diff options
Diffstat (limited to 'benchmark')
352 files changed, 7303 insertions, 0 deletions
diff --git a/benchmark/README.md b/benchmark/README.md new file mode 100644 index 0000000000..c222164be3 --- /dev/null +++ b/benchmark/README.md @@ -0,0 +1,72 @@ +# ruby/benchmark + +This directory has benchmark definitions to be run with +[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver). + +## Normal usage + +Execute `gem install benchmark_driver` and run a command like: + +```bash +# Run a benchmark script with the ruby in the $PATH +benchmark-driver benchmark/app_fib.rb + +# Run benchmark scripts with multiple Ruby executables or options +benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit' + +# Or compare Ruby versions managed by rbenv +benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit' + +# You can collect many metrics in many ways +benchmark-driver benchmark/*.rb --runner memory --output markdown + +# Some are defined with YAML for complex setup or accurate measurement +benchmark-driver benchmark/*.yml +``` + +See also: + +```console +Usage: benchmark-driver [options] RUBY|YAML... + -r, --runner TYPE Specify runner type: ips, time, memory, once (default: ips) + -o, --output TYPE Specify output type: compare, simple, markdown, record (default: compare) + -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...) + --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...) + --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage + --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best) + --bundler Install and use gems specified in Gemfile + --filter REGEXP Filter out benchmarks with given regexp + --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3) + -v, --verbose Verbose mode. Multiple -v options increase visibility (max: 2) +``` + +## make benchmark + +Using `make benchmark`, `make update-benchmark-driver` automatically downloads +the supported version of benchmark\_driver, and it runs benchmarks with the downloaded +benchmark\_driver. + +```bash +# Run all benchmarks with the ruby in the $PATH and the built ruby +make benchmark + +# Or compare with specific ruby binary +make benchmark COMPARE_RUBY="/path/to/ruby --jit" + +# Run vm benchmarks +make benchmark ITEM=vm + +# Run some limited benchmarks in ITEM-matched files +make benchmark ITEM=vm OPTS=--filter=block + +# You can specify the benchmark by an exact filename instead of using the default argument: +# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb') +make benchmark ARGS=benchmark/erb_render.yml + +# You can specify any option via $OPTS +make benchmark OPTS="--help" + +# With `make benchmark`, some special runner plugins are available: +# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime +make benchmark ITEM=vm_bigarray OPTS="-r peak" +``` diff --git a/benchmark/app_answer.rb b/benchmark/app_answer.rb new file mode 100644 index 0000000000..3cd8a8fd37 --- /dev/null +++ b/benchmark/app_answer.rb @@ -0,0 +1,15 @@ +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +def the_answer_to_life_the_universe_and_everything + (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i +end + +answer = the_answer_to_life_the_universe_and_everything diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb new file mode 100644 index 0000000000..16296af12b --- /dev/null +++ b/benchmark/app_aobench.rb @@ -0,0 +1,297 @@ +# coding: US-ASCII + +# AO render benchmark +# Original program (C) Syoyo Fujita in Javascript (and other languages) +# https://code.google.com/p/aobench/ +# Ruby(yarv2llvm) version by Hideki Miura +# + +IMAGE_WIDTH = 256 +IMAGE_HEIGHT = 256 +NSUBSAMPLES = 2 +NAO_SAMPLES = 8 + +srand(0) + +class Vec + def initialize(x, y, z) + @x = x + @y = y + @z = z + end + + attr_accessor :x, :y, :z + + def vadd(b) + Vec.new(@x + b.x, @y + b.y, @z + b.z) + end + + def vsub(b) + Vec.new(@x - b.x, @y - b.y, @z - b.z) + end + + def vcross(b) + Vec.new(@y * b.z - @z * b.y, + @z * b.x - @x * b.z, + @x * b.y - @y * b.x) + end + + def vdot(b) + @x * b.x + @y * b.y + @z * b.z + end + + def vlength + Math.sqrt(@x * @x + @y * @y + @z * @z) + end + + def vnormalize + len = vlength + v = Vec.new(@x, @y, @z) + if len > 1.0e-17 then + v.x = v.x / len + v.y = v.y / len + v.z = v.z / len + end + v + end +end + + +class Sphere + def initialize(center, radius) + @center = center + @radius = radius + end + + attr_reader :center, :radius + + def intersect(ray, isect) + rs = ray.org.vsub(@center) + b = rs.vdot(ray.dir) + c = rs.vdot(rs) - (@radius * @radius) + d = b * b - c + if d > 0.0 then + t = - b - Math.sqrt(d) + + if t > 0.0 and t < isect.t then + isect.t = t + isect.hit = true + isect.pl = Vec.new(ray.org.x + ray.dir.x * t, + ray.org.y + ray.dir.y * t, + ray.org.z + ray.dir.z * t) + n = isect.pl.vsub(@center) + isect.n = n.vnormalize + else + 0.0 + end + end + nil + end +end + +class Plane + def initialize(p, n) + @p = p + @n = n + end + + def intersect(ray, isect) + d = -@p.vdot(@n) + v = ray.dir.vdot(@n) + v0 = v + if v < 0.0 then + v0 = -v + end + if v0 < 1.0e-17 then + return + end + + t = -(ray.org.vdot(@n) + d) / v + + if t > 0.0 and t < isect.t then + isect.hit = true + isect.t = t + isect.n = @n + isect.pl = Vec.new(ray.org.x + t * ray.dir.x, + ray.org.y + t * ray.dir.y, + ray.org.z + t * ray.dir.z) + end + nil + end +end + +class Ray + def initialize(org, dir) + @org = org + @dir = dir + end + + attr_accessor :org, :dir +end + +class Isect + def initialize + @t = 10000000.0 + @hit = false + @pl = Vec.new(0.0, 0.0, 0.0) + @n = Vec.new(0.0, 0.0, 0.0) + end + + attr_accessor :t, :hit, :pl, :n +end + +def clamp(f) + i = f * 255.5 + if i > 255.0 then + i = 255.0 + end + if i < 0.0 then + i = 0.0 + end + i.to_i +end + +def otherBasis(basis, n) + basis[2] = Vec.new(n.x, n.y, n.z) + basis[1] = Vec.new(0.0, 0.0, 0.0) + + if n.x < 0.6 and n.x > -0.6 then + basis[1].x = 1.0 + elsif n.y < 0.6 and n.y > -0.6 then + basis[1].y = 1.0 + elsif n.z < 0.6 and n.z > -0.6 then + basis[1].z = 1.0 + else + basis[1].x = 1.0 + end + + basis[0] = basis[1].vcross(basis[2]) + basis[0] = basis[0].vnormalize + + basis[1] = basis[2].vcross(basis[0]) + basis[1] = basis[1].vnormalize +end + +class Scene + def initialize + @spheres = Array.new + @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5) + @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5) + @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5) + @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0)) + end + + def ambient_occlusion(isect) + basis = Array.new + otherBasis(basis, isect.n) + + ntheta = NAO_SAMPLES + nphi = NAO_SAMPLES + eps = 0.0001 + occlusion = 0.0 + + p0 = Vec.new(isect.pl.x + eps * isect.n.x, + isect.pl.y + eps * isect.n.y, + isect.pl.z + eps * isect.n.z) + nphi.times do |j| + ntheta.times do |i| + r = rand + phi = 2.0 * 3.14159265 * rand + x = Math.cos(phi) * Math.sqrt(1.0 - r) + y = Math.sin(phi) * Math.sqrt(1.0 - r) + z = Math.sqrt(r) + + rx = x * basis[0].x + y * basis[1].x + z * basis[2].x + ry = x * basis[0].y + y * basis[1].y + z * basis[2].y + rz = x * basis[0].z + y * basis[1].z + z * basis[2].z + + raydir = Vec.new(rx, ry, rz) + ray = Ray.new(p0, raydir) + + occisect = Isect.new + @spheres[0].intersect(ray, occisect) + @spheres[1].intersect(ray, occisect) + @spheres[2].intersect(ray, occisect) + @plane.intersect(ray, occisect) + if occisect.hit then + occlusion = occlusion + 1.0 + else + 0.0 + end + end + end + + occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f) + + Vec.new(occlusion, occlusion, occlusion) + end + + def render(w, h, nsubsamples) + cnt = 0 + nsf = nsubsamples.to_f + h.times do |y| + w.times do |x| + rad = Vec.new(0.0, 0.0, 0.0) + + # Subsampling + nsubsamples.times do |v| + nsubsamples.times do |u| + + cnt = cnt + 1 + wf = w.to_f + hf = h.to_f + xf = x.to_f + yf = y.to_f + uf = u.to_f + vf = v.to_f + + px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0) + py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0) + + eye = Vec.new(px, py, -1.0).vnormalize + + ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye) + + isect = Isect.new + @spheres[0].intersect(ray, isect) + @spheres[1].intersect(ray, isect) + @spheres[2].intersect(ray, isect) + @plane.intersect(ray, isect) + if isect.hit then + col = ambient_occlusion(isect) + rad.x = rad.x + col.x + rad.y = rad.y + col.y + rad.z = rad.z + col.z + end + end + end + + r = rad.x / (nsf * nsf) + g = rad.y / (nsf * nsf) + b = rad.z / (nsf * nsf) + printf("%c", clamp(r)) + printf("%c", clamp(g)) + printf("%c", clamp(b)) + end + nil + end + + nil + end +end + +alias printf_orig printf +def printf *args + # $fp.printf(*args) +end + +# File.open("ao.ppm", "w") do |fp| + # $fp = fp + printf("P6\n") + printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT) + printf("255\n") + Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES) +# end + +undef printf +alias printf printf_orig diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml new file mode 100644 index 0000000000..31e29b7644 --- /dev/null +++ b/benchmark/app_erb.yml @@ -0,0 +1,23 @@ +# +# Create many HTML strings with ERB. +# +prelude: | + require 'erb' + + data = <<erb + <html> + <head> <%= title %> </head> + <body> + <h1> <%= title %> </h1> + <p> + <%= content %> + </p> + </body> + </html> + erb + + title = "hello world!" + content = "hello world!\n" * 10 +benchmark: + app_erb: ERB.new(data).result(binding) +loop_count: 15000 diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb new file mode 100644 index 0000000000..45f471dfdb --- /dev/null +++ b/benchmark/app_factorial.rb @@ -0,0 +1,11 @@ +def fact(n) + if(n > 1) + n * fact(n-1) + else + 1 + end +end + +100.times { + fact(5000) +} diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb new file mode 100644 index 0000000000..34a7b2e725 --- /dev/null +++ b/benchmark/app_fib.rb @@ -0,0 +1,10 @@ +def fib n + if n < 3 + 1 + else + fib(n-1) + fib(n-2) + end +end + +fib(34) + diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb new file mode 100644 index 0000000000..f09574bbeb --- /dev/null +++ b/benchmark/app_lc_fizzbuzz.rb @@ -0,0 +1,52 @@ +# +# FizzBuzz program using only lambda calculus +# +# This program is quoted from +# "Understanding Computation" by Tom Stuart +# http://computationbook.com/ +# +# You can understand why this program works fine by reading this book. +# + +solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }] + +FIRST = -> l { LEFT[RIGHT[l]] } +IF = -> b { b } +LEFT = -> p { p[-> x { -> y { x } } ] } +RIGHT = -> p { p[-> x { -> y { y } } ] } +IS_EMPTY = LEFT +REST = -> l { RIGHT[RIGHT[l]] } + +def to_integer(proc) + proc[-> n { n + 1 }][0] +end + +def to_boolean(proc) + IF[proc][true][false] +end + +def to_array(proc) + array = [] + + until to_boolean(IS_EMPTY[proc]) + array.push(FIRST[proc]) + proc = REST[proc] + end + + array +end + +def to_char(c) + '0123456789BFiuz'.slice(to_integer(c)) +end + +def to_string(s) + to_array(s).map { |c| to_char(c) }.join +end + +answer = to_array(solution).map do |p| + to_string(p) +end + +answer_ary = answer.to_a +# puts answer_ary diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb new file mode 100644 index 0000000000..801b75e8e2 --- /dev/null +++ b/benchmark/app_mandelbrot.rb @@ -0,0 +1,23 @@ +require 'complex' + +def mandelbrot? z + i = 0 + while i<100 + i += 1 + z = z * z + return false if z.abs > 2 + end + true +end + +ary = [] + +(0..1000).each{|dx| + (0..1000).each{|dy| + x = dx / 50.0 + y = dy / 50.0 + c = Complex(x, y) + ary << c if mandelbrot?(c) + } +} + diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb new file mode 100644 index 0000000000..47be7b203f --- /dev/null +++ b/benchmark/app_pentomino.rb @@ -0,0 +1,130 @@ +#!/usr/local/bin/ruby +# This program is contributed by Shin Nishiyama + + +# modified by K.Sasada + +NP = 5 +ROW = 8 + NP +COL = 8 + +$p = [] +$b = [] +$no = 0 + +def piece(n, a, nb) + nb.each{|x| + a[n] = x + if n == NP-1 + $p << [a.sort] + else + nbc=nb.dup + [-ROW, -1, 1, ROW].each{|d| + if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) + nbc << x+d + end + } + nbc.delete x + piece(n+1,a[0..n],nbc) + end + } +end + +def kikaku(a) + a.collect {|x| x - a[0]} +end +def ud(a) + kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) +end +def rl(a) + kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) +end +def xy(a) + kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) +end + +def mkpieces + piece(0,[],[0]) + $p.each do |a| + a0 = a[0] + a[1] = ud(a0) + a[2] = rl(a0) + a[3] = ud(rl(a0)) + a[4] = xy(a0) + a[5] = ud(xy(a0)) + a[6] = rl(xy(a0)) + a[7] = ud(rl(xy(a0))) + a.sort! + a.uniq! + end + $p.uniq!.sort! {|x,y| x[0] <=> y[0] } +end + +def mkboard + (0...ROW*COL).each{|i| + if i % ROW >= ROW-NP + $b[i] = -2 + else + $b[i] = -1 + end + $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 + } +end + +def pboard + return # skip print + print "No. #$no\n" + (0...COL).each{|i| + print "|" + (0...ROW-NP).each{|j| + x = $b[i*ROW+j] + if x < 0 + print "..|" + else + printf "%2d|",x+1 + end + } + print "\n" + } + print "\n" +end + +$pnum=[] +def setpiece(a,pos) + if a.length == $p.length then + $no += 1 + pboard + return + end + while $b[pos] != -1 + pos += 1 + end + ($pnum - a).each do |i| + $p[i].each do |x| + f = 0 + x.each{|s| + if $b[pos+s] != -1 + f=1 + break + end + } + if f == 0 then + x.each{|s| + $b[pos+s] = i + } + a << i + setpiece(a.dup, pos) + a.pop + x.each{|s| + $b[pos+s] = -1 + } + end + end + end +end + +mkpieces +mkboard +$p[4] = [$p[4][0]] +$pnum = (0...$p.length).to_a +setpiece([],0) diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb new file mode 100644 index 0000000000..5db8f95d50 --- /dev/null +++ b/benchmark/app_raise.rb @@ -0,0 +1,8 @@ +i = 0 +while i<300000 + i += 1 + begin + raise + rescue + end +end diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb new file mode 100644 index 0000000000..7eed7c1aed --- /dev/null +++ b/benchmark/app_strconcat.rb @@ -0,0 +1,5 @@ +i = 0 +while i<2_000_000 + "#{1+1} #{1+1} #{1+1}" + i += 1 +end diff --git a/benchmark/app_tak.rb b/benchmark/app_tak.rb new file mode 100644 index 0000000000..efe5380f4e --- /dev/null +++ b/benchmark/app_tak.rb @@ -0,0 +1,13 @@ + +def tak x, y, z + unless y < x + z + else + tak( tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) + end +end + +tak(18, 9, 0) + diff --git a/benchmark/app_tarai.rb b/benchmark/app_tarai.rb new file mode 100644 index 0000000000..4c146f5ccf --- /dev/null +++ b/benchmark/app_tarai.rb @@ -0,0 +1,10 @@ +def tarai( x, y, z ) + if x <= y + then y + else tarai(tarai(x-1, y, z), + tarai(y-1, z, x), + tarai(z-1, x, y)) + end +end + +tarai(12, 6, 0) diff --git a/benchmark/app_uri.rb b/benchmark/app_uri.rb new file mode 100644 index 0000000000..586edfd5dc --- /dev/null +++ b/benchmark/app_uri.rb @@ -0,0 +1,8 @@ +require 'uri' + +100_000.times{ + uri = URI.parse('http://www.ruby-lang.org') + uri.scheme + uri.host + uri.port +} diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml new file mode 100644 index 0000000000..88ef544ba0 --- /dev/null +++ b/benchmark/array_flatten.yml @@ -0,0 +1,19 @@ +prelude: | + small_flat_ary = 5.times.to_a + large_flat_ary = 100.times.to_a + small_pairs_ary = [[1, 2]] * 5 + large_pairs_ary = [[1, 2]] * 100 + mostly_flat_ary = 100.times.to_a.push([101, 102]) + +benchmark: + small_flat_ary.flatten: small_flat_ary.flatten + small_flat_ary.flatten!: small_flat_ary.flatten! + large_flat_ary.flatten: large_flat_ary.flatten + large_flat_ary.flatten!: large_flat_ary.flatten! + small_pairs_ary.flatten: small_pairs_ary.flatten + small_pairs_ary.flatten!: small_pairs_ary.dup.flatten! + large_pairs_ary.flatten: large_pairs_ary.flatten + large_pairs_ary.flatten!: large_pairs_ary.dup.flatten! + mostly_flat_ary.flatten: mostly_flat_ary.flatten + mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten! +loop_count: 10000 diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml new file mode 100644 index 0000000000..26705323fd --- /dev/null +++ b/benchmark/array_intersection.yml @@ -0,0 +1,14 @@ +prelude: | + small1 = [1, 2, 3] + small2 = [1, 2, 3, 4, 5] + small3 = [2, 3, 4, 5] + small4 = [2] + big1 = [1, 2, 3, 4] * 64 + big2 = [1, 2, 3] * 64 + big3 = [1, 2] * 64 + +benchmark: + small-&: small1 & small2 & small3 & small4 + small-intersection: small1.intersection(small2, small3, small4) + big-&: big1 & big2 & big3 + big-intersection: big1.intersection(big2, big3) diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml new file mode 100644 index 0000000000..ace1ae2e14 --- /dev/null +++ b/benchmark/array_max_float.yml @@ -0,0 +1,30 @@ +prelude: | + ary2 = 2.times.map(&:to_f).shuffle + ary10 = 10.times.map(&:to_f).shuffle + ary100 = 100.times.map(&:to_f).shuffle + ary500 = 500.times.map(&:to_f).shuffle + ary1000 = 1000.times.map(&:to_f).shuffle + ary2000 = 2500.times.map(&:to_f).shuffle + ary3000 = 2500.times.map(&:to_f).shuffle + ary5000 = 5000.times.map(&:to_f).shuffle + ary10000 = 10000.times.map(&:to_f).shuffle + ary20000 = 20000.times.map(&:to_f).shuffle + ary50000 = 50000.times.map(&:to_f).shuffle + ary100000 = 100000.times.map(&:to_f).shuffle + +benchmark: + ary2.max: ary2.max + ary10.max: ary10.max + ary100.max: ary100.max + ary500.max: ary500.max + ary1000.max: ary1000.max + ary2000.max: ary2000.max + ary3000.max: ary3000.max + ary5000.max: ary5000.max + ary10000.max: ary10000.max + ary20000.max: ary20000.max + ary50000.max: ary50000.max + ary100000.max: ary100000.max + +loop_count: 10000 + diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml new file mode 100644 index 0000000000..acd83684d0 --- /dev/null +++ b/benchmark/array_max_int.yml @@ -0,0 +1,31 @@ +prelude: | + ary2 = 2.times.to_a.shuffle + ary10 = 10.times.to_a.shuffle + ary100 = 100.times.to_a.shuffle + ary500 = 500.times.to_a.shuffle + ary1000 = 1000.times.to_a.shuffle + ary2000 = 2500.times.to_a.shuffle + ary3000 = 2500.times.to_a.shuffle + ary5000 = 5000.times.to_a.shuffle + ary10000 = 10000.times.to_a.shuffle + ary20000 = 20000.times.to_a.shuffle + ary50000 = 50000.times.to_a.shuffle + ary100000 = 100000.times.to_a.shuffle + ary1000000 = 1000000.times.to_a.shuffle + +benchmark: + ary2.max: ary2.max + ary10.max: ary10.max + ary100.max: ary100.max + ary500.max: ary500.max + ary1000.max: ary1000.max + ary2000.max: ary2000.max + ary3000.max: ary3000.max + ary5000.max: ary5000.max + ary10000.max: ary10000.max + ary20000.max: ary20000.max + ary50000.max: ary50000.max + ary100000.max: ary100000.max + ary1000000.max: ary1000000.max + +loop_count: 10000 diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml new file mode 100644 index 0000000000..2aeed010f2 --- /dev/null +++ b/benchmark/array_max_str.yml @@ -0,0 +1,30 @@ +prelude: | + ary2 = 2.times.map(&:to_s).shuffle + ary10 = 10.times.map(&:to_s).shuffle + ary100 = 100.times.map(&:to_s).shuffle + ary500 = 500.times.map(&:to_s).shuffle + ary1000 = 1000.times.map(&:to_s).shuffle + ary2000 = 2500.times.map(&:to_s).shuffle + ary3000 = 2500.times.map(&:to_s).shuffle + ary5000 = 5000.times.map(&:to_s).shuffle + ary10000 = 10000.times.map(&:to_s).shuffle + ary20000 = 20000.times.map(&:to_s).shuffle + ary50000 = 50000.times.map(&:to_s).shuffle + ary100000 = 100000.times.map(&:to_s).shuffle + +benchmark: + ary2.max: ary2.max + ary10.max: ary10.max + ary100.max: ary100.max + ary500.max: ary500.max + ary1000.max: ary1000.max + ary2000.max: ary2000.max + ary3000.max: ary3000.max + ary5000.max: ary5000.max + ary10000.max: ary10000.max + ary20000.max: ary20000.max + ary50000.max: ary50000.max + ary100000.max: ary100000.max + +loop_count: 10000 + diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml new file mode 100644 index 0000000000..53e5072b14 --- /dev/null +++ b/benchmark/array_min.yml @@ -0,0 +1,31 @@ +prelude: | + ary2 = 2.times.to_a.shuffle + ary10 = 10.times.to_a.shuffle + ary100 = 100.times.to_a.shuffle + ary500 = 500.times.to_a.shuffle + ary1000 = 1000.times.to_a.shuffle + ary2000 = 2500.times.to_a.shuffle + ary3000 = 2500.times.to_a.shuffle + ary5000 = 5000.times.to_a.shuffle + ary10000 = 10000.times.to_a.shuffle + ary20000 = 20000.times.to_a.shuffle + ary50000 = 50000.times.to_a.shuffle + ary100000 = 100000.times.to_a.shuffle + ary1000000 = 1000000.times.to_a.shuffle + +benchmark: + ary2.min: ary2.min + ary10.min: ary10.min + ary100.min: ary100.min + ary500.min: ary500.min + ary1000.min: ary1000.min + ary2000.min: ary2000.min + ary3000.min: ary3000.min + ary5000.min: ary5000.min + ary10000.min: ary10000.min + ary20000.min: ary20000.min + ary50000.min: ary50000.min + ary100000.min: ary100000.min + ary1000000.min: ary1000000.min + +loop_count: 10000 diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml new file mode 100644 index 0000000000..1cd2b34794 --- /dev/null +++ b/benchmark/array_sample.yml @@ -0,0 +1,4 @@ +prelude: ary = (1..10_000).to_a +benchmark: + - ary.sample + - ary.sample(2) diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb new file mode 100644 index 0000000000..5f41ecc32b --- /dev/null +++ b/benchmark/array_sample_100k_10.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 10} diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb new file mode 100644 index 0000000000..18b1715319 --- /dev/null +++ b/benchmark/array_sample_100k_11.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 11} diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb new file mode 100644 index 0000000000..22863afe89 --- /dev/null +++ b/benchmark/array_sample_100k__100.