark/string_dup.yml
new file mode 100644
index 0000000000..90793f9f2a
--- /dev/null
+++ b/benchmark/string_dup.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  uplus: |
+    +"A"
+  dup: |
+    "A".dup
diff --git a/benchmark/string_fstring.yml b/benchmark/string_fstring.yml
new file mode 100644
index 0000000000..cafef1f3fe
--- /dev/null
+++ b/benchmark/string_fstring.yml
@@ -0,0 +1,16 @@
+benchmark:
+  fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 5_000_000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 10_000_000
+      -str
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/string_gsub.yml b/benchmark/string_gsub.yml
new file mode 100644
index 0000000000..c26e1a6498
--- /dev/null
+++ b/benchmark/string_gsub.yml
@@ -0,0 +1,54 @@
+prelude: |
+  # frozen_string_literal: true
+  STR = ((("a" * 31) + "<") * 1000).freeze
+  STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze
+  ESCAPED_CHARS_BINARY = {
+    "\u2028".b => '\u2028'.b,
+    "\u2029".b => '\u2029'.b,
+    ">".b => '\u003e'.b.freeze,
+    "<".b => '\u003c'.b.freeze,
+    "&".b => '\u0026'.b.freeze,
+  }
+  BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)
+
+  ESCAPED_CHARS = {
+    "\u2028" => '\u2028',
+    "\u2029" => '\u2029',
+    ">" => '\u003e',
+    "<" => '\u003c',
+    "&" => '\u0026',
+  }
+  ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)
+
+  NO_MATCH_SHARED_STRING = ("a" * 100_000).freeze
+
+benchmark:
+  gsub_no_match_shared: |
+    str = NO_MATCH_SHARED_STRING.dup
+    str.gsub!("z", "x")
+    str
+
+  sub_no_match_shared: |
+    str = NO_MATCH_SHARED_STRING.dup
+    str.sub!("z", "x")
+    str
+
+  escape: |
+    str = STR.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_bin: |
+    str = STR.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
+
+  escape_utf8: |
+    str = STR_UNICODE.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_utf8_bin: |
+    str = STR_UNICODE.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "�" * 1024 + "�" # not single byte optimizable
+str2 = "�"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_memsearch.yml b/benchmark/string_memsearch.yml
new file mode 100644
index 0000000000..cde363289a
--- /dev/null
+++ b/benchmark/string_memsearch.yml
@@ -0,0 +1,75 @@
+prelude: |
+  # Haystacks of various sizes
+  small_hay  = "a" * 256
+  medium_hay = "a" * 4096
+  large_hay  = "a" * 65536
+
+  # Short needles (2-8 bytes) that exercise rb_memsearch_ss
+  needle_2 = "xy"
+  needle_4 = "xyzw"
+  needle_8 = "xyzwabcd"
+
+  # Needle whose first byte is absent from the haystack (memchr fast-path)
+  # vs needle whose first byte is common (rolling hash comparison)
+  first_byte_absent  = "x" + "a" * 3
+  first_byte_common  = "a" + "x" * 3
+
+  # Haystack with match at the end
+  hay_match_end = "a" * 4095 + "xy"
+
+  # Haystack with match at the start
+  hay_match_start = "xy" + "a" * 4094
+
+  # Mixed content haystack (more realistic)
+  mixed_hay = (("abcdefghij" * 100) + "z") * 10
+
+benchmark:
+  # === First byte absent from haystack (biggest win for rolling hash) ===
+  index_first_byte_absent_small: |
+    small_hay.index(first_byte_absent)
+  index_first_byte_absent_medium: |
+    medium_hay.index(first_byte_absent)
+  index_first_byte_absent_large: |
+    large_hay.index(first_byte_absent)
+
+  # === First byte common in haystack (stresses comparison loop) ===
+  index_first_byte_common_small: |
+    small_hay.index(first_byte_common)
+  index_first_byte_common_medium: |
+    medium_hay.index(first_byte_common)
+  index_first_byte_common_large: |
+    large_hay.index(first_byte_common)
+
+  # === Needle length variations (all absent) ===
+  index_needle_2_absent: |
+    medium_hay.index(needle_2)
+  index_needle_4_absent: |
+    medium_hay.index(needle_4)
+  index_needle_8_absent: |
+    medium_hay.index(needle_8)
+
+  # === Match at end of haystack ===
+  index_match_at_end: |
+    hay_match_end.index(needle_2)
+
+  # === Match at start of haystack ===
+  index_match_at_start: |
+    hay_match_start.index(needle_2)
+
+  # === include? (same code path) ===
+  include_first_byte_absent: |
+    medium_hay.include?(first_byte_absent)
+  include_first_byte_common: |
+    medium_hay.include?(first_byte_common)
+
+  # === byteindex ===
+  byteindex_first_byte_absent: |
+    medium_hay.byteindex(first_byte_absent)
+  byteindex_first_byte_common: |
+    medium_hay.byteindex(first_byte_common)
+
+  # === Mixed/realistic haystack ===
+  index_mixed_absent: |
+    mixed_hay.index(needle_4)
+  index_mixed_present: |
+    mixed_hay.index("ijab")
diff --git a/benchmark/string_rpartition.yml b/benchmark/string_rpartition.yml
new file mode 100644
index 0000000000..37e9d1b071
--- /dev/null
+++ b/benchmark/string_rpartition.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10 + ":"
+  str100 = str1 * 100 + ":"
+  str1000 = str1 * 1000 + ":"
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10 + ":"
+  nonascii100 = nonascii1 * 100 + ":"
+  nonascii1000 = nonascii1 * 1000 + ":"
+benchmark:
+  rpartition-1: str1.rpartition(":")
+  rpartition-10: str10.rpartition(":")
+  rpartition-100: str100.rpartition(":")
+  rpartition-1000: str1000.rpartition(":")
+  rpartition-nonascii1: nonascii1.rpartition(":")
+  rpartition-nonascii10: nonascii10.rpartition(":")
+  rpartition-nonascii100: nonascii100.rpartition(":")
+  rpartition-nonascii1000: nonascii1000.rpartition(":")
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_scrub.yml b/benchmark/string_scrub.yml
new file mode 100644
index 0000000000..4b5faaad8e
--- /dev/null
+++ b/benchmark/string_scrub.yml
@@ -0,0 +1,48 @@
+prelude: |
+
+  STRING_SIZE = 1024
+  def duplicate_to_length(str, target_length)
+    return "" if target_length <= 0
+    return str[0, target_length] if str.length >= target_length
+
+    (str * ((target_length / str.length) + 1))[0, target_length]
+  end
+  base = "Hello \u{1f600} world! \u{00e9}\u{00f1}"
+  padding = duplicate_to_length(base, STRING_SIZE)
+
+  valid_utf8 = (padding.b + "OK".b).force_encoding("UTF-8")
+  valid_utf8.valid_encoding?