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 100} diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb new file mode 100644 index 0000000000..4cd79e6c67 --- /dev/null +++ b/benchmark/array_sample_100k__1k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 1000} diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb new file mode 100644 index 0000000000..b3d264249e --- /dev/null +++ b/benchmark/array_sample_100k__6k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 6000} diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb new file mode 100644 index 0000000000..5dd55ec058 --- /dev/null +++ b/benchmark/array_sample_100k___10k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 10_000} diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb new file mode 100644 index 0000000000..1506732c3c --- /dev/null +++ b/benchmark/array_sample_100k___50k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 50_000} diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb new file mode 100644 index 0000000000..798bb9e3f4 --- /dev/null +++ b/benchmark/array_shift.rb @@ -0,0 +1,14 @@ +require 'benchmark' + +Benchmark.bm do |x| + [10_000,1_000_000,100_000_000].each do |n| + ary = Array.new(n,0) + GC.start + x.report("#{n}:shift"){ ary.shift } + (0..4).each do |i| + ary = Array.new(n,0) + GC.start + x.report("#{n}:shift(#{i})"){ ary.shift(i) } + end + end +end diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb new file mode 100644 index 0000000000..e53a6edae6 --- /dev/null +++ b/benchmark/array_small_and.rb @@ -0,0 +1,17 @@ +MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i +MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i +ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i + +ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1| + (MIN_SIZE..MAX_SIZE).map do |size2| + [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }] + end +end + +ITERATIONS.times do + ARRAYS.each do |group| + group.each do |arr1, arr2| + arr1 & arr2 + end + end +end diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb new file mode 100644 index 0000000000..9661ee48db --- /dev/null +++ b/benchmark/array_small_diff.rb @@ -0,0 +1,17 @@ +MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i +MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i +ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i + +ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1| + (MIN_SIZE..MAX_SIZE).map do |size2| + [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }] + end +end + +ITERATIONS.times do + ARRAYS.each do |group| + group.each do |arr1, arr2| + arr1 - arr2 + end + end +end diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb new file mode 100644 index 0000000000..c58b5fd1ff --- /dev/null +++ b/benchmark/array_small_or.rb @@ -0,0 +1,17 @@ +MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i +MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i +ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i + +ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1| + (MIN_SIZE..MAX_SIZE).map do |size2| + [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }] + end +end + +ITERATIONS.times do + ARRAYS.each do |group| + group.each do |arr1, arr2| + arr1 | arr2 + end + end +end diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb new file mode 100644 index 0000000000..3579786056 --- /dev/null +++ b/benchmark/array_sort_block.rb @@ -0,0 +1,2 @@ +ary = Array.new(1000) { rand(1000) } +10000.times { ary.sort { |a, b| a <=> b } } diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb new file mode 100644 index 0000000000..9a6e2f8bd2 --- /dev/null +++ b/benchmark/array_sort_float.rb @@ -0,0 +1,2 @@ +arr = Array.new(1000) { rand } +10000.times { arr.sort } diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb new file mode 100644 index 0000000000..6cb394cb9f --- /dev/null +++ b/benchmark/array_values_at_int.rb @@ -0,0 +1,2 @@ +ary = Array.new(10000) {|i| i} +100000.times { ary.values_at(500) } diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb new file mode 100644 index 0000000000..5b53806d1c --- /dev/null +++ b/benchmark/array_values_at_range.rb @@ -0,0 +1,2 @@ +ary = Array.new(10000) {|i| i} +100000.times { ary.values_at(1..2000) } diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml new file mode 100644 index 0000000000..82134cdf9b --- /dev/null +++ b/benchmark/attr_accessor.yml @@ -0,0 +1,29 @@ +prelude: | + class C + attr_accessor :x + def initialize + @x = nil + end + class_eval <<-END + def ar + #{'x;'*256} + end + def aw + #{'self.x = nil;'*256} + end + def arm + m = method(:x) + #{'m.call;'*256} + end + def awm + m = method(:x=) + #{'m.call(nil);'*256} + end + END + end + obj = C.new +benchmark: + attr_reader: "obj.ar" + attr_writer: "obj.aw" + attr_reader_method: "obj.arm" + attr_writer_method: "obj.awm" diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb new file mode 100644 index 0000000000..e2ad5a5c94 --- /dev/null +++ b/benchmark/bighash.rb @@ -0,0 +1 @@ +h = {}; 5000000.times {|n| h[n] = n } diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml new file mode 100644 index 0000000000..e375dcf85d --- /dev/null +++ b/benchmark/buffer_get.yml @@ -0,0 +1,9 @@ +benchmark: + - name: buffer.get + prelude: buffer = IO::Buffer.new(32, IO::Buffer::MAPPED) + script: buffer.get(:U32, 0) + loop_count: 20000000 + - name: string.unpack + prelude: string = "\0" * 32 + script: string.unpack("C") + loop_count: 20000000 diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml new file mode 100644 index 0000000000..af6abd08ac --- /dev/null +++ b/benchmark/cgi_escape_html.yml @@ -0,0 +1,40 @@ +prelude: require 'cgi/escape' +benchmark: + - name: escape_html_blank + prelude: str = "" + script: CGI.escapeHTML(str) + loop_count: 20000000 + - name: escape_html_short_none + prelude: str = "abcde" + script: CGI.escapeHTML(str) + loop_count: 20000000 + - name: escape_html_short_one + prelude: str = "abcd<" + script: CGI.escapeHTML(str) + loop_count: 20000000 + - name: escape_html_short_all + prelude: str = "'&\"<>" + script: CGI.escapeHTML(str) + loop_count: 5000000 + - name: escape_html_long_none + prelude: str = "abcde" * 300 + script: CGI.escapeHTML(str) + loop_count: 1000000 + - name: escape_html_long_all + prelude: str = "'&\"<>" * 10 + script: CGI.escapeHTML(str) + loop_count: 1000000 + - name: escape_html_real + prelude: | # http://example.com/ + str = <<~HTML + <body> + <div> + <h1>Example Domain</h1> + <p>This domain is established to be used for illustrative examples in documents. You may use this + domain in examples without prior coordination or asking for permission.</p> + <p><a href="http://www.iana.org/domains/example">More information...</a></p> + </div> + </body> + HTML + script: CGI.escapeHTML(str) + loop_count: 1000000 diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml new file mode 100644 index 0000000000..d0150c5e5b --- /dev/null +++ b/benchmark/complex_float_add.yml @@ -0,0 +1,7 @@ +prelude: | + max, min = 1000.0, -1000.0 + a = Complex(rand(max)+min, rand(max)+min) + b = Complex(rand(max)+min, rand(max)+min) +benchmark: + complex_float_add: c = a + b +loop_count: 1000000 diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml new file mode 100644 index 0000000000..b9f5e1d51c --- /dev/null +++ b/benchmark/complex_float_div.yml @@ -0,0 +1,7 @@ +prelude: | + max, min = 1000.0, -1000.0 + a = Complex(rand(max)+min, rand(max)+min) + b = Complex(rand(max)+min, rand(max)+min) +benchmark: + complex_float_div: c = a / b +loop_count: 1000000 diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml new file mode 100644 index 0000000000..59b096a6dc --- /dev/null +++ b/benchmark/complex_float_mul.yml @@ -0,0 +1,7 @@ +prelude: | + max, min = 1000.0, -1000.0 + a = Complex(rand(max)+min, rand(max)+min) + b = Complex(rand(max)+min, rand(max)+min) +benchmark: + complex_float_mul: c = a * b +loop_count: 1000000 diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml new file mode 100644 index 0000000000..6fcde3125b --- /dev/null +++ b/benchmark/complex_float_new.yml @@ -0,0 +1,7 @@ +prelude: | + max, min = 1000.0, -1000.0 + a = Complex(rand(max)+min, rand(max)+min) + b = Complex(rand(max)+min, rand(max)+min) +benchmark: + complex_float_new: c = Complex(a, b) +loop_count: 1000000 diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml new file mode 100644 index 0000000000..c40a31ab55 --- /dev/null +++ b/benchmark/complex_float_power.yml @@ -0,0 +1,7 @@ +prelude: | + max, min = 1000.0, -1000.0 + a = Complex(rand(max)+min, rand(max)+min) + b = Complex(rand(max)+min, rand(max)+min) +benchmark: + complex_float_power: c = a ** b +loop_count: 1000000 diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml new file mode 100644 index 0000000000..3fafe7cdbe --- /dev/null +++ b/benchmark/complex_float_sub.yml @@ -0,0 +1,7 @@ +prelude: | + max, min = 1000.0, -1000.0 + a = Complex(rand(max)+min, rand(max)+min) + b = Complex(rand(max)+min, rand(max)+min) +benchmark: + complex_float_sub: c = a - b +loop_count: 1000000 diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb new file mode 100644 index 0000000000..8329c757cf --- /dev/null +++ b/benchmark/dir_empty_p.rb @@ -0,0 +1,5 @@ +require 'tmpdir' +max = 100_000 +Dir.mktmpdir('bm_dir_empty_p') do |dir| + max.times { Dir.empty?(dir) } +end diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml new file mode 100644 index 0000000000..0ee390a441 --- /dev/null +++ b/benchmark/enum_lazy_flat_map.yml @@ -0,0 +1,16 @@ +prelude: | + num = (1..).lazy.take(100) + ary2 = [[1,2]].cycle.lazy.take(10) + ary10 = [[*1..10]].cycle.lazy.take(10) + ary20 = [[*1..20]].cycle.lazy.take(10) + ary50 = [[*1..50]].cycle.lazy.take(10) + ary100 = [[*1..100]].cycle.lazy.take(10) + +benchmark: + num3: num.flat_map {|x| x}.take(3).to_a + num10: num.flat_map {|x| x}.take(3).to_a + ary2: ary2.flat_map {|x| x}.take(3).to_a + ary10: ary10.flat_map {|x| x}.take(3).to_a + ary20: ary20.flat_map {|x| x}.take(3).to_a + ary50: ary50.flat_map {|x| x}.take(3).to_a + ary100: ary100.flat_map {|x| x}.take(3).to_a diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb new file mode 100644 index 0000000000..8832392e65 --- /dev/null +++ b/benchmark/enum_lazy_grep_v_100.rb @@ -0,0 +1,4 @@ +grep_data = (1..10).to_a * 1000 +N = 100 +enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0}) +N.times {enum.each {}} diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb new file mode 100644 index 0000000000..329509fa8f --- /dev/null +++ b/benchmark/enum_lazy_grep_v_20.rb @@ -0,0 +1,4 @@ +grep_data = (1..10).to_a * 1000 +N = 100 +enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2}) +N.times {enum.each {}} diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb new file mode 100644 index 0000000000..02ea4d4e71 --- /dev/null +++ b/benchmark/enum_lazy_grep_v_50.rb @@ -0,0 +1,4 @@ +grep_data = (1..10).to_a * 1000 +N = 100 +enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5}) +N.times {enum.each {}} diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb new file mode 100644 index 0000000000..2e6434d9c4 --- /dev/null +++ b/benchmark/enum_lazy_uniq_100.rb @@ -0,0 +1,4 @@ +uniq_data = (1..10_000).to_a +N = 100 +enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000} +N.times {enum.each {}} diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb new file mode 100644 index 0000000000..75e6398fee --- /dev/null +++ b/benchmark/enum_lazy_uniq_20.rb @@ -0,0 +1,4 @@ +uniq_data = (1..10_000).to_a +N = 100 +enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000} +N.times {enum.each {}} diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb new file mode 100644 index 0000000000..59a39b78ff --- /dev/null +++ b/benchmark/enum_lazy_uniq_50.rb @@ -0,0 +1,4 @@ +uniq_data = (1..10_000).to_a +N = 100 +enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000} +N.times {enum.each {}} diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml new file mode 100644 index 0000000000..4566ff0261 --- /dev/null +++ b/benchmark/enum_lazy_zip.yml @@ -0,0 +1,22 @@ +prelude: | + a = (1..3).lazy + b = a.map {|x| x} + +benchmark: + first_ary: a.zip(["a", "b", "c"]).first + first_nonary: a.zip("a".."c").first + first_noarg: a.zip.first + + take3_ary: a.zip(["a", "b", "c"]).take(3).force + take3_nonary: a.zip("a".."c").take(3).force + take3_noarg: a.zip.take(3).force + + chain-first_ary: b.zip(["a", "b", "c"]).first + chain-first_nonary: b.zip("a".."c").first + chain-first_noarg: b.zip.first + + chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force + chain-take3_nonary: b.zip("a".."c").take(3).force + chain-take3_noarg: b.zip.take(3).force + + block: a.zip("a".."c") {|x, y| [x, y]} diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml new file mode 100644 index 0000000000..edd2e040a0 --- /dev/null +++ b/benchmark/enum_tally.yml @@ -0,0 +1,4 @@ +prelude: | + list = ("aaa".."zzz").to_a*10 +benchmark: + tally: list.tally diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml new file mode 100644 index 0000000000..15f6c3880b --- /dev/null +++ b/benchmark/erb_render.yml @@ -0,0 +1,24 @@ +prelude: | + require 'erb' + + data = <<erb + <html> + <head> <%= title %> </head> + <body> + <h1> <%= title %> </h1> + <p> + <%= content %> + </p> + </body> + </html> + erb + + title = "hello world!" + content = "hello world!\n" * 10 + + src = "def self.render(title, content); #{ERB.new(data).src}; end" + mod = Module.new + mod.instance_eval(src, "(ERB)") +benchmark: + erb_render: mod.render(title, content) +loop_count: 1500000 diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml new file mode 100644 index 0000000000..a36c759f8e --- /dev/null +++ b/benchmark/fiber_chain.yml @@ -0,0 +1,36 @@ +prelude: | + def make_link(previous) + Fiber.new do + while message = previous.resume + Fiber.yield(message) + end + end + end + + def make_chain(length = 1000, &block) + chain = Fiber.new(&block) + + (length - 1).times do + chain = make_link(chain) + end + + return chain + end + + message = "Hello World!" + + chain = make_chain do + while true + Fiber.yield(message) + end + end +benchmark: + make_chain: | + make_chain(100) do + while true + Fiber.yield(message) + end + end + resume_chain: | + chain.resume +loop_count: 5000 diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml new file mode 100644 index 0000000000..8588686477 --- /dev/null +++ b/benchmark/fiber_locals.yml @@ -0,0 +1,8 @@ +prelude: | + th = Thread.current + th[:key] = :val +benchmark: + key?: th.key?(:key) + []: th[:key] + keys: th.keys +loop_count: 1_000_000 diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb new file mode 100644 index 0000000000..1cd4760c9d --- /dev/null +++ b/benchmark/file_chmod.rb @@ -0,0 +1,9 @@ +# chmod file +require 'tempfile' +max = 200_000 +tmp = Tempfile.new('chmod') +path = tmp.path +max.times do + File.chmod(0777, path) +end +tmp.close! diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb new file mode 100644 index 0000000000..bbb44aebac --- /dev/null +++ b/benchmark/file_rename.rb @@ -0,0 +1,11 @@ +# rename file +require 'tempfile' + +max = 100_000 +tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ] +a, b = tmp.map { |x| x.path } +tmp.each { |t| t.close } # Windows can't rename files without closing them +max.times do + File.rename(a, b) + File.rename(b, a) +end diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml new file mode 100644 index 0000000000..56ea41effc --- /dev/null +++ b/benchmark/float_methods.yml @@ -0,0 +1,14 @@ +prelude: | + flo = 4.2 +benchmark: + to_f: | + flo.to_f + abs: | + flo.abs + magnitude: | + flo.magnitude + -@: | + -flo + zero?: | + flo.zero? +loop_count: 20000000 diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml new file mode 100644 index 0000000000..172db1bf6d --- /dev/null +++ b/benchmark/float_neg_posi.yml @@ -0,0 +1,8 @@ +prelude: | + flo = 4.2 +benchmark: + negative?: | + flo.negative? + positive?: | + flo.positive? +loop_count: 20000000 diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml new file mode 100644 index 0000000000..0abae5cdb8 --- /dev/null +++ b/benchmark/float_to_s.yml @@ -0,0 +1,7 @@ +prelude: | + floats = [*0.0.step(1.0, 0.0001)] + +benchmark: + to_s: floats.each {|f| f.to_s} + +loop_count: 1000 diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb new file mode 100644 index 0000000000..275f58b924 --- /dev/null +++ b/benchmark/gc/aobench.rb @@ -0,0 +1 @@ +require_relative '../app_aobench' diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb new file mode 100644 index 0000000000..83347cdd20 --- /dev/null +++ b/benchmark/gc/binary_trees.rb @@ -0,0 +1 @@ +require_relative '../so_binary_trees' diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb new file mode 100644 index 0000000000..23d0b91c6c --- /dev/null +++ b/benchmark/gc/gcbench.rb @@ -0,0 +1,57 @@ +require 'benchmark' +require 'pp' +require 'optparse' + +$list = true +$gcprof = false + +opt = OptionParser.new +opt.on('-q'){$list = false} +opt.on('-d'){$gcprof = false} +opt.on('-p'){$gcprof = true} +opt.parse!(ARGV) + +script = File.join(File.dirname(__FILE__), ARGV.shift) +script += '.rb' unless FileTest.exist?(script) +raise "#{script} not found" unless FileTest.exist?(script) + +puts "Script: #{script}" + +if $gcprof + GC::Profiler.enable +end + +tms = Benchmark.measure{|x| + load script +} + +gc_time = 0 + +if $gcprof + gc_time = GC::Profiler.total_time + GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop + GC::Profiler.disable +end + +pp GC.stat + +puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS) + +desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}" +name = File.basename(script, '.rb') + +puts +puts script +puts Benchmark::CAPTION +puts tms +puts "GC total time (sec): #{gc_time}" + +# show High-Water Mark on Linux +if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status') + puts + puts "VmHWM: #{$1.chomp}" +end + +puts +puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}" +puts " (real time in sec, GC time in sec, GC count)" diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb new file mode 100644 index 0000000000..cb030d458d --- /dev/null +++ b/benchmark/gc/hash1.rb @@ -0,0 +1,11 @@ +value = 0.01 +h = {} +n = 50_000 + +1.upto(n){|i| + h["%020d" % i] = "v-#{i}" +} + +(n * 1_000).times{ + '' +} diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb new file mode 100644 index 0000000000..e8c943fb21 --- /dev/null +++ b/benchmark/gc/hash2.rb @@ -0,0 +1,7 @@ +value = 0.01 +h = {} +n = 4*(10**6) + +1.upto(n){|i| + h["%020d" % i] = value * i +} diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb new file mode 100644 index 0000000000..c05a79f561 --- /dev/null +++ b/benchmark/gc/null.rb @@ -0,0 +1 @@ +# null diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb new file mode 100644 index 0000000000..8ebdff7d1d --- /dev/null +++ b/benchmark/gc/pentomino.rb @@ -0,0 +1 @@ +require_relative '../app_pentomino' diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb new file mode 100644 index 0000000000..14c89f5611 --- /dev/null +++ b/benchmark/gc/rdoc.rb @@ -0,0 +1,13 @@ +require 'rdoc/rdoc' +require 'tmpdir' + +srcdir = File.expand_path('../..', __dir__) + +Dir.mktmpdir('rdocbench-'){|d| + dir = File.join(d, 'rdocbench') + args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir}) + args << '--op' << dir + + r = RDoc::RDoc.new + r.document args +} diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb new file mode 100644 index 0000000000..c66290140a --- /dev/null +++ b/benchmark/gc/redblack.rb @@ -0,0 +1,366 @@ +# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb +# License is License is Apache-2 + +require 'benchmark' + +# Algorithm based on "Introduction to Algorithms" by Cormen and others +class RedBlackTree + class Node + attr_accessor :color + attr_accessor :key + attr_accessor :left + attr_accessor :right + attr_accessor :parent + + RED = :red + BLACK = :black + COLORS = [RED, BLACK].freeze + + def initialize(key, color = RED) + raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color) + @color = color + @key = key + @left = @right = @parent = NilNode.instance + end + + def black? + return color == BLACK + end + + def red? + return color == RED + end + end + + class NilNode < Node + class << self + private :new + + # it's not thread safe + def instance + @instance ||= begin + def instance + return @instance + end + + new + end + end + end + + def initialize + self.color = BLACK + self.key = 0 + self.left = nil + self.right = nil + self.parent = nil + end + + def nil? + return true + end + end + + include Enumerable + + attr_accessor :root + attr_accessor :size + + def initialize + self.root = NilNode.instance + self.size = 0 + end + + def add(key) + insert(Node.new(key)) + end + + def insert(x) + insert_helper(x) + + x.color = Node::RED + while x != root && x.parent.color == Node::RED + if x.parent == x.parent.parent.left + y = x.parent.parent.right + if !y.nil? && y.color == Node::RED + x.parent.color = Node::BLACK + y.color = Node::BLACK + x.parent.parent.color = Node::RED + x = x.parent.parent + else + if x == x.parent.right + x = x.parent + left_rotate(x) + end + x.parent.color = Node::BLACK + x.parent.parent.color = Node::RED + right_rotate(x.parent.parent) + end + else + y = x.parent.parent.left + if !y.nil? && y.color == Node::RED + x.parent.color = Node::BLACK + y.color = Node::BLACK + x.parent.parent.color = Node::RED + x = x.parent.parent + else + if x == x.parent.left + x = x.parent + right_rotate(x) + end + x.parent.color = Node::BLACK + x.parent.parent.color = Node::RED + left_rotate(x.parent.parent) + end + end + end + root.color = Node::BLACK + end + + alias << insert + + def delete(z) + y = (z.left.nil? || z.right.nil?) ? z : successor(z) + x = y.left.nil? ? y.right : y.left + x.parent = y.parent + + if y.parent.nil? + self.root = x + else + if y == y.parent.left + y.parent.left = x + else + y.parent.right = x + end + end + + z.key = y.key if y != z + + if y.color == Node::BLACK + delete_fixup(x) + end + + self.size -= 1 + return y + end + + def minimum(x = root) + while !x.left.nil? + x = x.left + end + return x + end + + def maximum(x = root) + while !x.right.nil? + x = x.right + end + return x + end + + def successor(x) + if !x.right.nil? + return minimum(x.right) + end + y = x.parent + while !y.nil? && x == y.right + x = y + y = y.parent + end + return y + end + + def predecessor(x) + if !x.left.nil? + return maximum(x.left) + end + y = x.parent + while !y.nil? && x == y.left + x = y + y = y.parent + end + return y + end + + def inorder_walk(x = root) + x = self.minimum + while !x.nil? + yield x.key + x = successor(x) + end + end + + alias each inorder_walk + + def reverse_inorder_walk(x = root) + x = self.maximum + while !x.nil? + yield x.key + x = predecessor(x) + end + end + + alias reverse_each reverse_inorder_walk + + def search(key, x = root) + while !x.nil? && x.key != key + key < x.key ? x = x.left : x = x.right + end + return x + end + + def empty? + return self.root.nil? + end + + def black_height(x = root) + height = 0 + while !x.nil? + x = x.left + height +=1 if x.nil? || x.black? + end + return height + end + +private + + def left_rotate(x) + raise "x.right is nil!" if x.right.nil? + y = x.right + x.right = y.left + y.left.parent = x if !y.left.nil? + y.parent = x.parent + if x.parent.nil? + self.root = y + else + if x == x.parent.left + x.parent.left = y + else + x.parent.right = y + end + end + y.left = x + x.parent = y + end + + def right_rotate(x) + raise "x.left is nil!" if x.left.nil? + y = x.left + x.left = y.right + y.right.parent = x if !y.right.nil? + y.parent = x.parent + if x.parent.nil? + self.root = y + else + if x == x.parent.left + x.parent.left = y + else + x.parent.right = y + end + end + y.right = x + x.parent = y + end + + def insert_helper(z) + y = NilNode.instance + x = root + while !x.nil? + y = x + z.key < x.key ? x = x.left : x = x.right + end + z.parent = y + if y.nil? + self.root = z + else + z.key < y.key ? y.left = z : y.right = z + end + self.size += 1 + end + + def delete_fixup(x) + while x != root && x.color == Node::BLACK + if x == x.parent.left + w = x.parent.right + if w.color == Node::RED + w.color = Node::BLACK + x.parent.color = Node::RED + left_rotate(x.parent) + w = x.parent.right + end + if w.left.color == Node::BLACK && w.right.color == Node::BLACK + w.color = Node::RED + x = x.parent + else + if w.right.color == Node::BLACK + w.left.color = Node::BLACK + w.color = Node::RED + right_rotate(w) + w = x.parent.right + end + w.color = x.parent.color + x.parent.color = Node::BLACK + w.right.color = Node::BLACK + left_rotate(x.parent) + x = root + end + else + w = x.parent.left + if w.color == Node::RED + w.color = Node::BLACK + x.parent.color = Node::RED + right_rotate(x.parent) + w = x.parent.left + end + if w.right.color == Node::BLACK && w.left.color == Node::BLACK + w.color = Node::RED + x = x.parent + else + if w.left.color == Node::BLACK + w.right.color = Node::BLACK + w.color = Node::RED + left_rotate(w) + w = x.parent.left + end + w.color = x.parent.color + x.parent.color = Node::BLACK + w.left.color = Node::BLACK + right_rotate(x.parent) + x = root + end + end + end + x.color = Node::BLACK + end +end + +def rbt_bm + n = 100_000 + a1 = []; n.times { a1 << rand(999_999) } + a2 = []; n.times { a2 << rand(999_999) } + + start = Time.now + + tree = RedBlackTree.new + + n.times {|i| tree.add(i) } + n.times { tree.delete(tree.root) } + + tree = RedBlackTree.new + a1.each {|e| tree.add(e) } + a2.each {|e| tree.search(e) } + tree.inorder_walk {|key| key + 1 } + tree.reverse_inorder_walk {|key| key + 1 } + n.times { tree.minimum } + n.times { tree.maximum } + + return Time.now - start +end + +N = (ARGV[0] || 10).to_i + +N.times do + # puts rbt_bm.to_f + rbt_bm.to_f + # puts "GC.count = #{GC.count}" if GC.respond_to?(:count) +end diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb new file mode 100644 index 0000000000..be2c7b7250 --- /dev/null +++ b/benchmark/gc/ring.rb @@ -0,0 +1,29 @@ +# create many old objects + +max = 30_000_000 + +class Ring + attr_reader :next_ring + def initialize n = nil + @next_ring = n + end + + + def size + s = 1 + ring = self + while ring.next_ring + s += 1 + ring = ring.next_ring + end + s + end +end + +ring = Ring.new + +max.times{ + ring = Ring.new(ring) +} + +# p ring.size diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb new file mode 100644 index 0000000000..ac7a683d95 --- /dev/null +++ b/benchmark/hash_aref_array.rb @@ -0,0 +1,5 @@ +h = {} +arrays = (0..99).each_slice(10).to_a +#STDERR.puts arrays.inspect +arrays.each { |s| h[s] = s } +200_000.times { arrays.each { |s| h[s] } } diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb new file mode 100644 index 0000000000..af4f8c36d4 --- /dev/null +++ b/benchmark/hash_aref_dsym.rb @@ -0,0 +1,4 @@ +h = {} +syms = ('a'..'z').map { |s| s.to_sym } +syms.each { |s| h[s] = 1 } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb new file mode 100644 index 0000000000..9d7759379e --- /dev/null +++ b/benchmark/hash_aref_dsym_long.rb @@ -0,0 +1,21 @@ +# [ruby-core:70129] [Bug #11396] +collection_size = 200000 +sample_size = 10000 + +values = (1..collection_size).to_a.map do |x| + "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}" +end + +symbol_hash = {} + +values.each do |x| + symbol_hash[x.to_sym] = 1 +end + +# use the same samples each time to minimize deviations +rng = Random.new(0) +symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym) + +3000.times do + symbol_sample_array.each { |x| symbol_hash[x] } +end diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb new file mode 100644 index 0000000000..1346890582 --- /dev/null +++ b/benchmark/hash_aref_fix.rb @@ -0,0 +1,4 @@ +h = {} +nums = (1..26).to_a +nums.each { |i| h[i] = i } +200_000.times { nums.each { |s| h[s] } } diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb new file mode 100644 index 0000000000..2217274c82 --- /dev/null +++ b/benchmark/hash_aref_flo.rb @@ -0,0 +1,4 @@ +h = {} +strs = [*1..10000].map! {|i| i.fdiv(10)} +strs.each { |s| h[s] = s } +50.times { strs.each { |s| h[s] } } diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb new file mode 100644 index 0000000000..b0913dd4bb --- /dev/null +++ b/benchmark/hash_aref_miss.rb @@ -0,0 +1,5 @@ +h = {} +strs = ('a'..'z').to_a.map!(&:freeze) +strs.each { |s| h[s] = s } +strs = ('A'..'Z').to_a +200_000.times { strs.each { |s| h[s] } } diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb new file mode 100644 index 0000000000..19439b061b --- /dev/null +++ b/benchmark/hash_aref_str.rb @@ -0,0 +1,4 @@ +h = {} +strs = ('a'..'z').to_a.map!(&:freeze) +strs.each { |s| h[s] = s } +200_000.times { strs.each { |s| h[s] } } diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb new file mode 100644 index 0000000000..f75d163fe6 --- /dev/null +++ b/benchmark/hash_aref_sym.rb @@ -0,0 +1,9 @@ +h = {} +syms = ('a'..'z').to_a +begin + syms = eval("%i[#{syms.join(' ')}]") +rescue SyntaxError # <= 1.9.3 + syms.map!(&:to_sym) +end +syms.each { |s| h[s] = s } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb new file mode 100644 index 0000000000..9dab8df7be --- /dev/null +++ b/benchmark/hash_aref_sym_long.rb @@ -0,0 +1,13 @@ +h = {} +syms = %w[puts warn syswrite write stat bacon lettuce tomato +some symbols in this array may already be interned others should not be +hash browns make good breakfast but not cooked using prime numbers +shift for division entries delete_if keys exist? +] +begin + syms = eval("%i[#{syms.join(' ')}]") +rescue SyntaxError # <= 1.9.3 + syms.map!(&:to_sym) +end +syms.each { |s| h[s] = s } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml new file mode 100644 index 0000000000..833f10e1c7 --- /dev/null +++ b/benchmark/hash_defaults.yml @@ -0,0 +1,6 @@ +prelude: | + h = Hash.new { :foo } +benchmark: + default_aref: h[1] + default_method: h.default(1) +loop_count: 1000000 diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml new file mode 100644 index 0000000000..65f521ec94 --- /dev/null +++ b/benchmark/hash_dup.yml @@ -0,0 +1,8 @@ +prelude: | + small_hash = { a: 1 } + larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h + +benchmark: + dup_small: small_hash.dup + dup_larger: larger_hash.dup +loop_count: 10000 diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml new file mode 100644 index 0000000000..c26df1a7ed --- /dev/null +++ b/benchmark/hash_first.yml @@ -0,0 +1,11 @@ +prelude: | + hash1 = 1_000_000.times.to_h { [rand, true]} + hash2 = hash1.dup + hash2.keys[1..100_000].each { hash2.delete _1 } + hash2.delete hash2.first[0] + +benchmark: + hash1: hash1.first + hash2: hash2.first + +loop_count: 100_000 diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb new file mode 100644 index 0000000000..e944aae9f2 --- /dev/null +++ b/benchmark/hash_flatten.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +1000.times do + h.flatten +end diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb new file mode 100644 index 0000000000..0c7edfed3e --- /dev/null +++ b/benchmark/hash_ident_flo.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +strs = (1..10000).to_a.map!(&:to_f) +strs.each { |s| h[s] = s } +50.times { strs.each { |s| h[s] } } diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb new file mode 100644 index 0000000000..b226736c6f --- /dev/null +++ b/benchmark/hash_ident_num.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +nums = (1..26).to_a +nums.each { |n| h[n] = n } +200_000.times { nums.each { |n| h[n] } } diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb new file mode 100644 index 0000000000..4b3b58edec --- /dev/null +++ b/benchmark/hash_ident_obj.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +objs = 26.times.map { Object.new } +objs.each { |o| h[o] = o } +200_000.times { objs.each { |o| h[o] } } diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb new file mode 100644 index 0000000000..8582b38e31 --- /dev/null +++ b/benchmark/hash_ident_str.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +strs = ('a'..'z').to_a +strs.each { |s| h[s] = s } +200_000.times { strs.each { |s| h[s] } } diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb new file mode 100644 index 0000000000..4c81e3d28e --- /dev/null +++ b/benchmark/hash_ident_sym.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +syms = ('a'..'z').to_a.map(&:to_sym) +syms.each { |s| h[s] = s } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb new file mode 100644 index 0000000000..6863cd01f9 --- /dev/null +++ b/benchmark/hash_keys.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +5000.times do + h.keys +end diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb new file mode 100644 index 0000000000..c188529260 --- /dev/null +++ b/benchmark/hash_literal_small2.rb @@ -0,0 +1,3 @@ +# frozen_string_literal: true + +1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } } diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb new file mode 100644 index 0000000000..739f71b5b0 --- /dev/null +++ b/benchmark/hash_literal_small4.rb @@ -0,0 +1,3 @@ +# frozen_string_literal: true + +1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } } diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb new file mode 100644 index 0000000000..53d80af535 --- /dev/null +++ b/benchmark/hash_literal_small8.rb @@ -0,0 +1,3 @@ +# frozen_string_literal: true + +1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } } diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb new file mode 100644 index 0000000000..03d9109602 --- /dev/null +++ b/benchmark/hash_long.rb @@ -0,0 +1,4 @@ +k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong"; +k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping"; +h = {k1 => 0, k2 => 0}; +3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1} diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb new file mode 100644 index 0000000000..a645671a5b --- /dev/null +++ b/benchmark/hash_shift.rb @@ -0,0 +1,10 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +50000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb new file mode 100644 index 0000000000..ec800d0342 --- /dev/null +++ b/benchmark/hash_shift_u16.rb @@ -0,0 +1,10 @@ +h = {} + +(16384..65536).each do |i| + h[i] = nil +end + +300000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb new file mode 100644 index 0000000000..de4e0fa696 --- /dev/null +++ b/benchmark/hash_shift_u24.rb @@ -0,0 +1,10 @@ +h = {} + +(0xff4000..0xffffff).each do |i| + h[i] = nil +end + +300000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb new file mode 100644 index 0000000000..656aa55583 --- /dev/null +++ b/benchmark/hash_shift_u32.rb @@ -0,0 +1,10 @@ +h = {} + +(0xffff4000..0xffffffff).each do |i| + h[i] = nil +end + +300000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb new file mode 100644 index 0000000000..45485d9c71 --- /dev/null +++ b/benchmark/hash_small2.rb @@ -0,0 +1 @@ +1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a} diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb new file mode 100644 index 0000000000..acd4084334 --- /dev/null +++ b/benchmark/hash_small4.rb @@ -0,0 +1 @@ +1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a} diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb new file mode 100644 index 0000000000..9cffcc91b6 --- /dev/null +++ b/benchmark/hash_small8.rb @@ -0,0 +1 @@ +1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a} diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb new file mode 100644 index 0000000000..2b675bf509 --- /dev/null +++ b/benchmark/hash_to_proc.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +5000.times do |i| + [i].map(&h) +end diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb new file mode 100644 index 0000000000..069441302f --- /dev/null +++ b/benchmark/hash_values.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +5000.times do + h.values +end diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb new file mode 100644 index 0000000000..e22a3f8c30 --- /dev/null +++ b/benchmark/int_quo.rb @@ -0,0 +1 @@ +5000000.times { 42.quo(3) } diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb new file mode 100644 index 0000000000..3fd87250a4 --- /dev/null +++ b/benchmark/io_copy_stream_write.rb @@ -0,0 +1,24 @@ +# The goal of this is to use a synthetic (non-IO) reader +# to trigger the read/write loop of IO.copy_stream, +# bypassing in-kernel mechanisms like sendfile for zero copy, +# so we wrap the /dev/zero IO object: + +class Zero + def initialize + @n = 100000 + @in = File.open('/dev/zero', 'rb') + end + + def read(len, buf) + return if (@n -= 1) == 0 + @in.read(len, buf) + end +end + +begin + src = Zero.new + dst = File.open(IO::NULL, 'wb') + n = IO.copy_stream(src, dst) +rescue Errno::ENOENT + # not *nix +end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL) diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb new file mode 100644 index 0000000000..11f369bd0d --- /dev/null +++ b/benchmark/io_copy_stream_write_socket.rb @@ -0,0 +1,35 @@ +# The goal of this is to use a synthetic (non-IO) reader +# to trigger the read/write loop of IO.copy_stream, +# bypassing in-kernel mechanisms like sendfile for zero copy, +# so we wrap the /dev/zero IO object: +class Zero + def initialize + @n = 100000 + @in = File.open('/dev/zero', 'rb') + end + + def read(len, buf) + return if (@n -= 1) == 0 + @in.read(len, buf) + end +end + +begin + require 'socket' + src = Zero.new + rd, wr = UNIXSocket.pair + pid = fork do + wr.close + buf = String.new + while rd.read(16384, buf) + end + end + rd.close + IO.copy_stream(src, wr) +rescue Errno::ENOENT, NotImplementedError, NameError + # not *nix: missing /dev/zero, fork, or UNIXSocket +rescue LoadError # no socket? +ensure + wr.close if wr + Process.waitpid(pid) if pid +end if IO.respond_to?(:copy_stream) diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb new file mode 100644 index 0000000000..2f205c1333 --- /dev/null +++ b/benchmark/io_file_create.rb @@ -0,0 +1,13 @@ +# +# Create files +# + +max = 200_000 +file = './tmpfile_of_bm_io_file_create' + +max.times{ + f = open(file, 'w') + f.close#(true) +} +File.unlink(file) + diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb new file mode 100644 index 0000000000..b9e796ed30 --- /dev/null +++ b/benchmark/io_file_read.rb @@ -0,0 +1,15 @@ +# +# Seek and Read file. +# + +require 'tempfile' + +max = 200_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') +f.write str + +max.times{ + f.seek 0 + f.read +} diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb new file mode 100644 index 0000000000..aa1be0e5fe --- /dev/null +++ b/benchmark/io_file_write.rb @@ -0,0 +1,14 @@ +# +# Seek and Write file. +# + +require 'tempfile' + +max = 200_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') + +max.times{ + f.seek 0 + f.write str +} diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb new file mode 100644 index 0000000000..da9357fdc6 --- /dev/null +++ b/benchmark/io_nonblock_noex.rb @@ -0,0 +1,22 @@ +nr = 1_000_000 +i = 0 +msg = '.' +buf = '.' +noex = { exception: false } +begin + r, w = IO.pipe + while i < nr + i += 1 + w.write_nonblock(msg, noex) + r.read_nonblock(1, buf, noex) + end +rescue ArgumentError # old Rubies + while i < nr + i += 1 + w.write_nonblock(msg) + r.read_nonblock(1, buf) + end +ensure + r.close + w.close +end diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb new file mode 100644 index 0000000000..56819d049b --- /dev/null +++ b/benchmark/io_nonblock_noex2.rb @@ -0,0 +1,21 @@ +nr = 1_000_000 +i = 0 +msg = '.' +buf = '.' +begin + r, w = IO.pipe + while i < nr + i += 1 + w.write_nonblock(msg, exception: false) + r.read_nonblock(1, buf, exception: false) + end +rescue ArgumentError # old Rubies + while i < nr + i += 1 + w.write_nonblock(msg) + r.read_nonblock(1, buf) + end +ensure + r.close + w.close +end diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb new file mode 100644 index 0000000000..6862a8ae61 --- /dev/null +++ b/benchmark/io_pipe_rw.rb @@ -0,0 +1,13 @@ +# Measure uncontended GVL performance via read/write with 1:1 threading +# If we switch to M:N threading, this will benchmark something else... +r, w = IO.pipe +src = '0'.freeze +dst = String.new +i = 0 +while i < 1_000_000 + i += 1 + w.write(src) + r.read(1, dst) +end +w.close +r.close diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb new file mode 100644 index 0000000000..19248daeb1 --- /dev/null +++ b/benchmark/io_select.rb @@ -0,0 +1,9 @@ +# IO.select performance + +w = [ IO.pipe[1] ]; + +nr = 1000000 +nr.times { + IO.select nil, w +} + diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb new file mode 100644 index 0000000000..10e37d71b2 --- /dev/null +++ b/benchmark/io_select2.rb @@ -0,0 +1,22 @@ +# IO.select performance. worst case of single fd. + +ios = [] +nr = 1000000 +if defined?(Process::RLIMIT_NOFILE) + max = Process.getrlimit(Process::RLIMIT_NOFILE)[0] +else + max = 64 +end +puts "max fd: #{max} (results not apparent with <= 1024 max fd)" + +((max / 2) - 10).times do + ios.concat IO.pipe +end + +last = [ ios[-1] ] +puts "last IO: #{last[0].inspect}" + +nr.times do + IO.select nil, last +end + diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb new file mode 100644 index 0000000000..7d0ba1f092 --- /dev/null +++ b/benchmark/io_select3.rb @@ -0,0 +1,21 @@ +# IO.select performance. a lot of fd + +ios = [] +nr = 100 +if defined?