+  unknown_but_valid_utf8 = valid_utf8.dup.b.force_encoding("UTF-8")
+  invalid_utf8 = (padding.b + "\x80\xFF".b).force_encoding("UTF-8")
+  invalid_utf8.valid_encoding?
+  unknown_but_invalid_utf8 = (padding.b + "\x80\xFF".b).force_encoding("UTF-8")
+
+  worst_case_utf8 = duplicate_to_length("\u{1f600}\u{00e9}\u{00f1}", STRING_SIZE).b.force_encoding("UTF-8")
+
+  unknown_but_valid_utf8_worst_case = worst_case_utf8.dup.b.force_encoding("UTF-8")
+  unknown_but_invalid_utf8_worst_case = (worst_case_utf8.b + "\x80\xFF".b).force_encoding("UTF-8")
+
+benchmark:
+  scrub_known_valid: |
+    string = valid_utf8.dup
+    string.scrub!
+
+  scrub_known_invalid: |
+    string = invalid_utf8.dup
+    string.scrub!
+
+  scrub_unknown_but_valid_coderange: |
+    string = unknown_but_valid_utf8.dup
+    string.scrub!
+
+  scrub_unknown_and_invalid_coderange: |
+    string = unknown_but_invalid_utf8.dup
+    string.scrub!
+
+  scrub_unknown_but_valid_coderange_worst_case: |
+    string = unknown_but_valid_utf8_worst_case.dup
+    string.scrub!
+
+  scrub_unknown_and_invalid_coderange_worst_case: |
+    string = unknown_but_invalid_utf8_worst_case.dup
+    string.scrub!
\ No newline at end of file
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+  long_string = "x"*1000+"-hår"
+benchmark:
+  regexp-short: |
+    "x-hår".slice!(/-(.)(.)(.)/, 3)
+  regexp-long: |
+    long_string.dup.slice!(/-(.)(.)(.)/, 3)
+  string-short: |
+    "x-hår".slice!("r")
+  string-long: |
+    long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+  str1 = [*0..5].join(" ") + " "
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  to_chars-1: str1.split('')
+  to_chars-10: str10.split('')
+  to_chars-100: str100.split('')
+  to_chars-1000: str1000.split('')
+  to_words-1: str1.split(' ')
+  to_words-10: str10.split(' ')
+  to_words-100: str100.split(' ')
+  to_words-1000: str1000.split(' ')
+  re_chars-1: str1.split(//)
+  re_chars-10: str10.split(//)
+  re_chars-100: str100.split(//)
+  re_chars-1000: str1000.split(//)
+  re_space-1: str1.split(/ /)
+  re_space-10: str10.split(/ /)
+  re_space-100: str100.split(/ /)
+  re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  swapcase-1: str1.swapcase
+  swapcase-10: str10.swapcase
+  swapcase-100: str100.swapcase
+  swapcase-1000: str1000.swapcase
+  swapcase-nonascii1: nonascii1.swapcase
+  swapcase-nonascii10: nonascii10.swapcase
+  swapcase-nonascii100: nonascii100.swapcase
+  swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  upcase-1: str1.upcase
+  upcase-10: str10.upcase
+  upcase-100: str100.upcase
+  upcase-1000: str1000.upcase
+  upcase-nonascii1: nonascii1.upcase
+  upcase-nonascii10: nonascii10.upcase
+  upcase-nonascii100: nonascii100.upcase
+  upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/struct_accessor.yml b/benchmark/struct_accessor.yml
new file mode 100644
index 0000000000..d95240e2dd
--- /dev/null
+++ b/benchmark/struct_accessor.yml
@@ -0,0 +1,37 @@
+prelude: |
+  C = Struct.new(:x) do
+    def initialize(...)
+      super
+      @ivar = 42
+    end
+
+    attr_accessor :ivar
+
+    class_eval <<-END
+      def r
+        #{'x;'*256}
+      end
+      def w
+        #{'self.x = nil;'*256}
+      end
+      def rm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def wm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+      def r_ivar
+        #{'ivar;'*256}
+      end
+    END
+  end
+  C.new(nil) # ensure common shape is known
+  obj = C.new(nil)
+benchmark:
+  member_reader: "obj.r"
+  member_writer: "obj.w"
+  member_reader_method: "obj.rm"
+  member_writer_method: "obj.wm"
+  ivar_reader: "obj.r_ivar"
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  - 'Time.at(0)'
+  - 'Time.at(0, 500)'
+  - 'Time.at(0, in: "+09:00")'
+  - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.new(2021)'
+  - 'Time.new(2021, 8, 22)'
+  - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..9336877cd4
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.now'
+  - 'Time.now(in: "+09:00")'
+  - 'Time.now.year'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+  require 'time'
+  inspect = "2021-08-23 09:57:02 +0900"
+  iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+  - Time.iso8601(iso8601)
+  - Time.parse(iso8601)
+  - Time.parse(inspect)
+  - Time.new(iso8601) rescue Time.iso8601(iso8601)
+  - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strftime.yml b/benchmark/time_strftime.yml
new file mode 100644
index 0000000000..28f62aec87
--- /dev/null
+++ b/benchmark/time_strftime.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+  time = Time.now
+benchmark:
+  - time.strftime("%FT%T")     # 19B
+  - time.strftime("%FT%T.%3N") # 23B
+  - time.strftime("%FT%T.%6N") # 26B
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'time'
+benchmark:
+  - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+  - Time.strptime("1", "%s")
+  - Time.strptime("0 +0100", "%s %z")
+  - Time.strptime("0 UTC", "%s %z")
+  - Time.strptime("1.5", "%s.%N")
+  - Time.strptime("1.000000000001", "%s.%N")
+  - Time.strptime("20010203 -0200", "%Y%m%d %z")
+  - Time.strptime("20010203 UTC", "%Y%m%d %z")
+  - Time.strptime("2018-365", "%Y-%j")
+  - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/time_xmlschema.yml b/benchmark/time_xmlschema.yml
new file mode 100644
index 0000000000..654e5cfcbc
--- /dev/null
+++ b/benchmark/time_xmlschema.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal
+  unless Time.method_defined?(:xmlschema)
+    class Time
+      def xmlschema(fraction_digits=0)
+        fraction_digits = fraction_digits.to_i
+        s = strftime("%FT%T")
+        if fraction_digits > 0
+          s << strftime(".%#{fraction_digits}N")
+        end
+        s << (utc? ? 'Z' : strftime("%:z"))
+      end
+    end
+  end
+  time = Time.now