(Process::RLIMIT_NOFILE) + max = Process.getrlimit(Process::RLIMIT_NOFILE)[0] +else + max = 64 +end +puts "max fd: #{max} (results not apparent with <= 1024 max fd)" + +(max - 10).times do + r, w = IO.pipe + r.close + ios.push w +end + +nr.times do + IO.select nil, ios +end + diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml new file mode 100644 index 0000000000..ebdc8d7e8b --- /dev/null +++ b/benchmark/irb_color.yml @@ -0,0 +1,13 @@ +prelude: | + require 'irb/color' + code = <<~'CODE' + def self.foo # bar + :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}" + end + CODE +benchmark: + irb_color_complete: | + IRB::Color.colorize_code(code, complete: true) + irb_color_incomplete: | + IRB::Color.colorize_code(code, complete: false) +loop_count: 2000000 diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml new file mode 100644 index 0000000000..28933f8b38 --- /dev/null +++ b/benchmark/irb_exec.yml @@ -0,0 +1,10 @@ +prelude: | + # frozen_string_literal: true + require 'rbconfig' + irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f'] +benchmark: + irb_exec: | + IO.popen(irb_f, 'w') do |io| + io.write('exit') + end +loop_count: 30 diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml new file mode 100644 index 0000000000..7e9d73bdd4 --- /dev/null +++ b/benchmark/iseq_load_from_binary.yml @@ -0,0 +1,25 @@ +prelude: | + symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary + + define_method = RubyVM::InstructionSequence.compile(%{ + def foo; end + def bar; end + def baz; end + def egg; end + def spam; end + }).to_binary + + all = RubyVM::InstructionSequence.compile(%{ + module Foo; def foo; :foo; end; end + module Bar; def bar; :bar; end; end + module Baz; def baz; :baz; end; end + class Egg; def egg; :egg; end; end + class Spaml; def spam; :spam; end; end + }).to_binary + +benchmark: + symbol: RubyVM::InstructionSequence.load_from_binary(symbol) + define_method: RubyVM::InstructionSequence.load_from_binary(define_method) + all: RubyVM::InstructionSequence.load_from_binary(all) + +loop_count: 100_000 diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml new file mode 100644 index 0000000000..eb9ee923f5 --- /dev/null +++ b/benchmark/ivar_extend.yml @@ -0,0 +1,23 @@ +prelude: | + class Embedded + def initialize + @a = 1 + @b = 1 + @c = 1 + end + end + + class Extended + def initialize + @a = 1 + @b = 1 + @c = 1 + @d = 1 + @e = 1 + @f = 1 + end + end +benchmark: + embedded: Embedded.new + extended: Extended.new +loop_count: 20_000_000 diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml new file mode 100644 index 0000000000..069b23abcd --- /dev/null +++ b/benchmark/kernel_clone.yml @@ -0,0 +1,6 @@ +prelude: "object = Object.new" +benchmark: + clone: "object.clone" + clone_true: "object.clone(freeze: true)" + clone_false: "object.clone(freeze: false)" +loop_count: 10000 diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml new file mode 100644 index 0000000000..215f6750fc --- /dev/null +++ b/benchmark/kernel_float.yml @@ -0,0 +1,5 @@ +benchmark: + float: "Float(42)" + float_true: "Float(42, exception: true)" + float_false: "Float(42, exception: false)" +loop_count: 10000 diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml new file mode 100644 index 0000000000..4dcbb31b4d --- /dev/null +++ b/benchmark/kernel_tap.yml @@ -0,0 +1,6 @@ +prelude: | + obj = Object.new + x = nil +benchmark: + kernel_tap: obj.tap { |o| x = o } +loop_count: 20000000 diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml new file mode 100644 index 0000000000..85f7341e33 --- /dev/null +++ b/benchmark/kernel_then.yml @@ -0,0 +1,6 @@ +benchmark: + kernel_then: 1.then { |i| i + 1 } + kernel_then_enum: 1.then + kernel_yield_self: 1.yield_self { |i| i + 1 } + kernel_yield_self_enum: 1.yield_self +loop_count: 20000000 diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml new file mode 100644 index 0000000000..fce6bce0b8 --- /dev/null +++ b/benchmark/keyword_arguments.yml @@ -0,0 +1,13 @@ +prelude: | + h = {a: 1} + def kw(a: 1) a end + def kws(**kw) kw end +benchmark: + kw_to_kw: "kw(a: 1)" + kw_splat_to_kw: "kw(**h)" + kw_to_kw_splat: "kws(a: 1)" + kw_splat_to_kw_splat: "kws(**h)" + kw_and_splat_to_kw: "kw(a: 1, **h)" + kw_splats_to_kw: "kw(**h, **h)" + kw_and_splat_to_kw_splat: "kws(a: 1, **h)" + kw_splats_to_kw_splat: "kws(**h, **h)" diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb new file mode 100644 index 0000000000..d22236e9fb --- /dev/null +++ b/benchmark/lib/benchmark_driver/output/driver.rb @@ -0,0 +1,36 @@ +require 'benchmark_driver/output/simple' + +# This replicates the legacy benchmark/driver.rb behavior. +class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple + def initialize(*) + super + @stdout = $stdout + @strio = StringIO.new + $stdout = IOMultiplexer.new(@stdout, @strio) + end + + def with_benchmark(*) + super + ensure + logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log" + puts "\nLog file: #{logfile}" + + $stdout = @stdout + File.write(logfile, @strio.tap(&:rewind).read) + end + + class IOMultiplexer + def initialize(io1, io2) + @io1 = io1 + @io2 = io2 + end + + [:write, :sync, :sync=, :puts, :print, :flush].each do |method| + define_method(method) do |*args| + @io1.send(method, *args) + @io2.send(method, *args) + end + end + end + private_constant :IOMultiplexer +end diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb new file mode 100644 index 0000000000..3c3453e527 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/cstime.rb @@ -0,0 +1,22 @@ +require 'benchmark_driver/runner/total' + +class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total + METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + private + + # Overriding BenchmarkDriver::Runner::Total#metric + def metric + METRIC + end + + # Overriding BenchmarkDriver::Runner::Total#target + def target + :cstime + end +end diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb new file mode 100644 index 0000000000..e139962ef2 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/cutime.rb @@ -0,0 +1,22 @@ +require 'benchmark_driver/runner/total' + +class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total + METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + private + + # Overriding BenchmarkDriver::Runner::Total#metric + def metric + METRIC + end + + # Overriding BenchmarkDriver::Runner::Total#target + def target + :cutime + end +end diff --git a/benchmark/lib/benchmark_driver/runner/mjit.rb b/benchmark/lib/benchmark_driver/runner/mjit.rb new file mode 100644 index 0000000000..1d4693e8be --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/mjit.rb @@ -0,0 +1,34 @@ +require 'benchmark_driver/struct' +require 'benchmark_driver/metric' +require 'erb' + +# A runner to measure after-JIT performance easily +class BenchmarkDriver::Runner::Mjit < BenchmarkDriver::Runner::Ips + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{ + def parse(**) + jobs = super + jobs.map do |job| + job = job.dup + job.prelude = "#{job.prelude}\n#{<<~EOS}" + if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? + __bmdv_ruby_i = 0 + while __bmdv_ruby_i < 10000 # jit_min_calls + #{job.script} + __bmdv_ruby_i += 1 + end + RubyVM::MJIT.pause # compile + #{job.script} + RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile + #{job.script} + RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile 2 + end + EOS + job + end + end + }) +end diff --git a/benchmark/lib/benchmark_driver/runner/mjit_exec.rb b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb new file mode 100644 index 0000000000..eac3dfba84 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb @@ -0,0 +1,237 @@ +require 'benchmark_driver/struct' +require 'benchmark_driver/metric' +require 'erb' + +# A special runner dedicated for measuring mjit_exec overhead. +class BenchmarkDriver::Runner::MjitExec + METRIC = BenchmarkDriver::Metric.new(name: 'Iteration per second', unit: 'i/s') + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = ::BenchmarkDriver::Struct.new( + :name, # @param [String] name - This is mandatory for all runner + :metrics, # @param [Array<BenchmarkDriver::Metric>] + :num_methods, # @param [Integer] num_methods - The number of methods to be defined + :loop_count, # @param [Integer] loop_count + :from_jit, # @param [TrueClass,FalseClass] from_jit - Whether the mjit_exec() is from JIT or not + :to_jit, # @param [TrueClass,FalseClass] to_jit - Whether the mjit_exec() is to JIT or not + ) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + class << JobParser = Module.new + # @param [Array,String] num_methods + # @param [Integer] loop_count + # @param [TrueClass,FalseClass] from_jit + # @param [TrueClass,FalseClass] to_jit + def parse(num_methods:, loop_count:, from_jit:, to_jit:) + if num_methods.is_a?(String) + num_methods = eval(num_methods) + end + + num_methods.map do |num| + if num_methods.size > 1 + suffix = "[#{'%4d' % num}]" + else + suffix = "_#{num}" + end + Job.new( + name: "mjit_exec_#{from_jit ? 'JT' : 'VM'}2#{to_jit ? 'JT' : 'VM'}#{suffix}", + metrics: [METRIC], + num_methods: num, + loop_count: loop_count, + from_jit: from_jit, + to_jit: to_jit, + ) + end + end + end + + # @param [BenchmarkDriver::Config::RunnerConfig] config + # @param [BenchmarkDriver::Output] output + # @param [BenchmarkDriver::Context] contexts + def initialize(config:, output:, contexts:) + @config = config + @output = output + @contexts = contexts + end + + # This method is dynamically called by `BenchmarkDriver::JobRunner.run` + # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs + def run(jobs) + @output.with_benchmark do + jobs.each do |job| + @output.with_job(name: job.name) do + @contexts.each do |context| + result = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: true, rest_on_average: :average) do + run_benchmark(job, context: context) + end + value, duration = result.value + @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do + @output.report(values: { METRIC => value }, duration: duration, loop_count: job.loop_count) + end + end + end + end + end + end + + private + + # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil + # @param [BenchmarkDriver::Context] context + # @return [BenchmarkDriver::Metrics] + def run_benchmark(job, context:) + if job.from_jit + if job.to_jit + benchmark = BenchmarkJT2JT.new(num_methods: job.num_methods, loop_count: job.loop_count) + else + raise NotImplementedError, "JT2VM is not implemented yet" + end + else + if job.to_jit + benchmark = BenchmarkVM2JT.new(num_methods: job.num_methods, loop_count: job.loop_count) + else + benchmark = BenchmarkVM2VM.new(num_methods: job.num_methods, loop_count: job.loop_count) + end + end + + duration = Tempfile.open(['benchmark_driver-result', '.txt']) do |f| + with_script(benchmark.render(result: f.path)) do |path| + opt = [] + if context.executable.command.any? { |c| c.start_with?('--jit') } + opt << '--jit-min-calls=2' + end + IO.popen([*context.executable.command, '--disable-gems', *opt, path], &:read) + if $?.success? + Float(f.read) + else + BenchmarkDriver::Result::ERROR + end + end + end + + [job.loop_count.to_f / duration, duration] + end + + def with_script(script) + if @config.verbose >= 2 + sep = '-' * 30 + $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n" + end + + Tempfile.open(['benchmark_driver-', '.rb']) do |f| + f.puts script + f.close + return yield(f.path) + end + end + + # @param [Integer] num_methods + # @param [Integer] loop_count + BenchmarkVM2VM = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do + # @param [String] result - A file to write result + def render(result:) + ERB.new(<<~EOS, trim_mode: '%').result(binding) + % num_methods.times do |i| + def a<%= i %> + nil + end + % end + RubyVM::MJIT.pause if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? + + def vm + t = Process.clock_gettime(Process::CLOCK_MONOTONIC) + i = 0 + while i < <%= loop_count / 1000 %> + % 1000.times do |i| + a<%= i % num_methods %> + % end + i += 1 + end + % (loop_count % 1000).times do |i| + a<%= i % num_methods %> + % end + Process.clock_gettime(Process::CLOCK_MONOTONIC) - t + end + + vm # warmup call cache + File.write(<%= result.dump %>, vm) + EOS + end + end + private_constant :BenchmarkVM2VM + + # @param [Integer] num_methods + # @param [Integer] loop_count + BenchmarkVM2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do + # @param [String] result - A file to write result + def render(result:) + ERB.new(<<~EOS, trim_mode: '%').result(binding) + % num_methods.times do |i| + def a<%= i %> + nil + end + a<%= i %> + a<%= i %> # --jit-min-calls=2 + % end + RubyVM::MJIT.pause if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? + + def vm + t = Process.clock_gettime(Process::CLOCK_MONOTONIC) + i = 0 + while i < <%= loop_count / 1000 %> + % 1000.times do |i| + a<%= i % num_methods %> + % end + i += 1 + end + % (loop_count % 1000).times do |i| + a<%= i % num_methods %> + % end + Process.clock_gettime(Process::CLOCK_MONOTONIC) - t + end + + vm # warmup call cache + File.write(<%= result.dump %>, vm) + EOS + end + end + private_constant :BenchmarkVM2JT + + # @param [Integer] num_methods + # @param [Integer] loop_count + BenchmarkJT2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do + # @param [String] result - A file to write result + def render(result:) + ERB.new(<<~EOS, trim_mode: '%').result(binding) + % num_methods.times do |i| + def a<%= i %> + nil + end + % end + + # You may need to: + # * Increase `JIT_ISEQ_SIZE_THRESHOLD` to 10000000 in mjit.h + # * Always return false in `inlinable_iseq_p()` of mjit_compile.c + def jit + t = Process.clock_gettime(Process::CLOCK_MONOTONIC) + i = 0 + while i < <%= loop_count / 1000 %> + % 1000.times do |i| + a<%= i % num_methods %> + % end + i += 1 + end + % (loop_count % 1000).times do |i| + a<%= i % num_methods %> + % end + Process.clock_gettime(Process::CLOCK_MONOTONIC) - t + end + + jit + jit + RubyVM::MJIT.pause if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled? + File.write(<%= result.dump %>, jit) + EOS + end + end + private_constant :BenchmarkJT2JT +end diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb new file mode 100644 index 0000000000..d04f2e51ff --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/peak.rb @@ -0,0 +1,151 @@ +require 'benchmark_driver/struct' +require 'benchmark_driver/metric' +require 'benchmark_driver/default_job' +require 'benchmark_driver/default_job_parser' +require 'tempfile' + +class BenchmarkDriver::Runner::Peak + METRIC = BenchmarkDriver::Metric.new( + name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger', + ) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + # @param [BenchmarkDriver::Config::RunnerConfig] config + # @param [BenchmarkDriver::Output] output + # @param [BenchmarkDriver::Context] contexts + def initialize(config:, output:, contexts:) + @config = config + @output = output + @contexts = contexts + end + + # This method is dynamically called by `BenchmarkDriver::JobRunner.run` + # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs + def run(jobs) + if jobs.any? { |job| job.loop_count.nil? } + jobs = jobs.map do |job| + job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1)) + end + end + + @output.with_benchmark do + jobs.each do |job| + @output.with_job(name: job.name) do + job.runnable_contexts(@contexts).each do |context| + value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do + run_benchmark(job, context: context) + end + @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do + @output.report(values: { metric => value }, loop_count: job.loop_count) + end + end + end + end + end + end + + private + + # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil + # @param [BenchmarkDriver::Context] context + # @return [BenchmarkDriver::Metrics] + def run_benchmark(job, context:) + benchmark = BenchmarkScript.new( + preludes: [context.prelude, job.prelude], + script: job.script, + teardown: job.teardown, + loop_count: job.loop_count, + ) + + memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__) + Tempfile.open(['benchmark_driver-', '.rb']) do |f| + with_script(benchmark.render) do |path| + output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read) + if $?.success? + Integer(f.read) + else + $stdout.print(output) + BenchmarkDriver::Result::ERROR + end + end + end + end + + # Overridden by BenchmarkDriver::Runner::Size + def target + 'peak' + end + + # Overridden by BenchmarkDriver::Runner::Size + def metric + METRIC + end + + def with_script(script) + if @config.verbose >= 2 + sep = '-' * 30 + $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n" + end + + Tempfile.open(['benchmark_driver-', '.rb']) do |f| + f.puts script + f.close + return yield(f.path) + end + end + + # @param [String] prelude + # @param [String] script + # @param [String] teardown + # @param [Integer] loop_count + BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do + def render + prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n") + <<-RUBY +#{prelude} +#{while_loop(script, loop_count)} +#{teardown} + +result_file, target, memory_status = ARGV +require_relative memory_status + +ms = Memory::Status.new +case target.to_sym +when :peak + key = ms.respond_to?(:hwm) ? :hwm : :peak +when :size + key = ms.respond_to?(:rss) ? :rss : :size +else + raise('unexpected target: ' + target) +end + +File.write(result_file, ms[key]) + RUBY + end + + private + + def while_loop(content, times) + if !times.is_a?(Integer) || times <= 0 + raise ArgumentError.new("Unexpected times: #{times.inspect}") + end + + if times > 1 + <<-RUBY +__bmdv_i = 0 +while __bmdv_i < #{times} + #{content} + __bmdv_i += 1 +end + RUBY + else + content + end + end + end + private_constant :BenchmarkScript +end diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb new file mode 100644 index 0000000000..c730b8e4a5 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/ractor.rb @@ -0,0 +1,122 @@ +require 'erb' + +# A runner to measure performance *inside* Ractor +class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) do + attr_accessor :ractor + end + + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{ + def parse(ractor: 1, **kwargs) + super(**kwargs).each do |job| + job.ractor = ractor + end + end + }) + + private + + unless private_instance_methods.include?(:run_benchmark) + raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips" + end + + # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil + # @param [BenchmarkDriver::Context] context + # @return [BenchmarkDriver::Metrics] + def run_benchmark(job, context:) + benchmark = BenchmarkScript.new( + preludes: [context.prelude, job.prelude], + script: job.script, + teardown: job.teardown, + loop_count: job.loop_count, + ) + + results = job.ractor.times.map do + Tempfile.open('benchmark_driver_result') + end + duration = with_script(benchmark.render(results: results.map(&:path))) do |path| + success = execute(*context.executable.command, path, exception: false) + if success && ((value = results.map { |f| Float(f.read) }.max) > 0) + value + else + BenchmarkDriver::Result::ERROR + end + end + results.each(&:close) + + value_duration( + loop_count: job.loop_count, + duration: duration, + ) + end + + # @param [String] prelude + # @param [String] script + # @param [String] teardown + # @param [Integer] loop_count + BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do + # @param [String] result - A file to write result + def render(results:) + prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n") + ERB.new(<<-RUBY).result_with_hash(results: results) +Warning[:experimental] = false +# shareable-constant-value: experimental_everything +#{prelude} + +if #{loop_count} == 1 + __bmdv_loop_before = 0 + __bmdv_loop_after = 0 +else + __bmdv_loop_before = Time.new + #{while_loop('', loop_count, id: 0)} + __bmdv_loop_after = Time.new +end + +__bmdv_ractors = [] +<% results.size.times do %> +__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time| + __bmdv_time = Time + __bmdv_script_before = __bmdv_time.new + #{while_loop(script, loop_count, id: 1)} + __bmdv_script_after = __bmdv_time.new + + (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time +} +<% end %> + +# Wait for all Ractors before executing code to write results +__bmdv_ractors.map!(&:take) + +<% results.each do |result| %> +File.write(<%= result.dump %>, __bmdv_ractors.shift) +<% end %> + +#{teardown} + RUBY + end + + private + + # id is to prevent: + # can not isolate a Proc because it accesses outer variables (__bmdv_i) + def while_loop(content, times, id:) + if !times.is_a?(Integer) || times <= 0 + raise ArgumentError.new("Unexpected times: #{times.inspect}") + elsif times == 1 + return content + end + + # TODO: execute in batch + <<-RUBY +__bmdv_i#{id} = 0 +while __bmdv_i#{id} < #{times} + #{content} + __bmdv_i#{id} += 1 +end + RUBY + end + end + private_constant :BenchmarkScript +end diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb new file mode 100644 index 0000000000..1b31f901c7 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/size.rb @@ -0,0 +1,25 @@ +require 'benchmark_driver/runner/peak' + +# Actually the same as BenchmarkDriver::Runner::Memory +class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak + METRIC = BenchmarkDriver::Metric.new( + name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger', + ) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + private + + # Overriding BenchmarkDriver::Runner::Peak#metric + def metric + METRIC + end + + # Overriding BenchmarkDriver::Runner::Peak#target + def target + 'size' + end +end diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb new file mode 100644 index 0000000000..4577fb0bf8 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/stime.rb @@ -0,0 +1,22 @@ +require 'benchmark_driver/runner/total' + +class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total + METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + private + + # Overriding BenchmarkDriver::Runner::Total#metric + def metric + METRIC + end + + # Overriding BenchmarkDriver::Runner::Total#target + def target + :stime + end +end diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb new file mode 100644 index 0000000000..64dc14f84e --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/total.rb @@ -0,0 +1,137 @@ +require 'benchmark_driver/struct' +require 'benchmark_driver/metric' +require 'benchmark_driver/default_job' +require 'benchmark_driver/default_job_parser' +require 'tempfile' + +class BenchmarkDriver::Runner::Total + METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + # @param [BenchmarkDriver::Config::RunnerConfig] config + # @param [BenchmarkDriver::Output] output + # @param [BenchmarkDriver::Context] contexts + def initialize(config:, output:, contexts:) + @config = config + @output = output + @contexts = contexts + end + + # This method is dynamically called by `BenchmarkDriver::JobRunner.run` + # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs + def run(jobs) + if jobs.any? { |job| job.loop_count.nil? } + raise 'missing loop_count is not supported in Ruby repository' + end + + @output.with_benchmark do + jobs.each do |job| + @output.with_job(name: job.name) do + job.runnable_contexts(@contexts).each do |context| + duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do + run_benchmark(job, context: context) + end + @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do + @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count) + end + end + end + end + end + end + + private + + # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil + # @param [BenchmarkDriver::Context] context + # @return [BenchmarkDriver::Metrics] + def run_benchmark(job, context:) + benchmark = BenchmarkScript.new( + preludes: [context.prelude, job.prelude], + script: job.script, + teardown: job.teardown, + loop_count: job.loop_count, + ) + + Tempfile.open(['benchmark_driver-', '.rb']) do |f| + with_script(benchmark.render(result: f.path, target: target)) do |path| + IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2 + if $?.success? + Float(f.read) + else + BenchmarkDriver::Result::ERROR + end + end + end + end + + # This method is overridden by some subclasses + def metric + METRIC + end + + # This method is overridden by some subclasses + def target + :total + end + + def with_script(script) + if @config.verbose >= 2 + sep = '-' * 30 + $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n" + end + + Tempfile.open(['benchmark_driver-', '.rb']) do |f| + f.puts script + f.close + return yield(f.path) + end + end + + # @param [String] prelude + # @param [String] script + # @param [String] teardown + # @param [Integer] loop_count + BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do + # @param [String] result - A file to write result + def render(result:, target:) + prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n") + <<-RUBY +#{prelude} + +require 'benchmark' +__bmdv_result = Benchmark.measure { + #{while_loop(script, loop_count)} +} + +#{teardown} + +File.write(#{result.dump}, __bmdv_result.