+  utc_time = Time.now.utc
+  fraction_sec = Time.at(123456789.quo(9999999999)).getlocal("+09:00")
+  future_time = Time.utc(10000)
+benchmark:
+  - time.xmlschema
+  - utc_time.xmlschema
+  - time.xmlschema(6)
+  - utc_time.xmlschema(6)
+  - time.xmlschema(9)
+  - utc_time.xmlschema(9)
+  - fraction_sec.xmlschema(10)
+  - future_time.xmlschema
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_array: |
+    a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_reader :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar: |
+    j = obj.a
+    k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_accessor :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar_set: |
+    obj.a = 1
+    obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_backtrace.rb b/benchmark/vm_backtrace.rb
new file mode 100644
index 0000000000..0fbf73e1ca
--- /dev/null
+++ b/benchmark/vm_backtrace.rb
@@ -0,0 +1,22 @@
+# get last backtrace
+
+begin
+  caller(0, 0)
+rescue ArgumentError
+  alias caller_orig caller
+  def caller lev, n
+    caller_orig(lev)[0..n]
+  end
+end
+
+def rec n
+  if n < 0
+    100_000.times{
+      caller(0, 1)
+    }
+  else
+    rec(n-1)
+  end
+end
+
+rec 50
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+  vm_bigarray: |
+    a = [
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+    ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_bighash: |
+    a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+  def m
+    yield
+  end
+benchmark:
+  vm_block: |
+    m{
+    }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+  p = proc{_1}
+  o = Object.new
+  def o.each
+    i = 0
+    while i < 3_000_000 do
+      yield i
+      i += 1
+    end
+  end
+
+benchmark:
+  - name: block_handler_type_iseq
+    script: |
+      o.each{_1}
+
+  - name: block_handler_type_symbol
+    script: |
+      o.each(&:itself)
+
+  - name: block_handler_type_proc
+    script: |
+      o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m &b
+  end
+benchmark:
+  vm_blockparam: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m &b
+    b.call
+  end
+benchmark:
+  vm_blockparam_call: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def bp_yield
+    yield
+  end
+
+  def bp_pass &b
+    bp_yield &b
+  end
+benchmark:
+  vm_blockparam_pass: |
+    bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def bp_yield &b
+    yield
+  end
+benchmark:
+  vm_blockparam_yield: |
+    bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_call_bmethod.yml b/benchmark/vm_call_bmethod.yml
new file mode 100644
index 0000000000..40136e5aa4
--- /dev/null
+++ b/benchmark/vm_call_bmethod.yml
@@ -0,0 +1,37 @@
+prelude: |
+  define_method(:a0){}
+  define_method(:a1){|a| a}
+  define_method(:s){|*a| a}
+  define_method(:b){|kw: 1| kw}
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t100 = 100.times.to_a
+  kw = {kw: 2}
+benchmark:
+  bmethod_simple_0: |
+    a0
+  bmethod_simple_1: |
+    a1(1)
+  bmethod_simple_0_splat: |
+    a0(*t0)
+  bmethod_simple_1_splat: |
+    a1(*t1)
+  bmethod_no_splat: |
+    s
+  bmethod_0_splat: |
+    s(*t0)
+  bmethod_1_splat: |
+    s(*t1)
+  bmethod_10_splat: |
+    s(*t10)
+  bmethod_100_splat: |
+    s(*t100)
+  bmethod_kw: |
+    b(kw: 1)
+  bmethod_no_kw: |
+    b
+  bmethod_kw_splat: |
+    b(**kw)
+loop_count: 6000000
diff --git a/benchmark/vm_call_kw_and_kw_splat.yml b/benchmark/vm_call_kw_and_kw_splat.yml
new file mode 100644
index 0000000000..aa6e549e0c
--- /dev/null
+++ b/benchmark/vm_call_kw_and_kw_splat.yml
@@ -0,0 +1,25 @@
+prelude: |
+  h1, h10, h100, h1000 = [1, 10, 100, 1000].map do |n|
+    h = {kw: 1}
+    n.times{|i| h[i.to_s.to_sym] = i}
+    h
+  end
+  eh = {}
+  def kw(kw: nil, **kws) end
+benchmark:
+  1: |
+    kw(**h1)
+  1_mutable: |
+    kw(**eh, **h1)
+  10: |
+    kw(**h10)
+  10_mutable: |
+    kw(**eh, **h10)
+  100: |
+    kw(**h100)
+  100_mutable: |
+    kw(**eh, **h100)
+  1000: |
+    kw(**h1000)
+  1000_mutable: |
+    kw(**eh, **h1000)
diff --git a/benchmark/vm_call_method_missing.yml b/benchmark/vm_call_method_missing.yml
new file mode 100644
index 0000000000..f890796f11
--- /dev/null
+++ b/benchmark/vm_call_method_missing.yml
@@ -0,0 +1,62 @@
+prelude: |
+  class A0
+    def method_missing(m); m end
+  end
+  class A1
+    def method_missing(m, a) a; end
+  end
+  class S
+    def method_missing(m, *a) a; end
+  end
+  class B
+    def method_missing(m, kw: 1) kw end
+  end
+  class SB
+    def method_missing(m, *a, kw: 1) kw end
+  end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+  kw = {kw: 2}
+
+  a0 = A0.new
+  a1 = A1.new
+  s = S.new
+  b = B.new
+  sb = SB.new
+benchmark:
+  method_missing_simple_0: |
+    a0.()
+  method_missing_simple_1: |
+    a1.x(1)
+  method_missing_simple_0_splat: |
+    a0.(*t0)
+  method_missing_simple_1_splat: |
+    a1.(*t1)
+  method_missing_no_splat: |
+    s.()
+  method_missing_0_splat: |
+    s.(*t0)
+  method_missing_1_splat: |
+    s.(*t1)
+  method_missing_10_splat: |
+    s.(*t10)
+  method_missing_200_splat: |
+    s.(*t200)
+  method_missing_kw: |
+    b.(kw: 1)
+  method_missing_no_kw: |
+    b.()
+  method_missing_kw_splat: |
+    b.(**kw)
+  method_missing_0_splat_kw: |
+    sb.(*t0, **kw)
+  method_missing_1_splat_kw: |
+    sb.(*t1, **kw)
+  method_missing_10_splat_kw: |
+    sb.(*t10, **kw)
+  method_missing_200_splat_kw: |
+    sb.(*t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_call_send_iseq.yml b/benchmark/vm_call_send_iseq.yml
new file mode 100644
index 0000000000..60ff23c475
--- /dev/null
+++ b/benchmark/vm_call_send_iseq.yml
@@ -0,0 +1,77 @@
+prelude: |
+  def a0; end
+  def a1(a) a; end
+  def s(*a) a; end
+  def b(kw: 1) kw end
+  def sb(*a, kw: 1) kw end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+
+  a0_t0 = [:a0, *t0]
+  a1_t1 = [:a1, *t1]
+  s_t0 = [:s, *t0]
+  s_t1 = [:s, *t1]
+  s_t10 = [:s, *t10]
+  s_t200 = [:s, *t200]
+  sb_t0 = [:sb, *t0]
+  sb_t1 = [:sb, *t1]
+  sb_t10 = [:sb, *t10]
+  sb_t200 = [:sb, *t200]
+  kw = {kw: 2}
+benchmark:
+  send_simple_0: |
+    send(:a0)
+  send_simple_1: |
+    send(:a1, 1)
+  send_simple_0_splat: |
+    send(:a0, *t0)
+  send_simple_1_splat: |
+    send(:a1, *t1)
+  send_simple_0_splat_comb: |
+    send(*a0_t0)
+  send_simple_1_splat_comb: |
+    send(*a1_t1)
+  send_no_splat: |
+    send(:s)
+  send_0_splat: |
+    send(:s, *t0)
+  send_1_splat: |
+    send(:s, *t1)
+  send_10_splat: |
+    send(:s, *t10)
+  send_200_splat: |
+    send(:s, *t200)
+  send_0_splat_comb: |
+    send(*s_t0)
+  send_1_splat_comb: |
+    send(*s_t1)
+  send_10_splat_comb: |
+    send(*s_t10)
+  send_200_splat_comb: |
+    send(*s_t200)
+  send_kw: |
+    send(:b, kw: 1)
+  send_no_kw: |
+    send(:b)
+  send_kw_splat: |
+    send(:b, **kw)
+  send_0_splat_kw: |
+    send(:sb, *t0, **kw)
+  send_1_splat_kw: |
+    send(:sb, *t1, **kw)
+  send_10_splat_kw: |
+    send(:sb, *t10, **kw)
+  send_200_splat_kw: |
+    send(:sb, *t200, **kw)
+  send_0_splat_comb_kw: |
+    send(*sb_t0, **kw)
+  send_1_splat_comb_kw: |
+    send(*sb_t1, **kw)
+  send_10_splat_comb_kw: |
+    send(*sb_t10, **kw)
+  send_200_splat_comb_kw: |
+    send(*sb_t200, **kw)
+loop_count: 3000000
diff --git a/benchmark/vm_call_symproc.yml b/benchmark/vm_call_symproc.yml
new file mode 100644
index 0000000000..16e0ac579e
--- /dev/null
+++ b/benchmark/vm_call_symproc.yml
@@ -0,0 +1,83 @@
+prelude: |
+  def self.a0; end
+  def self.a1(a) a; end
+  def self.s(*a) a; end
+  def self.b(kw: 1) kw end
+  def self.sb(*a, kw: 1) kw end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+
+  a0_t0 = [self, *t0]
+  a1_t1 = [self, *t1]
+  s_t0 = [self, *t0]
+  s_t1 = [self, *t1]
+  s_t10 = [self, *t10]
+  s_t200 = [self, *t200]
+  sb_t0 = [self, *t0]
+  sb_t1 = [self, *t1]
+  sb_t10 = [self, *t10]
+  sb_t200 = [self, *t200]
+  kw = {kw: 2}
+
+  a0 = :a0.to_proc
+  a1 = :a1.to_proc
+  s = :s.to_proc
+  b = :b.to_proc
+  sb = :sb.to_proc
+benchmark:
+  symproc_simple_0: |
+    a0.(self)
+  symproc_simple_1: |
+    a1.(self, 1)
+  symproc_simple_0_splat: |
+    a0.(self, *t0)
+  symproc_simple_1_splat: |
+    a1.(self, *t1)
+  symproc_simple_0_splat_comb: |
+    a0.(*a0_t0)
+  symproc_simple_1_splat_comb: |
+    a1.(*a1_t1)
+  symproc_no_splat: |
+    s.(self)
+  symproc_0_splat: |
+    s.(self, *t0)
+  symproc_1_splat: |
+    s.(self, *t1)
+  symproc_10_splat: |
+    s.(self, *t10)
+  symproc_200_splat: |
+    s.(self, *t200)
+  symproc_0_splat_comb: |
+    s.(*s_t0)
+  symproc_1_splat_comb: |
+    s.(*s_t1)
+  symproc_10_splat_comb: |
+    s.(*s_t10)
+  symproc_200_splat_comb: |
+    s.(*s_t200)
+  symproc_kw: |
+    b.(self, kw: 1)
+  symproc_no_kw: |
+    b.(self)
+  symproc_kw_splat: |
+    b.(self, **kw)
+  symproc_0_splat_kw: |
+    sb.(self, *t0, **kw)
+  symproc_1_splat_kw: |
+    sb.(self, *t1, **kw)
+  symproc_10_splat_kw: |
+    sb.(self, *t10, **kw)
+  symproc_200_splat_kw: |
+    sb.(self, *t200, **kw)
+  symproc_0_splat_comb_kw: |
+    sb.(*sb_t0, **kw)
+  symproc_1_splat_comb_kw: |
+    sb.(*sb_t1, **kw)
+  symproc_10_splat_comb_kw: |
+    sb.(*sb_t10, **kw)
+  symproc_200_splat_comb_kw: |
+    sb.(*sb_t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+  vm_case: |
+    case :foo
+    when :bar
+      raise
+    when :baz
+      raise
+    when :boo
+      raise
+    when :foo
+      # noop
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_case_classes: |
+    case :foo
+    when Hash
+      raise
+    when Array
+      raise
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_case_lit: |
+    i = 0
+    @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+    def foo(i)
+      @ret[i % @ret.size]
+    end
+
+    while i<6_000_000
+      case foo(i)
+      when "foo" then :foo
+      when true then true
+      when false then false
+      when :sym then :sym
+      when 6 then :fix
+      when nil then nil
+      when 0.1 then :float
+      when 0xffffffffffffffff then :big
+      end
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
new file mode 100644
index 0000000000..9661323cd2
--- /dev/null
+++ b/benchmark/vm_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<200_000
+  i += 1
+
+  Class.new{
+    def m; end
+  }
+end
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..8939ca0cd3
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,13 @@
+prelude: |
+  Const = 1
+  A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1
+  def foo
+    A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z
+  end
+benchmark:
+  vm_const: |
+    j = Const
+    k = Const
+  vm_const_many: |
+    foo
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    @@foo = 1
+
+    def self.foo
+      @@foo
+    end
+
+    ("A".."Z").each do |module_name|
+      eval <<-EOM
+        module #{module_name}
+        end
+
+        include #{module_name}
+      EOM
+    end
+  end
+benchmark:
+  vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  class Object
+    define_method(:m){}
+  end
+benchmark:
+  vm_defined_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+  x = y = 'z'
+benchmark:
+  vm_dstr: |
+    str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb
new file mode 100644
index 0000000000..1d3aa3b97b
--- /dev/null
+++ b/benchmark/vm_dstr_ary.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = []
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb
new file mode 100644
index 0000000000..631ca54755
--- /dev/null
+++ b/benchmark/vm_dstr_bool.rb
@@ -0,0 +1,7 @@
+i = 0
+x = true
+y = false
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb
new file mode 100644
index 0000000000..ed380d7595
--- /dev/null