#{target}) + RUBY + end + + private + + def while_loop(content, times) + if !times.is_a?(Integer) || times <= 0 + raise ArgumentError.new("Unexpected times: #{times.inspect}") + elsif times == 1 + return content + end + + # TODO: execute in batch + <<-RUBY +__bmdv_i = 0 +while __bmdv_i < #{times} + #{content} + __bmdv_i += 1 +end + RUBY + end + end + private_constant :BenchmarkScript +end diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb new file mode 100644 index 0000000000..b61d83a188 --- /dev/null +++ b/benchmark/lib/benchmark_driver/runner/utime.rb @@ -0,0 +1,22 @@ +require 'benchmark_driver/runner/total' + +class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total + METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false) + + # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job" + Job = Class.new(BenchmarkDriver::DefaultJob) + # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse` + JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]) + + private + + # Overriding BenchmarkDriver::Runner::Total#metric + def metric + METRIC + end + + # Overriding BenchmarkDriver::Runner::Total#target + def target + :utime + end +end diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb new file mode 100644 index 0000000000..31b770c484 --- /dev/null +++ b/benchmark/lib/load.rb @@ -0,0 +1,18 @@ +# How to use this file: +# 1. write a `$(srcdir)/test.rb` like: +=begin +require_relative 'benchmark/lib/load' + +Benchmark.driver(repeat_count: 5){|x| + x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby' + x.executable name: 'modif-miniruby', command: %w'./miniruby' + + x.report %q{ + h = {a: 1, b: 2, c: 3, d: 4} + } +} +=end +# +# 2. `make run` +$:.unshift(File.join(__dir__, '../benchmark-driver/lib')) +require 'benchmark_driver' diff --git a/benchmark/loop_for.rb b/benchmark/loop_for.rb new file mode 100644 index 0000000000..0fc4cc1511 --- /dev/null +++ b/benchmark/loop_for.rb @@ -0,0 +1,3 @@ +for i in 1..30_000_000 + # +end diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb new file mode 100644 index 0000000000..d3375c744c --- /dev/null +++ b/benchmark/loop_generator.rb @@ -0,0 +1,14 @@ +max = 600000 + +if defined? Fiber + gen = (1..max).each + loop do + gen.next + end +else + require 'generator' + gen = Generator.new((0..max)) + while gen.next? + gen.next + end +end diff --git a/benchmark/loop_times.rb b/benchmark/loop_times.rb new file mode 100644 index 0000000000..521f72ad1a --- /dev/null +++ b/benchmark/loop_times.rb @@ -0,0 +1 @@ +30_000_000.times{|e|} diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb new file mode 100644 index 0000000000..0072822c06 --- /dev/null +++ b/benchmark/loop_whileloop.rb @@ -0,0 +1,4 @@ +i = 0 +while i<30_000_000 # benchmark loop 1 + i += 1 +end diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb new file mode 100644 index 0000000000..47d02dffc4 --- /dev/null +++ b/benchmark/loop_whileloop2.rb @@ -0,0 +1,4 @@ +i = 0 +while i< 6_000_000 # benchmark loop 2 + i += 1 +end diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb new file mode 100644 index 0000000000..9b8d0c6afb --- /dev/null +++ b/benchmark/marshal_dump_flo.rb @@ -0,0 +1,2 @@ +bug10761 = 10000.times.map { |x| x.to_f } +100.times { Marshal.dump(bug10761) } diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb new file mode 100644 index 0000000000..8252ad90fa --- /dev/null +++ b/benchmark/marshal_dump_load_geniv.rb @@ -0,0 +1,10 @@ +a = '' +a.instance_eval do + @a = :a + @b = :b + @c = :c +end +100000.times do + a = Marshal.load(Marshal.dump(a)) +end +#p(a.instance_eval { @a == :a && @b == :b && @c == :c }) diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb new file mode 100644 index 0000000000..e29743b791 --- /dev/null +++ b/benchmark/marshal_dump_load_time.rb @@ -0,0 +1 @@ +100000.times { Marshal.load(Marshal.dump(Time.now)) } diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml new file mode 100644 index 0000000000..4be9333e23 --- /dev/null +++ b/benchmark/masgn.yml @@ -0,0 +1,29 @@ +prelude: | + a = [nil] * 3 + b = Class.new{attr_writer :a, :b, :c}.new + c, d, e, f = nil, nil, nil, nil +benchmark: + array2_2: "c = (a[0], a[1] = 1, 2)" + array2_3: "c = (a[0], a[1] = 1, 2, 3)" + array3_2: "c = (a[0], a[1], a[2] = 1, 2)" + array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)" + attr2_2: "c = (b.a, b.b = 1, 2)" + attr2_3: "c = (b.a, b.b = 1, 2, 3)" + attr3_2: "c = (b.a, b.b, b.c = 1, 2)" + attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)" + lvar2_2: "c = (d, e = 1, 2)" + lvar2_3: "c = (d, e = 1, 2, 3)" + lvar3_2: "c = (d, e, f = 1, 2)" + lvar3_3: "c = (d, e, f = 1, 2, 3)" + array2_2p: "(a[0], a[1] = 1, 2; nil)" + array2_3p: "(a[0], a[1] = 1, 2, 3; nil)" + array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)" + array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)" + attr2_2p: "(b.a, b.b = 1, 2; nil)" + attr2_3p: "(b.a, b.b = 1, 2, 3; nil)" + attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)" + attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)" + lvar2_2p: "(d, e = 1, 2; nil)" + lvar2_3p: "(d, e = 1, 2, 3; nil)" + lvar3_2p: "(d, e, f = 1, 2; nil)" + lvar3_3p: "(d, e, f = 1, 2, 3; nil)" diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb new file mode 100644 index 0000000000..ffda109912 --- /dev/null +++ b/benchmark/match_gt4.rb @@ -0,0 +1 @@ +1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") } diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb new file mode 100644 index 0000000000..3b743d484a --- /dev/null +++ b/benchmark/match_small.rb @@ -0,0 +1 @@ +1000000.times { 'haystack'.match(/hay/) } diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml new file mode 100644 index 0000000000..9e0e046ed4 --- /dev/null +++ b/benchmark/method_bind_call.yml @@ -0,0 +1,16 @@ +prelude: | + named_module = Kernel + + module FakeName + def self.name + "NotMyame".freeze + end + end + + MOD_NAME = Module.instance_method(:name) + +benchmark: + fastpath: MOD_NAME.bind_call(Kernel) + slowpath: MOD_NAME.bind_call(FakeName) + +loop_count: 100_000 diff --git a/benchmark/mjit_exec_jt2jt.yml b/benchmark/mjit_exec_jt2jt.yml new file mode 100644 index 0000000000..6c303c7a44 --- /dev/null +++ b/benchmark/mjit_exec_jt2jt.yml @@ -0,0 +1,6 @@ +type: lib/benchmark_driver/runner/mjit_exec +num_methods: [1] +#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000] +loop_count: 50000000 +from_jit: true +to_jit: true diff --git a/benchmark/mjit_exec_vm2jt.yml b/benchmark/mjit_exec_vm2jt.yml new file mode 100644 index 0000000000..764883f070 --- /dev/null +++ b/benchmark/mjit_exec_vm2jt.yml @@ -0,0 +1,6 @@ +type: lib/benchmark_driver/runner/mjit_exec +num_methods: [1] +#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000] +loop_count: 50000000 +from_jit: false +to_jit: true diff --git a/benchmark/mjit_exec_vm2vm.yml b/benchmark/mjit_exec_vm2vm.yml new file mode 100644 index 0000000000..030aa76c1c --- /dev/null +++ b/benchmark/mjit_exec_vm2vm.yml @@ -0,0 +1,6 @@ +type: lib/benchmark_driver/runner/mjit_exec +num_methods: [1] +#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000] +loop_count: 50000000 +from_jit: false +to_jit: false diff --git a/benchmark/mjit_exivar.yml b/benchmark/mjit_exivar.yml new file mode 100644 index 0000000000..2584fa6410 --- /dev/null +++ b/benchmark/mjit_exivar.yml @@ -0,0 +1,18 @@ +type: lib/benchmark_driver/runner/mjit +prelude: | + class Bench < Hash + def initialize + @exivar = nil + end + + def exivar + @exivar + end + end + + bench = Bench.new + +benchmark: + mjit_exivar: bench.exivar + +loop_count: 200000000 diff --git a/benchmark/mjit_integer.yml b/benchmark/mjit_integer.yml new file mode 100644 index 0000000000..a6b5c9ee16 --- /dev/null +++ b/benchmark/mjit_integer.yml @@ -0,0 +1,32 @@ +type: lib/benchmark_driver/runner/mjit +prelude: | + def mjit_abs(int) int.abs end + def mjit_bit_length(int) int.bit_length end + def mjit_comp(int) ~int end + def mjit_even?(int) int.even? end + def mjit_integer?(int) int.integer? end + def mjit_magnitude(int) int.magnitude end + def mjit_odd?(int) int.odd? end + def mjit_ord(int) int.ord end + def mjit_size(int) int.size end + def mjit_to_i(int) int.to_i end + def mjit_to_int(int) int.to_int end + def mjit_uminus(int) -int end + def mjit_zero?(int) int.zero? end + +benchmark: + - mjit_abs(-1) + - mjit_bit_length(100) + - mjit_comp(1) + - mjit_even?(2) + - mjit_integer?(0) + - mjit_magnitude(-1) + - mjit_odd?(1) + - mjit_ord(1) + - mjit_size(1) + - mjit_to_i(1) + - mjit_to_int(1) + - mjit_uminus(1) + - mjit_zero?(0) + +loop_count: 40000000 diff --git a/benchmark/mjit_kernel.yml b/benchmark/mjit_kernel.yml new file mode 100644 index 0000000000..7720e65c2c --- /dev/null +++ b/benchmark/mjit_kernel.yml @@ -0,0 +1,20 @@ +type: lib/benchmark_driver/runner/mjit +prelude: | + def mjit_class(obj) + obj.class + end + + def mjit_frozen?(obj) + obj.frozen? + end + + str = "" + fstr = "".freeze + +benchmark: + - mjit_class(self) + - mjit_class(1) + - mjit_frozen?(str) + - mjit_frozen?(fstr) + +loop_count: 40000000 diff --git a/benchmark/mjit_leave.yml b/benchmark/mjit_leave.yml new file mode 100644 index 0000000000..9ac68b164b --- /dev/null +++ b/benchmark/mjit_leave.yml @@ -0,0 +1,8 @@ +type: lib/benchmark_driver/runner/mjit +prelude: | + def leave + nil + end +benchmark: + mjit_leave: leave +loop_count: 200000000 diff --git a/benchmark/mjit_opt_cc_insns.yml b/benchmark/mjit_opt_cc_insns.yml new file mode 100644 index 0000000000..fed6d34bd5 --- /dev/null +++ b/benchmark/mjit_opt_cc_insns.yml @@ -0,0 +1,27 @@ +# opt_* insns using vm_method_cfunc_is with send-compatible operands: +# * opt_nil_p +# * opt_not +# * opt_eq +type: lib/benchmark_driver/runner/mjit +prelude: | + def mjit_nil?(obj) + obj.nil? + end + + def mjit_not(obj) + !obj + end + + def mjit_eq(a, b) + a == b + end + +benchmark: + - script: mjit_nil?(1) + loop_count: 40000000 + - script: mjit_not(1) + loop_count: 40000000 + - script: mjit_eq(1, nil) + loop_count: 8000000 + - script: mjit_eq(nil, 1) + loop_count: 8000000 diff --git a/benchmark/mjit_struct_aref.yml b/benchmark/mjit_struct_aref.yml new file mode 100644 index 0000000000..bfba1323f2 --- /dev/null +++ b/benchmark/mjit_struct_aref.yml @@ -0,0 +1,10 @@ +type: lib/benchmark_driver/runner/mjit +prelude: | + def mjit_struct_aref(struct) + struct.aa + end + struct = Struct.new(:a0, :a1, :a2, :a3, :a4, :a5, :a6, :a7, :a8, :a9, :aa).new + +benchmark: mjit_struct_aref(struct) + +loop_count: 40000000 diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml new file mode 100644 index 0000000000..79ba4f2177 --- /dev/null +++ b/benchmark/nil_p.yml @@ -0,0 +1,9 @@ +prelude: | + class Niller; def nil?; true; end; end + xnil, notnil = nil, Object.new + niller = Niller.new +benchmark: + - xnil.nil? + - notnil.nil? + - niller.nil? +loop_count: 10000000 diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml new file mode 100644 index 0000000000..fba67a5f6a --- /dev/null +++ b/benchmark/nilclass.yml @@ -0,0 +1,6 @@ +benchmark: + to_i: | + nil.to_i + to_f: | + nil.to_f +loop_count: 100000 diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml new file mode 100644 index 0000000000..2195963433 --- /dev/null +++ b/benchmark/num_zero_p.yml @@ -0,0 +1,8 @@ +benchmark: + - 0.zero? + - 1.zero? + - 0r.zero? + - 1r.zero? + - 0i.zero? + - 1i.zero? +loop_count: 50000000 diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml new file mode 100644 index 0000000000..433c2268a3 --- /dev/null +++ b/benchmark/numeric_methods.yml @@ -0,0 +1,13 @@ +prelude: | + int = 42 + flo = 4.2 +benchmark: + real?: | + int.real? + integer?: | + flo.integer? + finite?: | + int.finite? + infinite?: | + int.infinite? +loop_count: 20000000 diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml new file mode 100644 index 0000000000..93ff463e41 --- /dev/null +++ b/benchmark/object_allocate.yml @@ -0,0 +1,21 @@ +prelude: | + class Eight + 8.times { include(Module.new) } + end + class ThirtyTwo + 32.times { include(Module.new) } + end + class SixtyFour + 64.times { include(Module.new) } + end + class OneTwentyEight + 128.times { include(Module.new) } + end + # Disable GC to see raw throughput: + GC.disable +benchmark: + allocate_8_deep: Eight.new + allocate_32_deep: ThirtyTwo.new + allocate_64_deep: SixtyFour.new + allocate_128_deep: OneTwentyEight.new +loop_count: 100000 diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml new file mode 100644 index 0000000000..ebab562d2e --- /dev/null +++ b/benchmark/objspace_dump_all.yml @@ -0,0 +1,13 @@ +prelude: | + require 'objspace' + require 'tempfile' + $objs = 1_000.times.map { Object.new } + $strings = 1_000.times.map { |i| "string #{i}" } + $file = Tempfile.new('heap') + $dev_null = File.open(File::NULL, 'w+') + +benchmark: + dump_all_string: "ObjectSpace.dump_all(output: :string)" + dump_all_file: "ObjectSpace.dump_all(output: $file)" + dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)" +loop_count: 1 diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl new file mode 100644 index 0000000000..201e22ddfa --- /dev/null +++ b/benchmark/other-lang/ack.pl @@ -0,0 +1,11 @@ +use integer; + +sub Ack { + return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1)) + : Ack($_[0]-1, 1)) + : $_[1]+1; +} + +my $NUM = 9; +$NUM = 1 if ($NUM < 1); +my $ack = Ack(3, $NUM); diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py new file mode 100644 index 0000000000..9968e7cfcf --- /dev/null +++ b/benchmark/other-lang/ack.py @@ -0,0 +1,16 @@ +import sys +sys.setrecursionlimit(5000000) + +def Ack(M, N): + if (not M): + return( N + 1 ) + if (not N): + return( Ack(M-1, 1) ) + return( Ack(M-1, Ack(M, N-1)) ) + +def main(): + NUM = 9 + sys.setrecursionlimit(10000) + Ack(3, NUM) + +main() diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb new file mode 100644 index 0000000000..7451bed6c4 --- /dev/null +++ b/benchmark/other-lang/ack.rb @@ -0,0 +1,12 @@ +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +NUM = 9 +ack(3, NUM) diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm new file mode 100644 index 0000000000..a80b73ba55 --- /dev/null +++ b/benchmark/other-lang/ack.scm @@ -0,0 +1,7 @@ +(define (ack m n) + (cond ((zero? m) (+ n 1)) + ((zero? n) (ack (- m 1) 1)) + (else (ack (- m 1) (ack m (- n 1)))))) + +(ack 3 9) + diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb new file mode 100644 index 0000000000..48a2cea019 --- /dev/null +++ b/benchmark/other-lang/eval.rb @@ -0,0 +1,66 @@ + +Bench = %w( + loop + ack + fib + tak + fact +) + +Lang = <<EOP.map{|l| l.strip} + ruby-cyg + ../../../test6/miniruby + perl + python + gosh +EOP + +Bench.replace ['loop2'] +Lang.replace ['ruby-cyg'] + +Ext = %w( + .rb + .rb + .pl + .py + .scm +) + +p Bench +p Lang + +require 'benchmark' + +def bench cmd + m = Benchmark.measure{ + #p cmd + system(cmd) + } + [m.utime, m.real] +end + +Result = [] +Bench.each{|b| + r = [] + Lang.each_with_index{|l, idx| + cmd = "#{l} #{b}#{Ext[idx]}" + r << bench(cmd) + } + Result << r +} + +require 'pp' +# utime +puts Lang.join("\t") +Bench.each_with_index{|b, bi| + print b, "\t" + puts Result[bi].map{|e| e[0]}.join("\t") +} + +# rtime +puts Lang.join("\t") +Bench.each_with_index{|b, bi| + print b, "\t" + puts Result[bi].map{|e| e[1]}.join("\t") +} + diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl new file mode 100644 index 0000000000..a9b0b69cdf --- /dev/null +++ b/benchmark/other-lang/fact.pl @@ -0,0 +1,13 @@ +sub fact{ + my $n = @_[0]; + if($n < 2){ + return 1; + } + else{ + return $n * fact($n-1); + } +} + +for($i=0; $i<10000; $i++){ + &fact(100); +} diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py new file mode 100644 index 0000000000..1ce9f76275 --- /dev/null +++ b/benchmark/other-lang/fact.py @@ -0,0 +1,18 @@ +#import sys +#sys.setrecursionlimit(1000) + +def factL(n): + r = 1 + for x in range(2, n+1): + r *= x + return r + +def factR(n): + if n < 2: + return 1 + else: + return n * factR(n-1) + +for i in range(10000): + factR(100) + diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb new file mode 100644 index 0000000000..6cedc752cd --- /dev/null +++ b/benchmark/other-lang/fact.rb @@ -0,0 +1,13 @@ +def fact(n) + if n < 2 + 1 + else + n * fact(n-1) + end +end + +i = 0 +while i<10000 + i += 1 + fact(100) +end diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm new file mode 100644 index 0000000000..c98a7fedd3 --- /dev/null +++ b/benchmark/other-lang/fact.scm @@ -0,0 +1,8 @@ +(define (fact n) + (if (< n 2) + 1 + (* n (fact (- n 1))))) + +(dotimes (i 10000) + (fact 100)) + diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl new file mode 100644 index 0000000000..a46f666d1e --- /dev/null +++ b/benchmark/other-lang/fib.pl @@ -0,0 +1,11 @@ +sub fib{ + my $n = $_[0]; + if($n < 3){ + return 1; + } + else{ + return fib($n-1) + fib($n-2); + } +}; + +&fib(34); diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py new file mode 100644 index 0000000000..45f2bceb8d --- /dev/null +++ b/benchmark/other-lang/fib.py @@ -0,0 +1,7 @@ +def fib(n): + if n < 3: + return 1 + else: + return fib(n-1) + fib(n-2) + +fib(34) diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb new file mode 100644 index 0000000000..ec587eabe0 --- /dev/null +++ b/benchmark/other-lang/fib.rb @@ -0,0 +1,9 @@ +def fib n + if n < 3 + 1 + else + fib(n-1) + fib(n-2) + end +end + +fib(34) diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm new file mode 100644 index 0000000000..2fc4e225bd --- /dev/null +++ b/benchmark/other-lang/fib.scm @@ -0,0 +1,7 @@ +(define (fib n) + (if (< n 3) + 1 + (+ (fib (- n 1)) (fib (- n 2))))) + +(fib 34) + diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl new file mode 100644 index 0000000000..2777490aaa --- /dev/null +++ b/benchmark/other-lang/loop.pl @@ -0,0 +1,3 @@ +for($i=0; $i<30000000; $i++){ +} + diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py new file mode 100644 index 0000000000..003749bf3a --- /dev/null +++ b/benchmark/other-lang/loop.py @@ -0,0 +1,2 @@ +for i in xrange(30000000): + pass diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb new file mode 100644 index 0000000000..b367b9dbf3 --- /dev/null +++ b/benchmark/other-lang/loop.rb @@ -0,0 +1,4 @@ +i = 0 +while i<30000000 + i += 1 +end diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm new file mode 100644 index 0000000000..3364f7e679 --- /dev/null +++ b/benchmark/other-lang/loop.scm @@ -0,0 +1 @@ +(dotimes (x 30000000)) diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb new file mode 100644 index 0000000000..df8fffc1ff --- /dev/null +++ b/benchmark/other-lang/loop2.rb @@ -0,0 +1 @@ +30000000.times{} diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl new file mode 100644 index 0000000000..7e748a67c6 --- /dev/null +++ b/benchmark/other-lang/tak.pl @@ -0,0 +1,11 @@ +sub tak { + local($x, $y, $z) = @_; + if (!($y < $x)) { + return $z; + } else { + return &tak(&tak($x - 1, $y, $z), + &tak($y - 1, $z, $x), + &tak($z - 1, $x, $y)); + } +} +&tak(18, 9, 0); diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py new file mode 100644 index 0000000000..04f3f6829c --- /dev/null +++ b/benchmark/other-lang/tak.py @@ -0,0 +1,8 @@ +def tak(x, y, z): + if not(y<x): + return z + else: + return tak(tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) +tak(18, 9, 0) diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb new file mode 100644 index 0000000000..efe5380f4e --- /dev/null +++ b/benchmark/other-lang/tak.rb @@ -0,0 +1,13 @@ + +def tak x, y, z + unless y < x + z + else + tak( tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) + end +end + +tak(18, 9, 0) + diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm new file mode 100644 index 0000000000..52a7629ee5 --- /dev/null +++ b/benchmark/other-lang/tak.scm @@ -0,0 +1,10 @@ +(define (tak x y z) + (if (not (< y x)) + z + (tak (tak (- x 1) y z) + (tak (- y 1) z x) + (tak (- z 1) x y)))) + +(tak 18 9 0) + + diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml new file mode 100644 index 0000000000..babb65a289 --- /dev/null +++ b/benchmark/pm_array.yml @@ -0,0 +1,19 @@ +prelude: | + def call(*val) + case val + in [String => body] + [200, {}, [body]] + in [Integer => status] + [status, {}, [""]] + in [Integer, String] => response + [response[0], {}, [response[1]]] + in [Integer, Hash, String] => response + [response[0], response[1], [response[2]]] + end + end + +benchmark: + first_match: call("ok") + second_match: call(401) + third_match: call(200, "ok") + fourth_match: call(201, {}, "created") diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml new file mode 100644 index 0000000000..d7ab74bdca --- /dev/null +++ b/benchmark/ractor_const.yml @@ -0,0 +1,4 @@ +type: lib/benchmark_driver/runner/ractor +benchmark: + ractor_const: Object +ractor: 1 diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml new file mode 100644 index 0000000000..8f492be668 --- /dev/null +++ b/benchmark/ractor_float_to_s.yml @@ -0,0 +1,8 @@ +type: lib/benchmark_driver/runner/ractor +prelude: | + FLOATS = [*0.0.step(1.0, 0.001)] +benchmark: + ractor_float_to_s: | + FLOATS.each {|f| f.to_s} +loop_count: 100 +ractor: 2 diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml new file mode 100644 index 0000000000..a6674f82ee --- /dev/null +++ b/benchmark/range_last.yml @@ -0,0 +1,4 @@ +benchmark: + - (1..1_000_000).last(100) + - (1..1_000_000).last(1000) + - (1..1_000_000).last(10000) diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml new file mode 100644 index 0000000000..90a029d5b9 --- /dev/null +++ b/benchmark/realpath.yml @@ -0,0 +1,30 @@ +prelude: | + f = File + pwd = Dir.pwd + Dir.mkdir('b') unless f.directory?