+++ b/benchmark/vm_dstr_int.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{i}bar#{i}baz"
+end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb
new file mode 100644
index 0000000000..45fc107892
--- /dev/null
+++ b/benchmark/vm_dstr_str.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = ""
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb
new file mode 100644
index 0000000000..484b8f8150
--- /dev/null
+++ b/benchmark/vm_dstr_sym.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = :z
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+  vm_ensure: |
+    i = 0
+    while i<30_000_000
+      i += 1
+      begin
+        begin
+        ensure
+        end
+      ensure
+      end
+    end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_eval: |
+    eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  vm_fiber_allocate: |
+    fiber = Fiber.new{Fiber.yield}
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_count: |
+    fiber = Fiber.new{Fiber.yield}
+    fibers << fiber
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+  GC.disable
+  fibers = []
+benchmark:
+  vm_fiber_reuse: |
+    1024.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+
+    fibers.clear
+    GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_reuse_gc: |
+    2000.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+    fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+  # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+  fib = Fiber.new do
+    loop { Fiber.yield }
+  end
+benchmark:
+  vm_fiber_switch: |
+    fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+  f = 0.0
+benchmark:
+  vm_float_simple: |
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezeobj.yml b/benchmark/vm_freezeobj.yml
new file mode 100644
index 0000000000..69a795a354
--- /dev/null
+++ b/benchmark/vm_freezeobj.yml
@@ -0,0 +1,6 @@
+prelude: |
+ objs = 100000.times.map { Object.new }
+benchmark:
+  vm_freeze_obj: |
+    objs.map(&:freeze)
+loop_count: 600
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+  class String
+    def freeze
+      -self
+    end
+  end
+benchmark:
+  vm_freezestring: |
+    "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/vm_gc.rb b/benchmark/vm_gc.rb
new file mode 100644
index 0000000000..e668026915
--- /dev/null
+++ b/benchmark/vm_gc.rb
@@ -0,0 +1,6 @@
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
new file mode 100644
index 0000000000..cfdfc8c5a5
--- /dev/null
+++ b/benchmark/vm_gc_old_full.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+100.times do
+  GC.start
+end
diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
new file mode 100644
index 0000000000..ad22feb655
--- /dev/null
+++ b/benchmark/vm_gc_old_immediate.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+  GC.start(full_mark: false, immediate_sweep: true)
+end
diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
new file mode 100644
index 0000000000..b74d44baf1
--- /dev/null
+++ b/benchmark/vm_gc_old_lazy.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+  GC.start(full_mark: false, immediate_sweep: false)
+end
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_gc_short_lived: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+  def nested_hash h, n
+    if n == 0
+      ''
+    else
+      10.times{
+        h[Object.new] = nested_hash(h, n-1)
+      }
+    end
+  end
+
+  long_lived = Hash.new
+  nested_hash long_lived, 6
+
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_complex_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+  long_lived = Array.new(1_000_000){|i| "#{i}"}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+  50_000.times{|i| sym = "sym#{i}".to_sym}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_symbol: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+  short_lived_ary = []
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_ary: |
+    short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+  long_lived = []
+
+  if RUBY_VERSION > "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+
+benchmark:
+  vm_gc_wb_ary_promoted: |
+    long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  short_lived_obj = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj: |
+    short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  long_lived = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj_promoted: |
+    long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+
+    ("A".."M").each do |module_name|
+      eval <<-EOM
+          module #{module_name}
+            def m; super; end
+          end
+          prepend #{module_name}
+      EOM
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+  vm_ivar: |
+    j = @a
+    k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_embedded_obj_init.yml b/benchmark/vm_ivar_embedded_obj_init.yml
new file mode 100644
index 0000000000..74fe20a630
--- /dev/null
+++ b/benchmark/vm_ivar_embedded_obj_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_embedded_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_extended_obj_init.yml b/benchmark/vm_ivar_extended_obj_init.yml
new file mode 100644
index 0000000000..f054bab282
--- /dev/null
+++ b/benchmark/vm_ivar_extended_obj_init.yml
@@ -0,0 +1,16 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_extended_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_get.yml b/benchmark/vm_ivar_generic_get.yml
new file mode 100644
index 0000000000..dae2d37671
--- /dev/null
+++ b/benchmark/vm_ivar_generic_get.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C < Array
+    attr_reader :a, :b, :c
+    def initialize
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_get: |
+    c.a
+    c.b
+    c.c
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_set.yml b/benchmark/vm_ivar_generic_set.yml
new file mode 100644
index 0000000000..102a6577fb
--- /dev/null
+++ b/benchmark/vm_ivar_generic_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C < Array
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_set: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_get.yml b/benchmark/vm_ivar_get.yml
new file mode 100644
index 0000000000..1e0dad665f
--- /dev/null
+++ b/benchmark/vm_ivar_get.yml
@@ -0,0 +1,100 @@
+prelude: |
+  class Example
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+
+    @levar = 1
+    @v0 = 1
+    @v1 = 2
+    @v3 = 3
+
+    def self.get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  class GenExample < Time
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  obj = Example.new
+  gen = GenExample.new
+benchmark:
+  vm_ivar_get_on_obj: |
+    obj.get_value_loop
+  vm_ivar_get_on_class: |
+    Example.get_value_loop
+  vm_ivar_get_on_generic: |
+    gen.get_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_get_unintialized.yml b/benchmark/vm_ivar_get_unintialized.yml
new file mode 100644
index 0000000000..a1ccfb06ce
--- /dev/null
+++ b/benchmark/vm_ivar_get_unintialized.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def read
+      @uninitialized
+    end
+  end
+
+  obj = Example.new
+benchmark:
+  vm_ivar_get_uninitialized: |
+    obj.read
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_ic_miss.yml b/benchmark/vm_ivar_ic_miss.yml
new file mode 100644
index 0000000000..944fb1a9e6
--- /dev/null
+++ b/benchmark/vm_ivar_ic_miss.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class Foo
+    def initialize diverge
+      if diverge
+        @a = 1
+      end
+
+      @a0 = @a1 = @a2 = @a3 = @a4 = @a5 = @a6 = @a7 = @a8 = @a9 = @a10 = @a11 = @a12 = @a13 = @a14 = @a15 = @a16 = @a17 = @a18 = @a19 = @a20 = @a21 = @a22 = @a23 = @a24 = @a25 = @a26 = @a27 = @a28 = @a29 = @a30 = @a31 = @a32 = @a33 = @a34 = @a35 = @a36 = @a37 = @a38 = @a39 = @a40 = @a41 = @a42 = @a43 = @a44 = @a45 = @a46 = @a47 = @a48 = @a49 = @a50 = @a51 = @a52 = @a53 = @a54 = @a55 = @a56 = @a57 = @a58 = @a59 = @a60 = @a61 = @a62 = @a63 = @a64 = @a65 = @a66 = @a67 = @a68 = @a69 = @a70 = @a71 = @a72 = @a73 = @a74 = @b = 1
+    end
+
+    def b; @b; end
+  end
+
+  a = Foo.new false
+  b = Foo.new true
+benchmark:
+  vm_ivar_ic_miss: |
+    a.b
+    b.b
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_lazy_set.yml b/benchmark/vm_ivar_lazy_set.yml
new file mode 100644
index 0000000000..7372ffcfbc
--- /dev/null
+++ b/benchmark/vm_ivar_lazy_set.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def lazy_set
+      @uninitialized ||= 123
+    end
+  end
+
+  objs = 10000000.times.map { Example.new }
+benchmark:
+  vm_ivar_lazy_set: |
+    objs.each(&:lazy_set)
+loop_count: 1
diff --git a/benchmark/vm_ivar_memoize.yml b/benchmark/vm_ivar_memoize.yml
new file mode 100644
index 0000000000..90f6b07f05
--- /dev/null
+++ b/benchmark/vm_ivar_memoize.yml
@@ -0,0 +1,85 @@
+prelude: |
+  IVARS = 60
+  class Record
+    def initialize(offset = false)
+      @offset = 1 if offset
+      @first = 0
+      IVARS.times do |i|
+        instance_variable_set("@ivar_#{i}", i)
+      end
+    end
+
+    def first
+      @first
+    end
+
+    def lazy_set
+      @lazy_set ||= 123
+    end
+
+    def undef
+      @undef
+    end
+  end
+
+  Record.new # Need one alloc to right size
+
+  BASE = Record.new
+  LAZY = Record.new
+  LAZY.lazy_set
+
+  class Miss < Record
+    @first = 0
+    IVARS.times do |i|
+      instance_variable_set("@i_#{i}", i)
+    end
+  end
+
+  Miss.new # Need one alloc to right size
+  MISS = Miss.new
+
+  DIVERGENT = Record.new(true)
+
+benchmark:
+  vm_ivar_stable_shape: |
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+  vm_ivar_memoize_unstable_shape: |
+    BASE.first
+    LAZY.first
+    BASE.first
+    LAZY.first
+    BASE.first
+    LAZY.first
+  vm_ivar_memoize_unstable_shape_miss: |
+    BASE.first
+    MISS.first
+    BASE.first
+    MISS.first
+    BASE.first
+    MISS.first
+  vm_ivar_unstable_undef: |
+    BASE.undef
+    LAZY.undef
+    BASE.undef
+    LAZY.undef
+    BASE.undef
+    LAZY.undef
+  vm_ivar_divergent_shape: |
+    BASE.first
+    DIVERGENT.first
+    BASE.first
+    DIVERGENT.first
+    BASE.first
+    DIVERGENT.first
+  vm_ivar_divergent_shape_imbalanced: |
+    BASE.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+    end
+  end
+benchmark:
+  vm_ivar_of_class: |
+    a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a o
+      @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+    end
+  end
+benchmark:
+  vm_ivar_of_class_set: |
+    a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+  vm_ivar_set: |
+    @a = 1
+    @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_on_instance.yml b/benchmark/vm_ivar_set_on_instance.yml
new file mode 100644
index 0000000000..6ce53a86ec
--- /dev/null
+++ b/benchmark/vm_ivar_set_on_instance.yml
@@ -0,0 +1,94 @@
+prelude: |
+  class TheClass
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  class Generic < Time
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  obj = TheClass.new
+  gen_obj = Generic.new
+
+  class SomeClass
+    @levar = 1
+    @v0 = 1
+    @v1 = 2
+    @v3 = 3
+
+    def self.set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+benchmark:
+  vm_ivar_set_on_instance: |
+    obj.set_value_loop
+  vm_ivar_set_on_generic: |
+    gen_obj.set_value_loop
+  vm_ivar_set_on_class: |
+    SomeClass.set_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..bc8bf5bf6b
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+  class B < A; end
+  class C < A; end
+
+  b = B.new
+  c = C.new
+benchmark:
+  vm_ivar_init_subclass: |
+    b.set_ivars
+    c.set_ivars
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+  a = 'abc'
+  b = [1, 2, 3]
+benchmark:
+  vm_length: |
+    a.length