('b') + f.write('b/a', '') unless f.file?('b/a') + + relative = 'b/a' + absolute = File.join(pwd, relative) + dir = 'b' + file = 'a' + + relative_dir = 'b/c' + absolute_dir = File.join(pwd, relative_dir) + file_dir = 'c' +benchmark: + relative_nil: "f.realpath(relative, nil)" + absolute_nil: "f.realpath(absolute, nil)" + relative_relative: "f.realpath(file, dir)" + absolute_relative: "f.realpath(absolute, dir)" + relative_absolute: "f.realpath(relative, pwd)" + relative_nil_dir: "f.realdirpath(relative_dir, nil)" + absolute_nil_dir: "f.realdirpath(absolute_dir, nil)" + relative_relative_dir: "f.realdirpath(file_dir, dir)" + absolute_relative_dir: "f.realdirpath(absolute_dir, dir)" + relative_absolute_dir: "f.realdirpath(relative_dir, pwd)" + relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil" + absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil" + relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil" + absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil" + relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil" diff --git a/benchmark/require.yml b/benchmark/require.yml new file mode 100644 index 0000000000..09f218cf08 --- /dev/null +++ b/benchmark/require.yml @@ -0,0 +1,32 @@ +prelude: | + require "fileutils" + + def prepare + num_files = 10000 + + basename = File.dirname($0) + data_dir = File.join(basename, "bm_require.data") + + # skip if all of files exists + if File.exist?(File.join(data_dir, "c#{num_files}.rb")) + return + end + + FileUtils.mkdir_p(data_dir) + + 1.upto(num_files) do |i| + File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n") + end + end + + prepare +benchmark: + require: | + $:.push File.join(File.dirname(__FILE__), "bm_require.data") + + 1.upto(10000) do |i| + require "c#{i}" + end + + $:.pop +loop_count: 1 diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml new file mode 100644 index 0000000000..0c63257106 --- /dev/null +++ b/benchmark/require_thread.yml @@ -0,0 +1,40 @@ +prelude: | + require "fileutils" + + def prepare + num_files = 10000 + + basename = File.dirname($0) + data_dir = File.join(basename, "bm_require.data") + + # skip if all of files exists + if File.exist?(File.join(data_dir, "c#{num_files}.rb")) + return + end + + FileUtils.mkdir_p(data_dir) + + 1.upto(num_files) do |i| + File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n") + end + end + + prepare +benchmark: + require_thread: | + $:.push File.join(File.dirname(__FILE__), "bm_require.data") + + i=0 + t = Thread.new do + while true + i = i+1 # dummy loop + end + end + + 1.upto(100) do |i| + require "c#{i}" + end + + $:.pop + t.kill +loop_count: 1 diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb new file mode 100644 index 0000000000..a082ea6d5b --- /dev/null +++ b/benchmark/securerandom.rb @@ -0,0 +1,5 @@ +require "securerandom" + +20_0000.times do + SecureRandom.random_number(100) +end diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb new file mode 100644 index 0000000000..4effa1ecaf --- /dev/null +++ b/benchmark/so_ackermann.rb @@ -0,0 +1,19 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +NUM = 9 +ack(3, NUM) + + diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb new file mode 100644 index 0000000000..767e03db5f --- /dev/null +++ b/benchmark/so_array.rb @@ -0,0 +1,23 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Paul Brannan and Mark Hubbart + +n = 9000 # Integer(ARGV.shift || 1) + +x = Array.new(n) +y = Array.new(n, 0) + +n.times{|bi| + x[bi] = bi + 1 +} + +(0 .. 999).each do |e| + (n-1).step(0,-1) do |bi| + y[bi] += x.at(bi) + end +end +# puts "#{y.first} #{y.last}" + + diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb new file mode 100644 index 0000000000..b1693e4109 --- /dev/null +++ b/benchmark/so_binary_trees.rb @@ -0,0 +1,62 @@ +# The Computer Language Shootout Benchmarks +# http://shootout.alioth.debian.org +# +# contributed by Jesse Millikan + +# disable output +alias puts_orig puts +def puts str + # disable puts +end + +def item_check(tree) + if tree[0] == nil + tree[1] + else + tree[1] + item_check(tree[0]) - item_check(tree[2]) + end +end + +def bottom_up_tree(item, depth) + if depth > 0 + item_item = 2 * item + depth -= 1 + [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)] + else + [nil, item, nil] + end +end + +max_depth = 16 # ARGV[0].to_i +min_depth = 4 + +max_depth = min_depth + 2 if min_depth + 2 > max_depth + +stretch_depth = max_depth + 1 +stretch_tree = bottom_up_tree(0, stretch_depth) + +puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}" +stretch_tree = nil + +long_lived_tree = bottom_up_tree(0, max_depth) + +min_depth.step(max_depth + 1, 2) do |depth| + iterations = 2**(max_depth - depth + min_depth) + + check = 0 + + for i in 1..iterations + temp_tree = bottom_up_tree(i, depth) + check += item_check(temp_tree) + + temp_tree = bottom_up_tree(-i, depth) + check += item_check(temp_tree) + end + + puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}" +end + +puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}" + +undef puts +alias puts puts_orig diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb new file mode 100644 index 0000000000..4468e20ac8 --- /dev/null +++ b/benchmark/so_concatenate.rb @@ -0,0 +1,18 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# based on code from Aristarkh A Zagorodnikov and Dat Nguyen + +STUFF = "hello\n" +i = 0 +while i<10 + i += 1 + hello = '' + 4_000_000.times do |e| + hello << STUFF + end +end +# puts hello.length + + diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml new file mode 100644 index 0000000000..99683505f9 --- /dev/null +++ b/benchmark/so_count_words.yml @@ -0,0 +1,65 @@ +prelude: | + #!/usr/bin/ruby + + wc_input_base = <<EOS + Subject: Re: Who was Izchak Miller? + From: "Jane D. Anonymous" <nobody@yale.edu> + Date: 1996/04/28 + Message-Id: <4lv7bc$oh@news.ycc.yale.edu> + References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net> + To: 75176.2330@compuserve.com + Content-Type: text/plain; charset=us-ascii + Organization: Yale University + X-Url: news:4lk6vl$gde@ns.oar.net + Mime-Version: 1.0 + Newsgroups: rec.games.roguelike.nethack + X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) + + Hello there, Izchak Miller was my father. When I was younger I spent + many a night, hunched over the keyboard with a cup of tea, playing + nethack with him and my brother. my dad was a philosopher with a strong + weakness for fantasy/sci fi. I remember when he started to get involved + with the Nethack team- my brother's Dungeons and Dragons monster book + found a regular place beside my dad's desk. it's nice to see him living + on in the game he loved so much :-). + Tamar Miller + + The following is a really long word of 5000 characters: + + wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww + EOS + + # prepare 'wc.input' + + def prepare_wc_input(wcbase) + wcinput = File.join(File.dirname($0), 'wc.input') + unless FileTest.exist?(wcinput) + data = wcbase.dup + 13.times{ + data << data + } + open(wcinput, 'w'){|f| f.write data} + end + end + + prepare_wc_input(wc_input_base) + +benchmark: + so_count_words: | + # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $ + # http://www.bagley.org/~doug/shootout/ + # with help from Paul Brannan + input = open(File.join(File.dirname($0), 'wc.input'), 'rb') + + nl = nw = nc = 0 + while true + tmp = input.read(4096) or break + data = tmp << (input.gets || "") + nc += data.length + nl += data.count("\n") + ((data.strip! || data).tr!("\n", " ") || data).squeeze! + nw += data.count(" ") + 1 + end + # STDERR.puts "#{nl} #{nw} #{nc}" + +loop_count: 1 diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb new file mode 100644 index 0000000000..eb205b4df1 --- /dev/null +++ b/benchmark/so_exception.rb @@ -0,0 +1,61 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +$HI = 0 +$LO = 0 +NUM = 250000 # Integer(ARGV[0] || 1) + + +class Lo_Exception < Exception + def initialize(num) + @value = num + end +end + +class Hi_Exception < Exception + def initialize(num) + @value = num + end +end + +def some_function(num) + begin + hi_function(num) + rescue + print "We shouldn't get here, exception is: #{$!.type}\n" + end +end + +def hi_function(num) + begin + lo_function(num) + rescue Hi_Exception + $HI = $HI + 1 + end +end + +def lo_function(num) + begin + blowup(num) + rescue Lo_Exception + $LO = $LO + 1 + end +end + +def blowup(num) + if num % 2 == 0 + raise Lo_Exception.new(num) + else + raise Hi_Exception.new(num) + end +end + + +i = 1 +max = NUM+1 +while i < max + i += 1 + some_function(i+1) +end diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb new file mode 100644 index 0000000000..bac5ecd44c --- /dev/null +++ b/benchmark/so_fannkuch.rb @@ -0,0 +1,45 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura +# Modified by Ryan Williams + +def fannkuch(n) + maxFlips, m, r, check = 0, n-1, n, 0 + count = (1..n).to_a + perm = (1..n).to_a + + while true + if check < 30 + puts "#{perm}" + check += 1 + end + + while r != 1 + count[r-1] = r + r -= 1 + end + + if perm[0] != 1 and perm[m] != n + perml = perm.clone #.dup + flips = 0 + while (k = perml.first ) != 1 + perml = perml.slice!(0, k).reverse + perml + flips += 1 + end + maxFlips = flips if flips > maxFlips + end + while true + if r==n then return maxFlips end + perm.insert r,perm.shift + break if (count[r] -= 1) > 0 + r += 1 + end + end +end + +def puts *args +end + +N = 9 # (ARGV[0] || 1).to_i +puts "Pfannkuchen(#{N}) = #{fannkuch(N)}" + diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb new file mode 100644 index 0000000000..dcc6b39507 --- /dev/null +++ b/benchmark/so_fasta.rb @@ -0,0 +1,81 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +$last = 42.0 +def gen_random(max, im=139968, ia=3877, ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im +end + +alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + +iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], +] +homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], +] + +def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) +end + +def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end +end + + +n = (ARGV[0] or 250_000).to_i + +make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) +make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) +make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml new file mode 100644 index 0000000000..d7df086c39 --- /dev/null +++ b/benchmark/so_k_nucleotide.yml @@ -0,0 +1,155 @@ +prelude: | + bm_so_fasta = <<'EOS' + # The Computer Language Shootout + # http://shootout.alioth.debian.org/ + # Contributed by Sokolov Yura + + $last = 42.0 + def gen_random(max, im=139968, ia=3877, ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im + end + + alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + + iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], + ] + homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], + ] + + def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) + end + + def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + end + + + n = (ARGV[0] or 250_000).to_i + + make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) + make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) + make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + EOS +benchmark: + - name: so_k_nucleotide + prelude: | + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + File.write(script, bm_so_fasta) + + def prepare_fasta_output n + filebase = File.join(File.dirname($0), 'fasta.output') + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + file = "#{filebase}.#{n}" + + unless FileTest.exist?(file) + STDERR.puts "preparing #{file}" + + open(file, 'w'){|f| + ARGV[0] = n + $stdout = f + load script + $stdout = STDOUT + } + end + end + prepare_fasta_output(100_000) + script: | + # The Computer Language Shootout + # http://shootout.alioth.debian.org + # + # contributed by jose fco. gonzalez + # modified by Sokolov Yura + + seq = String.new + + def frecuency( seq,length ) + n, table = seq.length - length + 1, Hash.new(0) + f, i = nil, nil + (0 ... length).each do |f| + (f ... n).step(length) do |i| + table[seq[i,length]] += 1 + end + end + [n,table] + + end + + def sort_by_freq( seq,length ) + n,table = frecuency( seq,length ) + a, b, v = nil, nil, nil + table.sort{|a,b| b[1] <=> a[1]}.each do |v| + puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] + end + puts + end + + def find_seq( seq,s ) + n,table = frecuency( seq,s.length ) + puts "#{table[s].to_s}\t#{s.upcase}" + end + + input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') + + line = input.gets while line !~ /^>THREE/ + line = input.gets + + while (line !~ /^>/) & line do + seq << line.chomp + line = input.gets + end + + [1,2].each {|i| sort_by_freq( seq,i ) } + + %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } + loop_count: 1 diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb new file mode 100644 index 0000000000..e8f4a2a5f7 --- /dev/null +++ b/benchmark/so_lists.rb @@ -0,0 +1,47 @@ +#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby + +NUM = 300 +SIZE = 10000 + +def test_lists() + # create a list of integers (Li1) from 1 to SIZE + li1 = (1..SIZE).to_a + # copy the list to li2 (not by individual items) + li2 = li1.dup + # remove each individual item from left side of li2 and + # append to right side of li3 (preserving order) + li3 = Array.new + while (not li2.empty?) + li3.push(li2.shift) + end + # li2 must now be empty + # remove each individual item from right side of li3 and + # append to right side of li2 (reversing list) + while (not li3.empty?) + li2.push(li3.pop) + end + # li3 must now be empty + # reverse li1 in place + li1.reverse! + # check that first item is now SIZE + if li1[0] != SIZE then + p "not SIZE" + 0 + else + # compare li1 and li2 for equality + if li1 != li2 then + return(0) + else + # return the length of the list + li1.length + end + end +end + +i = 0 +while i<NUM + i += 1 + result = test_lists() +end + +result diff --git a/benchmark/so_mandelbrot.rb b/benchmark/so_mandelbrot.rb new file mode 100644 index 0000000000..76331c64b8 --- /dev/null +++ b/benchmark/so_mandelbrot.rb @@ -0,0 +1,57 @@ +# The Computer Language Benchmarks Game +# http://shootout.alioth.debian.org/ +# +# contributed by Karl von Laudermann +# modified by Jeremy Echols + +size = 600 # ARGV[0].to_i + +puts "P4\n#{size} #{size}" + +ITER = 49 # Iterations - 1 for easy for..in looping +LIMIT_SQUARED = 4.0 # Presquared limit + +byte_acc = 0 +bit_num = 0 + +count_size = size - 1 # Precomputed size for easy for..in looping + +# For..in loops are faster than .upto, .downto, .times, etc. +for y in 0..count_size + for x in 0..count_size + zr = 0.0 + zi = 0.0 + cr = (2.0*x/size)-1.5 + ci = (2.0*y/size)-1.0 + escape = false + + # To make use of the for..in code, we use a dummy variable, + # like one would in C + for dummy in 0..ITER + tr = zr*zr - zi*zi + cr + ti = 2*zr*zi + ci + zr, zi = tr, ti + + if (zr*zr+zi*zi) > LIMIT_SQUARED + escape = true + break + end + end + + byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1) + bit_num += 1 + + # Code is very similar for these cases, but using separate blocks + # ensures we skip the shifting when it's unnecessary, which is most cases. + if (bit_num == 8) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + elsif (x == count_size) + byte_acc <<= (8 - bit_num) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + end + end +end diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb new file mode 100644 index 0000000000..2d1e72bda9 --- /dev/null +++ b/benchmark/so_matrix.rb @@ -0,0 +1,48 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +n = 60 #Integer(ARGV.shift || 1) + +size = 40 + +def mkmatrix(rows, cols) + count = 1 + mx = Array.new(rows) + (0 .. (rows - 1)).each do |bi| + row = Array.new(cols, 0) + (0 .. (cols - 1)).each do |j| + row[j] = count + count += 1 + end + mx[bi] = row + end + mx +end + +def mmult(rows, cols, m1, m2) + m3 = Array.new(rows) + (0 .. (rows - 1)).each do |bi| + row = Array.new(cols, 0) + (0 .. (cols - 1)).each do |j| + val = 0 + (0 .. (cols - 1)).each do |k| + val += m1.at(bi).at(k) * m2.at(k).at(j) + end + row[j] = val + end + m3[bi] = row + end + m3 +end + +m1 = mkmatrix(size, size) +m2 = mkmatrix(size, size) +mm = Array.new +n.times do + mm = mmult(size, size, m1, m2) +end +# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}" + + diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb new file mode 100644 index 0000000000..8c136baa6c --- /dev/null +++ b/benchmark/so_meteor_contest.rb @@ -0,0 +1,563 @@ +#!/usr/bin/env ruby +# +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# contributed by Kevin Barnes (Ruby novice) + +# PROGRAM: the main body is at the bottom. +# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# 2) see how I represent a board as a bitmask by reading the blank_board comments +# 3) read as your mental paths take you + +def print *args +end + +# class to represent all information about a particular rotation of a particular piece +class Rotation + # an array (by location) containing a bit mask for how the piece maps at the given location. + # if the rotation is invalid at that location the mask will contain false + attr_reader :start_masks + + # maps a direction to a relative location. these differ depending on whether it is an even or + # odd row being mapped from + @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 } + @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 } + + def initialize( directions ) + @even_offsets, @odd_offsets = normalize_offsets( get_values( directions )) + + @even_mask = mask_for_offsets( @even_offsets) + @odd_mask = mask_for_offsets( @odd_offsets) + + @start_masks = Array.new(60) + + # create the rotational masks by placing the base mask at the location and seeing if + # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these + # is true the piece cannot be placed + 0.upto(59) do | offset | + mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset) + if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then + imask = compute_required( mask, offset) + @start_masks[offset] = [ mask, imask, imask | mask ] + else + @start_masks[offset] = false + end + end + end + + def compute_required( mask, offset ) + board = blank_board + 0.upto(offset) { | i | board |= 1 << i } + board |= mask + return 0 if (!prunable(board | mask, offset)) + board = flood_fill(board,58) + count = 0 + imask = 0 + 0.upto(59) do | i | + if (board[i] == 0) then + imask |= (1 << i) + count += 1 + end + end + (count > 0 && count < 5) ? imask : 0 + end + + def flood_fill( board, location) + return board if (board[location] == 1) + board |= 1 << location + row, col = location.divmod(6) + board = flood_fill( board, location - 1) if (col > 0) + board = flood_fill( board, location + 1) if (col < 4) + if (row % 2 == 0) then + board = flood_fill( board, location - 7) if (col > 0 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 5) if (col > 0 && row < 9) + else + board = flood_fill( board, location - 5) if (col < 4 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 7) if (col < 4 && row < 9) + end + board + end + + # given a location, produces a list of relative locations covered by the piece at this rotation + def offsets( location) + if is_even( location) then + @even_offsets.collect { | value | value + location } + else + @odd_offsets.collect { | value | value + location } + end + end + + # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows) + # this is hard to explain. imagine we have this partial board: + # 0 0 0 0 0 x [positions 0-5] + # 0 0 1 1 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 1 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # The top-left of the piece is at position 8, the + # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that + # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained + # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row: + # 0 0 0 1 1 x [positions 0-5] + # 0 0 1 0 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 0 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the + # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what + # this function would return + def normalize_offsets( values) + min = values.min + even_min = is_even(min) + other_min = even_min ? min + 6 : min + 7 + other_values = values.collect do | value | + if is_even(value) then + value + 6 - other_min + else + value + 7 - other_min + end + end + values.collect! { | value | value - min } + + if even_min then + [values, other_values] + else + [other_values, values] + end + end + + # produce a bitmask representation of an array of offset locations + def mask_for_offsets( offsets ) + mask = 0 + offsets.each { | value | mask = mask + ( 1 << value ) } + mask + end + + # finds a "safe" position that a position as described by a list of directions can be placed + # without falling off any edge of the board. the values returned a location to place the first piece + # at so it will fit after making the described moves + def start_adjust( directions ) + south = east = 0; + directions.each do | direction | + east += 1 if ( direction == :sw || direction == :nw || direction == :west ) + south += 1 if ( direction == :nw || direction == :ne ) + end + south * 6 + east + end + + # given a set of directions places the piece (as defined by a set of directions) on the board at + # a location that will not take it off the edge + def get_values( directions ) + start = start_adjust(directions) + values = [ start ] + directions.each do | direction | + if (start % 12 >= 6) then + start += @@rotation_odd_adder[direction] + else + start += @@rotation_even_adder[direction] + end + values += [ start ] + end + + # some moves take you back to an existing location, we'll strip duplicates + values.uniq + end +end + +# describes a piece and caches information about its rotations to as to be efficient for iteration +# ATTRIBUTES: +# rotations -- all the rotations of the piece +# type -- a numeic "name" of the piece +# masks -- an array by location of all legal rotational masks (a n inner array) for that location +# placed -- the mask that this piece was last placed at (not a location, but the actual mask used) +class Piece + attr_reader :rotations, :type, :masks + attr_accessor :placed + + # transform hashes that change one direction into another when you either flip or rotate a set of directions + @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne } + @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw } + + def initialize( directions, type ) + @type = type + @rotations = Array.new(); + @map = {} + + generate_rotations( directions ) + directions.collect! { | value | @@flip_converter[value] } + generate_rotations( directions ) + + # creates the masks AND a map that returns [location, rotation] for any given mask + # this is used when a board is found and we want to draw it, otherwise the map is unused + @masks = Array.new(); + 0.upto(59) do | i | + even = true + @masks[i] = @rotations.collect do | rotation | + mask = rotation.start_masks[i] + @map[mask[0]] = [ i, rotation ] if (mask) + mask || nil + end + @masks[i].compact! + end + end + + # rotates a set of directions through all six angles and adds a Rotation to the list for each one + def generate_rotations( directions ) + 6.times do + rotations.push( Rotation.new(directions)) + directions.collect! { | value | @@rotate_converter[value] } + end + end + + # given a board string, adds this piece to the board at whatever location/rotation + # important: the outbound board string is 5 wide, the normal location notation is six wide (padded) + def fill_string( board_string) + location, rotation = @map[@placed] + rotation.offsets(location).each do | offset | + row, col = offset.divmod(6) + board_string[ row*5 + col, 1 ] = @type.to_s + end + end +end + +# a blank bit board having this form: +# +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 1 1 1 1 1 1 +# +# where left lest significant bit is the top left and the most significant is the lower right +# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running +# off the edges or bottom +def blank_board + 0b111111100000100000100000100000100000100000100000100000100000100000 +end + +def full_board + 0b111111111111111111111111111111111111111111111111111111111111111111 +end + +# determines if a location (bit position) is in an even row +def is_even( location) + (location % 12) < 6 +end + +# support function that create three utility maps: +# $converter -- for each row an array that maps a five bit row (via array mapping) +# to the a five bit representation of the bits below it +# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row +# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays +# a region array has three values the first is a mask of bits in the region, +# the second is the count of those bits and the third is identical to the first +# examples: +# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001] +# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001] +# 0b10001 => [ 0b01110, 3, 0b01110 ] +def create_collector_support + odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000] + even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000] + + all_odds = Array.new(0b100000) + all_evens = Array.new(0b100000) + bit_counts = Array.new(0b100000) + new_regions = Array.new(0b100000) + 0.upto(0b11111) do | i | + bit_count = odd = even = 0 + 0.upto(4) do | bit | + if (i[bit] == 1) then + bit_count += 1 + odd |= odd_map[bit] + even |= even_map[bit] + end + end + all_odds[i] = odd + all_evens[i] = even + bit_counts[i] = bit_count + new_regions[i] = create_regions( i) + end + + $converter = [] + 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) } + $bit_counts = bit_counts + $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } } +end + +# determines if a board is punable, meaning that there is no possibility that it +# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces +# that are not a multiple of five. The following board is an example of a prunable board: +# 0 0 1 0 0 +# 0 1 0 0 0 +# 1 1 0 0 0 +# 0 1 0 0 0 +# 0 0 0 0 0 +# ... +# +# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it +# parameters: +# board -- an initial bit board (6 bit padded rows, see blank_board for format) +# location -- starting location, everything above and to the left is already full +# slotting -- set to true only when testing initial pieces, when filling normally +# additional assumptions are possible +# +# Algorithm: +# The algorithm starts at the top row (as determined by location) and iterates a row at a time +# maintainng counts of active open areas (kept in the collector array) each collector contains +# three values at the start of an iteration: +# 0: mask of bits that would be adjacent to the collector in this row +# 1: the number of bits collected so far +# 2: a scratch space starting as zero, but used during the computation to represent +# the empty bits in the new row that are adjacent (position 0) +# The exact procedure is described in-code +def prunable( board, location, slotting = false) + collectors = [] + # loop across the rows + (location / 6).to_i.upto(9) do | row_on | + # obtain a set of regions representing the bits of the current row. + regions = $regions[(board >> (row_on * 6)) & 0b11111] + converter = $converter[row_on] + + # track the number of collectors at the start of the cycle so that + # we don't compute against newly created collectors, only existing collectors + initial_collector_count = collectors.length + + # loop against the regions. For each region of the row + # we will see if it connects to one or more existing collectors. + # if it connects to 1 collector, the bits from the region are added to the + # bits of the collector and the mask is placed in collector[2] + # If the region overlaps more than one collector then all the collectors + # it overlaps with are merged into the first one (the others are set to nil in the array) + # if NO collectors are found then the region is copied as a new collector + regions.each do | region | + collector_found = nil + region_mask = region[2] + initial_collector_count.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + collector_mask = collector[0] + if (collector_mask & region_mask != 0) then + if (collector_found) then + collector_found[0] |= collector_mask + collector_found[1] += collector[1] + collector_found[2] |= collector[2] + collectors[collector_num] = nil + else + collector_found = collector + collector[1] += region[1] + collector[2] |= region_mask + end + end + end + end + if (collector_found == nil) then + collectors.push(Array.new(region)) + end + end + + # check the existing collectors, if any collector overlapped no bits in the region its [2] value will + # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since + # the board is prunable. if it is a multiple of five it is removed. + # Collector that are still active have a new adjacent value [0] set based n the matched bits + # and have [2] cleared out for the next cycle. + collectors.length.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + if (collector[2] == 0) then + return true if (collector[1] % 5 != 0) + collectors[collector_num] = nil + else + # if a collector matches all bits in the row then we can return unprunable early for the + # following reasons: + # 1) there can be no more unavailable bits bince we fill from the top left downward + # 2) all previous regions have been closed or joined so only this region can fail + # 3) this region must be good since there can never be only 1 region that is nuot + # a multiple of five + # this rule only applies when filling normally, so we ignore the rule if we are "slotting" + # in pieces to see what configurations work for them (the only other time this algorithm is used). + return false if (collector[2] == 0b11111 && !slotting) + collector[0] = converter[collector[2]] + collector[2] = 0 + end + end + end + + # get rid of all the empty converters for the next round + collectors.compact! + end + return false if (collectors.length <= 1) # 1 collector or less and the region is fine + collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size +end + +# creates a region given a row mask. see prunable for what a "region" is +def create_regions( value ) + regions = [] + cur_region = 0 + 5.times do | bit | + if (value[bit] == 0) then + cur_region |= 1 << bit + else + if (cur_region != 0 ) then + regions.push( cur_region) + cur_region = 0; + end + end + end + regions.push(cur_region) if (cur_region != 0) + regions +end + +# find up to the counted number of solutions (or all solutions) and prints the final result +def find_all + find_top( 1) + find_top( 0) + print_results +end + +# show the board +def print_results + print "#{@boards_found} solutions found\n\n" + print_full_board( @min_board) + print "\n" + print_full_board( @max_board) + print "\n" +end + +# finds solutions. This special version of the main function is only used for the top level +# the reason for it is basically to force a particular ordering on how the rotations are tested for +# the first piece. It is called twice, first looking for placements of the odd rotations and then +# looking for placements of the even locations. +# +# WHY? +# Since any found solution has an inverse we want to maximize finding solutions that are not already found +# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away +# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier +# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will +# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces +# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the +# maximum number +def find_top( rotation_skip) + board = blank_board + (@pieces.length-1).times do + piece = @pieces.shift + piece.masks[0].each do | mask, imask, cmask | + if ((rotation_skip += 1) % 2 == 0) then + piece.placed = mask + find( 1, 1, board | mask) + end + end + @pieces.push(piece) + end + piece = @pieces.shift + @pieces.push(piece) +end + +# the normail find routine, iterates through the available pieces, checks all rotations at the current location +# and adds any boards found. depth is achieved via recursion. the overall approach is described +# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# parameters: +# start_location -- where to start looking for place for the next piece at +# placed -- number of pieces placed +# board -- current state of the board +# +# see in-code comments +def find( start_location, placed, board) + # find the next location to place a piece by looking for an empty bit + while board[start_location] == 1 + start_location += 1 + end + + @pieces.length.times do + piece = @pieces.shift + piece.masks[start_location].each do | mask, imask, cmask | + if ( board & cmask == imask) then + piece.placed = mask + if (placed == 9) then + add_board + else + find( start_location + 1, placed + 1, board | mask) + end + end + end + @pieces.push(piece) + end +end + +# print the board +def print_full_board( board_string) + 10.times do | row | + print " " if (row % 2 == 1) + 5.times do | col | + print "#{board_string[row*5 + col,1]} " + end + print "\n" + end +end + +# when a board is found we "draw it" into a string and then flip that string, adding both to +# the list (hash) of solutions if they are unique. +def add_board + board_string = "99999999999999999999999999999999999999999999999999" + @all_pieces.each { | piece | piece.fill_string( board_string ) } + save( board_string) + save( board_string.reverse) +end + +# adds a board string to the list (if new) and updates the current best/worst board +def save( board_string) + if (@all_boards[board_string] == nil) then + @min_board = board_string if (board_string < @min_board) + @max_board = board_string if (board_string > @max_board) + @all_boards.store(board_string,true) + @boards_found += 1 + + # the exit motif is a time saver. Ideally the function should return, but those tests + # take noticeable time (performance). + if (@boards_found == @stop_count) then + print_results + exit(0) + end + end +end + + +## +## MAIN BODY :) +## +create_collector_support +@pieces = [ + Piece.new( [ :nw, :ne, :east, :east ], 2), + Piece.new( [ :ne, :se, :east, :ne ], 7), + Piece.new( [ :ne, :east, :ne, :nw ], 1), + Piece.new( [ :east, :sw, :sw, :se ], 6), + Piece.new( [ :east, :ne, :se, :ne ], 5), + Piece.new( [ :east, :east, :east, :se ], 0), + Piece.new( [ :ne, :nw, :se, :east, :se ], 4), + Piece.new( [ :se, :se, :se, :west ], 9), + Piece.new( [ :se, :se, :east, :se ], 8), + Piece.new( [ :east, :east, :sw, :se ], 3) + ]; + +@all_pieces = Array.new( @pieces) + +@min_board = "99999999999999999999999999999999999999999999999999" +@max_board = "00000000000000000000000000000000000000000000000000" +@stop_count = ARGV[0].to_i || 2089 +@all_boards = {} +@boards_found = 0 + +find_all ######## DO IT!!! diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb new file mode 100644 index 0000000000..d6c5bb9e61 --- /dev/null +++ b/benchmark/so_nbody.rb @@ -0,0 +1,148 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# Optimized for Ruby by Jesse Millikan +# From version ported by Michael Neumann from the C gcc version, +# which was written by Christoph Bauer. + +SOLAR_MASS = 4 * Math::PI**2 +DAYS_PER_YEAR = 365.24 + +def _puts *args +end + +class Planet + attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass + + def initialize(x, y, z, vx, vy, vz, mass) + @x, @y, @z = x, y, z + @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR + @mass = mass * SOLAR_MASS + end + + def move_from_i(bodies, nbodies, dt, i) + while i < nbodies + b2 = bodies[i] + dx = @x - b2.x + dy = @y - b2.y + dz = @z - b2.z + + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + mag = dt / (distance * distance * distance) + b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag + + @vx -= dx * b2_mass_mag + @vy -= dy * b2_mass_mag + @vz -= dz * b2_mass_mag + b2.vx += dx * b_mass_mag + b2.vy += dy * b_mass_mag + b2.vz += dz * b_mass_mag + i += 1 + end + + @x += dt * @vx + @y += dt * @vy + @z += dt * @vz + end +end + +def energy(bodies) + e = 0.0 + nbodies = bodies.size + + for i in 0 ... nbodies + b = bodies[i] + e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz) + for j in (i + 1) ... nbodies + b2 = bodies[j] + dx = b.x - b2.x + dy = b.y - b2.y + dz = b.z - b2.z + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + e -= (b.mass * b2.mass) / distance + end + end + e +end + +def offset_momentum(bodies) + px, py, pz = 0.0, 0.0, 0.0 + + for b in bodies + m = b.mass + px += b.vx * m + py += b.vy * m + pz += b.vz * m + end + + b = bodies[0] + b.vx = - px / SOLAR_MASS + b.vy = - py / SOLAR_MASS + b.vz = - pz / SOLAR_MASS +end + +BODIES = [ + # sun + Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0), + + # jupiter + Planet.new( + 4.84143144246472090e+00, + -1.16032004402742839e+00, + -1.03622044471123109e-01, + 1.66007664274403694e-03, + 7.69901118419740425e-03, + -6.90460016972063023e-05, + 9.54791938424326609e-04), + + # saturn + Planet.new( + 8.34336671824457987e+00, + 4.12479856412430479e+00, + -4.03523417114321381e-01, + -2.76742510726862411e-03, + 4.99852801234917238e-03, + 2.30417297573763929e-05, + 2.85885980666130812e-04), + + # uranus + Planet.new( + 1.28943695621391310e+01, + -1.51111514016986312e+01, + -2.23307578892655734e-01, + 2.96460137564761618e-03, + 2.37847173959480950e-03, + -2.96589568540237556e-05, + 4.36624404335156298e-05), + + # neptune + Planet.new( + 1.53796971148509165e+01, + -2.59193146099879641e+01, + 1.79258772950371181e-01, + 2.68067772490389322e-03, + 1.62824170038242295e-03, + -9.51592254519715870e-05, + 5.15138902046611451e-05) +] + +init = 200_000 # ARGV[0] +n = Integer(init) + +offset_momentum(BODIES) + +puts "%.9f" % energy(BODIES) + +nbodies = BODIES.size +dt = 0.01 + +n.times do + i = 0 + while i < nbodies + b = BODIES[i] + b.move_from_i(BODIES, nbodies, dt, i + 1) + i += 1 + end +end + +puts "%.9f" % energy(BODIES) diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb new file mode 100644 index 0000000000..766fcf7b84 --- /dev/null +++ b/benchmark/so_nested_loop.rb @@ -0,0 +1,24 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# from Avi Bryant + +n = 16 # Integer(ARGV.shift || 1) +x = 0 +n.times do + n.times do + n.times do + n.times do + n.times do + n.times do + x += 1 + end + end + end + end + end +end +# puts x + + diff --git a/benchmark/so_nsieve.rb b/benchmark/so_nsieve.rb new file mode 100644 index 0000000000..a65cc78233 --- /dev/null +++ b/benchmark/so_nsieve.rb @@ -0,0 +1,35 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Glenn Parker, March 2005 +# modified by Evan Phoenix, Sept 2006 + +def sieve(m) + flags = Flags.dup[0,m] + count = 0 + pmax = m - 1 + p = 2 + while p <= pmax + unless flags[p].zero? + count += 1 + mult = p + while mult <= pmax + flags[mult] = 0 + mult += p + end + end + p += 1 + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*") + +n.downto(n-2) do |exponent| + break if exponent < 0 + m = (1 << exponent) * 10_000 + # m = (2 ** exponent) * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb new file mode 100644 index 0000000000..6f958ee44e --- /dev/null +++ b/benchmark/so_nsieve_bits.rb @@ -0,0 +1,43 @@ +#!/usr/bin/ruby +#coding: us-ascii +# +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# nsieve-bits in Ruby +# Contributed by Glenn Parker, March 2005 + +CharExponent = 3 +BitsPerChar = 1 << CharExponent +LowMask = BitsPerChar - 1 + +def sieve(m) + items = "\xFF" * ((m / BitsPerChar) + 1) + masks = "" + BitsPerChar.times do |b| + masks << (1 << b).chr + end + + count = 0 + pmax = m - 1 + 2.step(pmax, 1) do |p| + if items[p >> CharExponent][p & LowMask] == 1 + count += 1 + p.step(pmax, p) do |mult| + a = mult >> CharExponent + b = mult & LowMask + items[a] -= masks[b] if items[a][b] != 0 + end + end + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +n.step(n - 2, -1) do |exponent| + break if exponent < 0 + m = 2 ** exponent * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end + diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb new file mode 100644 index 0000000000..131f44624c --- /dev/null +++ b/benchmark/so_object.rb @@ -0,0 +1,56 @@ +#!/usr/bin/ruby +# -*- Ruby -*- +# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Aristarkh Zagorodnikov + +class Toggle + def initialize(start_state) + @bool = start_state + end + + def value + @bool + end + + def activate + @bool = !@bool + self + end +end + +class NthToggle < Toggle + def initialize(start_state, max_counter) + super start_state + @count_max = max_counter + @counter = 0 + end + + def activate + @counter += 1 + if @counter >= @count_max + @bool = !@bool + @counter = 0 + end + self + end +end + +n = 1500000 # (ARGV.shift || 1).to_i + +toggle = Toggle.new 1 +5.times do + toggle.activate.value ? 'true' : 'false' +end +n.times do + toggle = Toggle.new 1 +end + +ntoggle = NthToggle.new 1, 3 +8.times do + ntoggle.activate.value ? 'true' : 'false' +end +n.times do + ntoggle = NthToggle.new 1, 3 +end + diff --git a/benchmark/so_partial_sums.rb b/benchmark/so_partial_sums.rb new file mode 100644 index 0000000000..630b45cb8d --- /dev/null +++ b/benchmark/so_partial_sums.rb @@ -0,0 +1,31 @@ +n = 2_500_000 # (ARGV.shift || 1).to_i + +alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0 + +1.upto(n) do |d| + d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d) + + s0 += (2.0 / 3.0) ** (d - 1.0) + s1 += 1.0 / Math.sqrt(d) + s2 += 1.0 / (d * (d + 1.0)) + s3 += 1.0 / (d3 * ds * ds) + s4 += 1.0 / (d3 * dc * dc) + s5 += 1.0 / d + s6 += 1.0 / d2 + s7 += alt / d + s8 += alt / (2.0 * d - 1.0) + + alt = -alt +end + +if false + printf("%.9f\t(2/3)^k\n", s0) + printf("%.9f\tk^-0.5\n", s1) + printf("%.9f\t1/k(k+1)\n", s2) + printf("%.9f\tFlint Hills\n", s3) + printf("%.9f\tCookson Hills\n", s4) + printf("%.9f\tHarmonic\n", s5) + printf("%.9f\tRiemann Zeta\n", s6) + printf("%.9f\tAlternating Harmonic\n", s7) + printf("%.9f\tGregory\n", s8) +end diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb new file mode 100644 index 0000000000..9a537b2d1c --- /dev/null +++ b/benchmark/so_pidigits.rb @@ -0,0 +1,92 @@ +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Gabriele Renzi + +class PiDigitSpigot + + def initialize() + @z = Transformation.new 1,0,0,1 + @x = Transformation.new 0,0,0,0 + @inverse = Transformation.new 0,0,0,0 + end + + def next! + @y = @z.extract(3) + if safe? @y + @z = produce(@y) + @y + else + @z = consume @x.next!() + next!() + end + end + + def safe?(digit) + digit == @z.extract(4) + end + + def produce(i) + @inverse.qrst(10,-10*i,0,1).compose(@z) + end + + def consume(a) + @z.compose(a) + end +end + + +class Transformation + attr_reader :q, :r, :s, :t + def initialize(q, r, s, t) + @q,@r,@s,@t,@k = q,r,s,t,0 + end + + def next!