+    b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_cond_set.yml b/benchmark/vm_lvar_cond_set.yml
new file mode 100644
index 0000000000..1845f9d12e
--- /dev/null
+++ b/benchmark/vm_lvar_cond_set.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_lvar_cond_set: |
+    a ||= 1
+    b ||= 1
+    c ||= 1
+    d ||= 1
+    nil
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+  vm_lvar_init: |
+    def m v
+      unless v
+        # unreachable code
+        v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+        v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+        v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+        v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+        v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+      end
+    end
+
+    i = 0
+
+    while i<30_000_000
+      i += 1
+      m i
+    end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_lvar_set: |
+    a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    def method_missing mid
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_method_missing: |
+    obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_splat_calls.yml b/benchmark/vm_method_splat_calls.yml
new file mode 100644
index 0000000000..f2f366e99c
--- /dev/null
+++ b/benchmark/vm_method_splat_calls.yml
@@ -0,0 +1,13 @@
+prelude: |
+  def f(x=0, y: 0) end
+  a = [1]
+  ea = []
+  kw = {y: 1}
+  b = lambda{}
+benchmark:
+  arg_splat: "f(1, *ea)"
+  arg_splat_block: "f(1, *ea, &b)"
+  splat_kw_splat: "f(*a, **kw)"
+  splat_kw_splat_block: "f(*a, **kw, &b)"
+  splat_kw: "f(*a, y: 1)"
+  splat_kw_block: "f(*a, y: 1, &b)"
diff --git a/benchmark/vm_method_splat_calls2.yml b/benchmark/vm_method_splat_calls2.yml
new file mode 100644
index 0000000000..d33dcd7e8b
--- /dev/null
+++ b/benchmark/vm_method_splat_calls2.yml
@@ -0,0 +1,27 @@
+prelude: |
+  def named_arg_splat(*a) end
+  def named_arg_kw_splat(*a, **kw) end
+  def anon_arg_splat(*) end
+  def anon_kw_splat(**) end
+  def anon_arg_kw_splat(*, **) end
+  def anon_fw_to_named(*, **) named_arg_kw_splat(*, **) end
+  def fw_to_named(...) named_arg_kw_splat(...) end
+  def fw_to_anon_to_named(...) anon_fw_to_named(...) end
+  def fw_no_kw(...) named_arg_splat(...) end
+  a = [1]
+  kw = {y: 1}
+benchmark:
+  named_multi_arg_splat: "named_arg_splat(*a, *a)"
+  named_post_splat: "named_arg_splat(*a, a)"
+  anon_arg_splat: "anon_arg_splat(*a)"
+  anon_arg_kw_splat: "anon_arg_kw_splat(*a, **kw)"
+  anon_multi_arg_splat: "anon_arg_splat(*a, *a)"
+  anon_post_splat: "anon_arg_splat(*a, a)"
+  anon_kw_splat: "anon_kw_splat(**kw)"
+  anon_fw_to_named_splat: "anon_fw_to_named(*a, **kw)"
+  anon_fw_to_named_no_splat: "anon_fw_to_named(1, y: 1)"
+  fw_to_named_splat: "fw_to_named(*a, **kw)"
+  fw_to_named_no_splat: "fw_to_named(1, y: 1)"
+  fw_to_anon_to_named_splat: "fw_to_anon_to_named(*a, **kw)"
+  fw_to_anon_to_named_no_splat: "fw_to_anon_to_named(1, y: 1)"
+  fw_no_kw: "fw_no_kw(1, 2)"
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method_with_block: |
+    m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_module_ann_const_set: |
+    Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+  module M
+  end
+  $VERBOSE = nil
+benchmark:
+  vm_module_const_set: |
+    M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+  require 'thread'
+
+  m = Thread::Mutex.new
+benchmark:
+  vm_mutex: |
+    m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+  obj1 = Object.new
+  obj2 = Object.new
+benchmark:
+  vm_neq: |
+    obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_newlambda: |
+    lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+benchmark:
+  vm_not: |
+    !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method_ov: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+    #  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+  module AR; end
+  class AR::Base
+    def create_or_update
+      nil
+    end
+    def save
+      create_or_update
+    end
+  end
+  class Foo < AR::Base; end
+  class Bar < AR::Base; end
+  o1 = Foo.new
+  o2 = Bar.new
+benchmark:
+  vm_poly_same_method: |
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml
@@ -0,0 +1,18 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_singleton: |
+    class C1
+      def m; 1; end
+    end
+
+    o1 = C1.new
+    o2 = C1.new
+    o2.singleton_class
+
+    i = 0
+    while i<6_000_000 # benchmark loop 2
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml
new file mode 100644
index 0000000000..2f8de6c272
--- /dev/null
+++ b/benchmark/vm_proc.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def m &b
+    b
+  end
+
+  pr = m{
+    a = 1
+  }
+benchmark:
+  vm_proc: |
+    pr.call
+loop_count: 6000000
diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml
new file mode 100644
index 0000000000..247d9f70ee
--- /dev/null
+++ b/benchmark/vm_raise1.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise1: |
+    begin
+      rec 1
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml
new file mode 100644
index 0000000000..f0fa047b3c
--- /dev/null
+++ b/benchmark/vm_raise2.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise2: |
+    begin
+      rec 10
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml
new file mode 100644
index 0000000000..80541332b1
--- /dev/null
+++ b/benchmark/vm_regexp.yml
@@ -0,0 +1,14 @@
+prelude: |
+  str = 'xxxhogexxx'
+benchmark:
+  vm_regexp: |
+    /hoge/ =~ str
+  vm_regexp_alternating: |
+    /hoge/ =~ str
+    /huge/ =~ str
+  vm_regexp_invert: |
+    str =~ /hoge/
+  vm_regexp_invert_alternating: |
+    str =~ /hoge/
+    str =~ /huge/
+loop_count: 6000000
diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml
new file mode 100644
index 0000000000..b4a0af521f
--- /dev/null
+++ b/benchmark/vm_rescue.yml
@@ -0,0 +1,6 @@
+benchmark:
+  vm_rescue: |
+    begin
+    rescue
+    end
+loop_count: 30000000
diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml
new file mode 100644
index 0000000000..f31bc7ac89
--- /dev/null
+++ b/benchmark/vm_send.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def m
+    end
+  end
+
+  o = C.new
+  m = :m
+benchmark:
+  vm_send: |
+    o.__send__ :m
+  vm_send_var: |
+    o.__send__ m
+loop_count: 6000000
diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml
new file mode 100644
index 0000000000..6f12b65176
--- /dev/null
+++ b/benchmark/vm_send_cfunc.yml
@@ -0,0 +1,14 @@
+prelude: |
+  ary = []
+  kw = {a: 1}
+  empty_kw = {}
+  kw_ary = [Hash.ruby2_keywords_hash(a: 1)]
+  empty_kw_ary = [Hash.ruby2_keywords_hash({})]
+benchmark:
+  vm_send_cfunc: itself
+  vm_send_cfunc_splat: itself(*ary)
+  vm_send_cfunc_splat_kw_hash: equal?(*kw_ary)
+  vm_send_cfunc_splat_empty_kw_hash: itself(*empty_kw_ary)
+  vm_send_cfunc_splat_kw: equal?(*ary, **kw)
+  vm_send_cfunc_splat_empty_kw: itself(*ary, **empty_kw)
+loop_count: 20000000
diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml
new file mode 100644
index 0000000000..c9829cff0b
--- /dev/null
+++ b/benchmark/vm_simplereturn.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m
+    return 1
+  end
+benchmark:
+  vm_simplereturn: m
+loop_count: 30000000
diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml
new file mode 100644
index 0000000000..64439c7980
--- /dev/null
+++ b/benchmark/vm_string_literal.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_string_literal: |
+    x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml
new file mode 100644
index 0000000000..4cf78970cb
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_hi: |
+    x.z # x[25]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml
new file mode 100644
index 0000000000..c91af27fa5
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_lo: |
+    x.k # x[10]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml
new file mode 100644
index 0000000000..69550d14ea
--- /dev/null
+++ b/benchmark/vm_struct_big_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_aset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.k = i # x[10] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml
new file mode 100644
index 0000000000..09b764dd13
--- /dev/null
+++ b/benchmark/vm_struct_big_href_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_hi: |
+    x[:z]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml
new file mode 100644
index 0000000000..d2f00b220f
--- /dev/null
+++ b/benchmark/vm_struct_big_href_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_lo: |
+    x[:k]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml
new file mode 100644
index 0000000000..fc45cbee9c
--- /dev/null
+++ b/benchmark/vm_struct_big_hset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_hset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x[:k] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml
new file mode 100644
index 0000000000..5a83251d1e
--- /dev/null
+++ b/benchmark/vm_struct_small_aref.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_aref: |
+    x.a
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml
new file mode 100644
index 0000000000..74f435f126
--- /dev/null
+++ b/benchmark/vm_struct_small_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_small_aset: |
+    s = Struct.new(:a, :b, :c)
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.a = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml
new file mode 100644
index 0000000000..6b7d7f39e7
--- /dev/null
+++ b/benchmark/vm_struct_small_href.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_href: |
+    x[:a]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml
new file mode 100644
index 0000000000..5d43b150de
--- /dev/null
+++ b/benchmark/vm_struct_small_hset.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_hset: |
+    x[:a] = 1
+loop_count: 6000000
diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml
new file mode 100644
index 0000000000..0d1e965c6e
--- /dev/null
+++ b/benchmark/vm_super.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+  end
+
+  class CC < C
+    def m
+      super()
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_super_splat_calls.yml b/benchmark/vm_super_splat_calls.yml
new file mode 100644
index 0000000000..795e44e4da
--- /dev/null
+++ b/benchmark/vm_super_splat_calls.yml
@@ -0,0 +1,25 @@
+prelude: |
+  @a = [1].freeze
+  @ea = [].freeze
+  @kw = {y: 1}.freeze
+  @b = lambda{}
+  extend(Module.new{def arg_splat(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+  extend(Module.new{def arg_splat; super(1, *@ea) end})
+  extend(Module.new{def arg_splat_block; super(1, *@ea, &@b) end})
+  extend(Module.new{def splat_kw_splat; super(*@a, **@kw) end})
+  extend(Module.new{def splat_kw_splat_block; super(*@a, **@kw, &@b) end})
+  extend(Module.new{def splat_kw; super(*@a, y: 1) end})
+  extend(Module.new{def splat_kw_block; super(*@a, y: 1, &@b) end})
+benchmark:
+  arg_splat: "arg_splat"
+  arg_splat_block: "arg_splat_block"
+  splat_kw_splat: "splat_kw_splat"
+  splat_kw_splat_block: "splat_kw_splat_block"
+  splat_kw: "splat_kw"
+  splat_kw_block: "splat_kw_block"
diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml
new file mode 100644
index 0000000000..e824a65e0a
--- /dev/null
+++ b/benchmark/vm_swap.yml
@@ -0,0 +1,7 @@
+prelude: |
+  a = 1
+  b = 2
+benchmark:
+  vm_swap: |
+    a, b = b, a
+loop_count: 30000000
diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb
new file mode 100644
index 0000000000..1d433353e1
--- /dev/null
+++ b/benchmark/vm_symbol_block_pass.rb
@@ -0,0 +1,13 @@
+class C
+  1000.times {|i|
+    eval("def i#{i};end")
+  }
+end
+
+c = C.new
+m = C.instance_methods(false)