() + @q = @k = @k + 1 + @r = 4 * @k + 2 + @s = 0 + @t = 2 * @k + 1 + self + end + + def extract(j) + (@q * j + @r) / (@s * j + @t) + end + + def compose(a) + self.class.new( @q * a.q, + @q * a.r + r * a.t, + @s * a.q + t * a.s, + @s * a.r + t * a.t + ) + end + + def qrst *args + initialize *args + self + end + + +end + + +WIDTH = 10 +n = 2_500 # Integer(ARGV[0]) +j = 0 + +digits = PiDigitSpigot.new + +while n > 0 + if n >= WIDTH + WIDTH.times {print digits.next!} + j += WIDTH + else + n.times {print digits.next!} + (WIDTH-n).times {print " "} + j += n + end + puts "\t:"+j.to_s + n -= WIDTH +end + diff --git a/benchmark/so_random.rb b/benchmark/so_random.rb new file mode 100644 index 0000000000..a66b9e8e63 --- /dev/null +++ b/benchmark/so_random.rb @@ -0,0 +1,20 @@ +# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby + +IM = 139968.0 +IA = 3877.0 +IC = 29573.0 + +$last = 42.0 + +def gen_random(max) + (max * ($last = ($last * IA + IC) % IM)) / IM +end + +N = 3_000_000 + +i = 0 +while i<N + i +=1 + gen_random(100.0) +end +# "%.9f" % gen_random(100.0) diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml new file mode 100644 index 0000000000..de05eedfc4 --- /dev/null +++ b/benchmark/so_reverse_complement.yml @@ -0,0 +1,137 @@ +prelude: | + bm_so_fasta = <<'EOS' + # The Computer Language Shootout + # http://shootout.alioth.debian.org/ + # Contributed by Sokolov Yura + + $last = 42.0 + def gen_random(max, im=139968, ia=3877, ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im + end + + alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + + iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], + ] + homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], + ] + + def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) + end + + def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + end + + + n = (ARGV[0] or 250_000).to_i + + make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) + make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) + make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + EOS +benchmark: + - name: so_reverse_complement + prelude: | + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + File.write(script, bm_so_fasta) + + def prepare_fasta_output n + filebase = File.join(File.dirname($0), 'fasta.output') + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + file = "#{filebase}.#{n}" + + unless FileTest.exist?(file) + STDERR.puts "preparing #{file}" + + open(file, 'w'){|f| + ARGV[0] = n + $stdout = f + load script + $stdout = STDOUT + } + end + end + prepare_fasta_output(2_500_000) + script: | + # The Great Computer Language Shootout + # http://shootout.alioth.debian.org/ + # + # Contributed by Peter Bjarke Olsen + # Modified by Doug King + + seq=Array.new + + def revcomp(seq) + seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN') + stringlen=seq.length + 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"} + end + + input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb') + + while input.gets + if $_ =~ />/ + if seq.length != 0 + revcomp(seq.join) + seq=Array.new + end + puts $_ + else + $_.sub(/\n/,'') + seq.push $_ + end + end + revcomp(seq.join) + loop_count: 1 diff --git a/benchmark/so_sieve.rb b/benchmark/so_sieve.rb new file mode 100644 index 0000000000..43dc302648 --- /dev/null +++ b/benchmark/so_sieve.rb @@ -0,0 +1,24 @@ +# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby +num = 500 +count = i = j = 0 +flags0 = Array.new(8192,1) +k = 0 +while k < num + k += 1 + count = 0 + flags = flags0.dup + i = 2 + while i<8192 + i += 1 + if flags[i] + # remove all multiples of prime: i + j = i*i + while j < 8192 + j += i + flags[j] = nil + end + count += 1 + end + end +end +count diff --git a/benchmark/so_spectralnorm.rb b/benchmark/so_spectralnorm.rb new file mode 100644 index 0000000000..6b97206689 --- /dev/null +++ b/benchmark/so_spectralnorm.rb @@ -0,0 +1,50 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +def eval_A(i,j) + return 1.0/((i+j)*(i+j+1)/2+i+1) +end + +def eval_A_times_u(u) + v, i = nil, nil + (0..u.length-1).collect { |i| + v = 0 + for j in 0..u.length-1 + v += eval_A(i,j)*u[j] + end + v + } +end + +def eval_At_times_u(u) + v, i = nil, nil + (0..u.length-1).collect{|i| + v = 0 + for j in 0..u.length-1 + v += eval_A(j,i)*u[j] + end + v + } +end + +def eval_AtA_times_u(u) + return eval_At_times_u(eval_A_times_u(u)) +end + +n = 500 # ARGV[0].to_i + +u=[1]*n +for i in 1..10 + v=eval_AtA_times_u(u) + u=eval_AtA_times_u(v) +end +vBv=0 +vv=0 +for i in 0..n-1 + vBv += u[i]*v[i] + vv += v[i]*v[i] +end + +str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n" +# print str diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml new file mode 100644 index 0000000000..7d23fd3d35 --- /dev/null +++ b/benchmark/string_capitalize.yml @@ -0,0 +1,10 @@ +prelude: | + str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("") + str10 = str1 * 10 + str100 = str10 * 10 + str1000 = str100 * 10 +benchmark: + capitalize-1: str1.capitalize + capitalize-10: str10.capitalize + capitalize-100: str100.capitalize + capitalize-1000: str1000.capitalize diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml new file mode 100644 index 0000000000..2354040a04 --- /dev/null +++ b/benchmark/string_casecmp.yml @@ -0,0 +1,26 @@ +prelude: | + lstr1 = [*"a".."z",*"0".."9"].join("") + lstr10 = lstr1 * 10 + lstr100 = lstr10 * 10 + lstr1000 = lstr100 * 10 + lnonascii1 = [*"\u{e0}".."\u{ff}"].join("") + lnonascii10 = lnonascii1 * 10 + lnonascii100 = lnonascii10 * 10 + lnonascii1000 = lnonascii100 * 10 + ustr1 = [*"A".."Z",*"0".."9"].join("") + ustr10 = ustr1 * 10 + ustr100 = ustr10 * 10 + ustr1000 = ustr100 * 10 + unonascii1 = [*"\u{c0}".."\u{df}"].join("") + unonascii10 = unonascii1 * 10 + unonascii100 = unonascii10 * 10 + unonascii1000 = unonascii100 * 10 +benchmark: + casecmp-1: lstr1.casecmp(ustr1) + casecmp-10: lstr10.casecmp(ustr10) + casecmp-100: lstr100.casecmp(ustr100) + casecmp-1000: lstr1000.casecmp(ustr1000) + casecmp-nonascii1: lnonascii1.casecmp(unonascii1) + casecmp-nonascii10: lnonascii10.casecmp(unonascii10) + casecmp-nonascii100: lnonascii100.casecmp(unonascii100) + casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000) diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml new file mode 100644 index 0000000000..a790ce7d55 --- /dev/null +++ b/benchmark/string_casecmp_p.yml @@ -0,0 +1,26 @@ +prelude: | + lstr1 = [*"a".."z",*"0".."9"].join("") + lstr10 = lstr1 * 10 + lstr100 = lstr10 * 10 + lstr1000 = lstr100 * 10 + lnonascii1 = [*"\u{e0}".."\u{ff}"].join("") + lnonascii10 = lnonascii1 * 10 + lnonascii100 = lnonascii10 * 10 + lnonascii1000 = lnonascii100 * 10 + ustr1 = [*"A".."Z",*"0".."9"].join("") + ustr10 = ustr1 * 10 + ustr100 = ustr10 * 10 + ustr1000 = ustr100 * 10 + unonascii1 = [*"\u{c0}".."\u{df}"].join("") + unonascii10 = unonascii1 * 10 + unonascii100 = unonascii10 * 10 + unonascii1000 = unonascii100 * 10 +benchmark: + casecmp_p-1: lstr1.casecmp?(ustr1) + casecmp_p-10: lstr10.casecmp?(ustr10) + casecmp_p-100: lstr100.casecmp?(ustr100) + casecmp_p-1000: lstr1000.casecmp?(ustr1000) + casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1) + casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10) + casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100) + casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000) diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml new file mode 100644 index 0000000000..1fea6afbec --- /dev/null +++ b/benchmark/string_downcase.yml @@ -0,0 +1,18 @@ +prelude: | + str1 = [*"A".."Z",*"0".."9"].join("") + str10 = str1 * 10 + str100 = str10 * 10 + str1000 = str100 * 10 + nonascii1 = [*"\u{c0}".."\u{df}"].join("") + nonascii10 = nonascii1 * 10 + nonascii100 = nonascii10 * 10 + nonascii1000 = nonascii100 * 10 +benchmark: + downcase-1: str1.upcase + downcase-10: str10.upcase + downcase-100: str100.upcase + downcase-1000: str1000.upcase + downcase-nonascii1: nonascii1.downcase + downcase-nonascii10: nonascii10.downcase + downcase-nonascii100: nonascii100.downcase + downcase-nonascii1000: nonascii1000.downcase diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb new file mode 100644 index 0000000000..7783111082 --- /dev/null +++ b/benchmark/string_index.rb @@ -0,0 +1,3 @@ +str1 = "あ" * 1024 + "い" # not single byte optimizable +str2 = "い" +100_000.times { str1.index(str2) } diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb new file mode 100644 index 0000000000..b0d60201a9 --- /dev/null +++ b/benchmark/string_scan_re.rb @@ -0,0 +1,2 @@ +str = Array.new(1_000, 'abc').join(',') +1_000.times { str.scan(/abc/) } diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb new file mode 100644 index 0000000000..42440bd948 --- /dev/null +++ b/benchmark/string_scan_str.rb @@ -0,0 +1,2 @@ +str = Array.new(1_000, 'abc').join(',') +1_000.times { str.scan('abc') } diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml new file mode 100644 index 0000000000..fc2393c5d1 --- /dev/null +++ b/benchmark/string_slice.yml @@ -0,0 +1,11 @@ +prelude: | + long_string = "x"*1000+"-hår" +benchmark: + regexp-short: | + "x-hår".slice!(/-(.)(.)(.)/, 3) + regexp-long: | + long_string.dup.slice!(/-(.)(.)(.)/, 3) + string-short: | + "x-hår".slice!("r") + string-long: | + long_string.dup.slice!("r") diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml new file mode 100644 index 0000000000..cc2c7d7855 --- /dev/null +++ b/benchmark/string_split.yml @@ -0,0 +1,22 @@ +prelude: | + str1 = [*0..5].join(" ") + " " + str10 = str1 * 10 + str100 = str10 * 10 + str1000 = str100 * 10 +benchmark: + to_chars-1: str1.split('') + to_chars-10: str10.split('') + to_chars-100: str100.split('') + to_chars-1000: str1000.split('') + to_words-1: str1.split(' ') + to_words-10: str10.split(' ') + to_words-100: str100.split(' ') + to_words-1000: str1000.split(' ') + re_chars-1: str1.split(//) + re_chars-10: str10.split(//) + re_chars-100: str100.split(//) + re_chars-1000: str1000.split(//) + re_space-1: str1.split(/ /) + re_space-10: str10.split(/ /) + re_space-100: str100.split(/ /) + re_space-1000: str1000.split(/ /) diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml new file mode 100644 index 0000000000..eeb5928907 --- /dev/null +++ b/benchmark/string_swapcase.yml @@ -0,0 +1,18 @@ +prelude: | + str1 = [*"A".."M",*"n".."z",*"0".."9"].join("") + str10 = str1 * 10 + str100 = str10 * 10 + str1000 = str100 * 10 + nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("") + nonascii10 = nonascii1 * 10 + nonascii100 = nonascii10 * 10 + nonascii1000 = nonascii100 * 10 +benchmark: + swapcase-1: str1.swapcase + swapcase-10: str10.swapcase + swapcase-100: str100.swapcase + swapcase-1000: str1000.swapcase + swapcase-nonascii1: nonascii1.swapcase + swapcase-nonascii10: nonascii10.swapcase + swapcase-nonascii100: nonascii100.swapcase + swapcase-nonascii1000: nonascii1000.swapcase diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml new file mode 100644 index 0000000000..dab84bbde2 --- /dev/null +++ b/benchmark/string_upcase.yml @@ -0,0 +1,18 @@ +prelude: | + str1 = [*"a".."z",*"0".."9"].join("") + str10 = str1 * 10 + str100 = str10 * 10 + str1000 = str100 * 10 + nonascii1 = [*"\u{e0}".."\u{ff}"].join("") + nonascii10 = nonascii1 * 10 + nonascii100 = nonascii10 * 10 + nonascii1000 = nonascii100 * 10 +benchmark: + upcase-1: str1.upcase + upcase-10: str10.upcase + upcase-100: str100.upcase + upcase-1000: str1000.upcase + upcase-nonascii1: nonascii1.upcase + upcase-nonascii10: nonascii10.upcase + upcase-nonascii100: nonascii100.upcase + upcase-nonascii1000: nonascii1000.upcase diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml new file mode 100644 index 0000000000..3247efbe77 --- /dev/null +++ b/benchmark/time_at.yml @@ -0,0 +1,7 @@ +prelude: | + # frozen_string_literal: true +benchmark: + - 'Time.at(0)' + - 'Time.at(0, 500)' + - 'Time.at(0, in: "+09:00")' + - 'Time.at(0, 500, in: "+09:00")' diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml new file mode 100644 index 0000000000..5947dd3a41 --- /dev/null +++ b/benchmark/time_new.yml @@ -0,0 +1,4 @@ +benchmark: + - 'Time.new(2021)' + - 'Time.new(2021, 8, 22)' + - 'Time.new(2021, 8, 22, in: "+09:00")' diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml new file mode 100644 index 0000000000..a6d6948b9c --- /dev/null +++ b/benchmark/time_parse.yml @@ -0,0 +1,8 @@ +prelude: | + require 'time' + inspect = "2021-08-23 09:57:02 +0900" + iso8601 = "2021-08-23T09:57:02+09:00" +benchmark: + - Time.iso8601(iso8601) + - Time.parse(iso8601) + - Time.parse(inspect) diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml new file mode 100644 index 0000000000..8d89ebb7a7 --- /dev/null +++ b/benchmark/time_strptime.yml @@ -0,0 +1,13 @@ +prelude: | + require 'time' +benchmark: + - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z") + - Time.strptime("1", "%s") + - Time.strptime("0 +0100", "%s %z") + - Time.strptime("0 UTC", "%s %z") + - Time.strptime("1.5", "%s.%N") + - Time.strptime("1.000000000001", "%s.%N") + - Time.strptime("20010203 -0200", "%Y%m%d %z") + - Time.strptime("20010203 UTC", "%Y%m%d %z") + - Time.strptime("2018-365", "%Y-%j") + - Time.strptime("2018-091", "%Y-%j") diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb new file mode 100644 index 0000000000..505021c701 --- /dev/null +++ b/benchmark/time_subsec.rb @@ -0,0 +1,2 @@ +t = Time.now +4000000.times { t.subsec } diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml new file mode 100644 index 0000000000..2a177237ef --- /dev/null +++ b/benchmark/vm_array.yml @@ -0,0 +1,4 @@ +benchmark: + vm_array: | + a = [1,2,3,4,5,6,7,8,9,10] +loop_count: 6000000 diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml new file mode 100644 index 0000000000..75b803478e --- /dev/null +++ b/benchmark/vm_attr_ivar.yml @@ -0,0 +1,14 @@ +prelude: | + class C + attr_reader :a, :b + def initialize + @a = nil + @b = nil + end + end + obj = C.new +benchmark: + vm_attr_ivar: | + j = obj.a + k = obj.b +loop_count: 30000000 diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml new file mode 100644 index 0000000000..a0d379b18a --- /dev/null +++ b/benchmark/vm_attr_ivar_set.yml @@ -0,0 +1,14 @@ +prelude: | + class C + attr_accessor :a, :b + def initialize + @a = nil + @b = nil + end + end + obj = C.new +benchmark: + vm_attr_ivar_set: | + obj.a = 1 + obj.b = 2 +loop_count: 30000000 diff --git a/benchmark/vm_backtrace.rb b/benchmark/vm_backtrace.rb new file mode 100644 index 0000000000..0fbf73e1ca --- /dev/null +++ b/benchmark/vm_backtrace.rb @@ -0,0 +1,22 @@ +# get last backtrace + +begin + caller(0, 0) +rescue ArgumentError + alias caller_orig caller + def caller lev, n + caller_orig(lev)[0..n] + end +end + +def rec n + if n < 0 + 100_000.times{ + caller(0, 1) + } + else + rec(n-1) + end +end + +rec 50 diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml new file mode 100644 index 0000000000..8b2d3f3443 --- /dev/null +++ b/benchmark/vm_bigarray.yml @@ -0,0 +1,105 @@ +benchmark: + vm_bigarray: | + a = [ + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + ] +loop_count: 6000000 diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml new file mode 100644 index 0000000000..4dacfde793 --- /dev/null +++ b/benchmark/vm_bighash.yml @@ -0,0 +1,4 @@ +benchmark: + vm_bighash: | + a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,} +loop_count: 60000 diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml new file mode 100644 index 0000000000..68b3e40bf5 --- /dev/null +++ b/benchmark/vm_block.yml @@ -0,0 +1,9 @@ +prelude: | + def m + yield + end +benchmark: + vm_block: | + m{ + } +loop_count: 30000000 diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml new file mode 100644 index 0000000000..461d7953ad --- /dev/null +++ b/benchmark/vm_block_handler.yml @@ -0,0 +1,27 @@ +# :FIXME: is there a way to benchmark block_handler_type_ifunc? + +prelude: | + p = proc{_1} + o = Object.new + def o.each + i = 0 + while i < 3_000_000 do + yield i + i += 1 + end + end + +benchmark: + - name: block_handler_type_iseq + script: | + o.each{_1} + + - name: block_handler_type_symbol + script: | + o.each(&:itself) + + - name: block_handler_type_proc + script: | + o.each(&p) + +loop_count: 1 diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml new file mode 100644 index 0000000000..5e5a0170a2 --- /dev/null +++ b/benchmark/vm_blockparam.yml @@ -0,0 +1,7 @@ +prelude: | + def m &b + end +benchmark: + vm_blockparam: | + m{} +loop_count: 30000000 diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml new file mode 100644 index 0000000000..a7d8d366ea --- /dev/null +++ b/benchmark/vm_blockparam_call.yml @@ -0,0 +1,8 @@ +prelude: | + def m &b + b.call + end +benchmark: + vm_blockparam_call: | + m{} +loop_count: 30000000 diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml new file mode 100644 index 0000000000..841f5e7a63 --- /dev/null +++ b/benchmark/vm_blockparam_pass.yml @@ -0,0 +1,12 @@ +prelude: | + def bp_yield + yield + end + + def bp_pass &b + bp_yield &b + end +benchmark: + vm_blockparam_pass: | + bp_pass{} +loop_count: 30000000 diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml new file mode 100644 index 0000000000..8ea9b46ed2 --- /dev/null +++ b/benchmark/vm_blockparam_yield.yml @@ -0,0 +1,8 @@ +prelude: | + def bp_yield &b + yield + end +benchmark: + vm_blockparam_yield: | + bp_yield{} +loop_count: 30000000 diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml new file mode 100644 index 0000000000..b26a491a15 --- /dev/null +++ b/benchmark/vm_case.yml @@ -0,0 +1,13 @@ +benchmark: + vm_case: | + case :foo + when :bar + raise + when :baz + raise + when :boo + raise + when :foo + # noop + end +loop_count: 6000000 diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml new file mode 100644 index 0000000000..cacc4f0464 --- /dev/null +++ b/benchmark/vm_case_classes.yml @@ -0,0 +1,9 @@ +benchmark: + vm_case_classes: | + case :foo + when Hash + raise + when Array + raise + end +loop_count: 6000000 diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml new file mode 100644 index 0000000000..9f91801544 --- /dev/null +++ b/benchmark/vm_case_lit.yml @@ -0,0 +1,23 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_case_lit: | + i = 0 + @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ] + def foo(i) + @ret[i % @ret.size] + end + + while i<6_000_000 + case foo(i) + when "foo" then :foo + when true then true + when false then false + when :sym then :sym + when 6 then :fix + when nil then nil + when 0.1 then :float + when 0xffffffffffffffff then :big + end + i += 1 + end +loop_count: 1 diff --git a/benchmark/vm_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb new file mode 100644 index 0000000000..9661323cd2 --- /dev/null +++ b/benchmark/vm_clearmethodcache.rb @@ -0,0 +1,8 @@ +i = 0 +while i<200_000 + i += 1 + + Class.new{ + def m; end + } +end diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml new file mode 100644 index 0000000000..6064d4eed0 --- /dev/null +++ b/benchmark/vm_const.yml @@ -0,0 +1,7 @@ +prelude: | + Const = 1 +benchmark: + vm_const: | + j = Const + k = Const +loop_count: 30000000 diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml new file mode 100644 index 0000000000..1d0e161829 --- /dev/null +++ b/benchmark/vm_cvar.yml @@ -0,0 +1,20 @@ +prelude: | + class A + @@foo = 1 + + def self.foo + @@foo + end + + ("A".."Z").each do |module_name| + eval <<-EOM + module #{module_name} + end + + include #{module_name} + EOM + end + end +benchmark: + vm_cvar: A.foo +loop_count: 600000 diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml new file mode 100644 index 0000000000..347e0cfd33 --- /dev/null +++ b/benchmark/vm_defined_method.yml @@ -0,0 +1,8 @@ +prelude: | + class Object + define_method(:m){} + end +benchmark: + vm_defined_method: | + m; m; m; m; m; m; m; m; +loop_count: 6000000 diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml new file mode 100644 index 0000000000..30c7a3193c --- /dev/null +++ b/benchmark/vm_dstr.yml @@ -0,0 +1,6 @@ +prelude: | + x = y = 'z' +benchmark: + vm_dstr: | + str = "foo#{x}bar#{y}baz" +loop_count: 6000000 diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb new file mode 100644 index 0000000000..1d3aa3b97b --- /dev/null +++ b/benchmark/vm_dstr_ary.rb @@ -0,0 +1,6 @@ +i = 0 +x = y = [] +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb new file mode 100644 index 0000000000..631ca54755 --- /dev/null +++ b/benchmark/vm_dstr_bool.rb @@ -0,0 +1,7 @@ +i = 0 +x = true +y = false +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb new file mode 100644 index 0000000000..becf0861c7 --- /dev/null +++ b/benchmark/vm_dstr_class_module.rb @@ -0,0 +1,10 @@ +i = 0 +class A; end unless defined?(A) +module B; end unless defined?(B) +x = A +y = B +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end + diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb new file mode 100644 index 0000000000..caaa395192 --- /dev/null +++ b/benchmark/vm_dstr_digit.rb @@ -0,0 +1,7 @@ +i = 0 +x = 0 +y = 9 +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb new file mode 100644 index 0000000000..ed380d7595 --- /dev/null +++ b/benchmark/vm_dstr_int.rb @@ -0,0 +1,5 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{i}bar#{i}baz" +end diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb new file mode 100644 index 0000000000..ec4f5d6c67 --- /dev/null +++ b/benchmark/vm_dstr_nil.rb @@ -0,0 +1,6 @@ +i = 0 +x = y = nil +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb new file mode 100644 index 0000000000..fb78637ead --- /dev/null +++ b/benchmark/vm_dstr_obj.rb @@ -0,0 +1,6 @@ +i = 0 +x = y = Object.new +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb new file mode 100644 index 0000000000..99ff7b98fb --- /dev/null +++ b/benchmark/vm_dstr_obj_def.rb @@ -0,0 +1,8 @@ +i = 0 +o = Object.new +def o.to_s; -""; end +x = y = o +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb new file mode 100644 index 0000000000..45fc107892 --- /dev/null +++ b/benchmark/vm_dstr_str.rb @@ -0,0 +1,6 @@ +i = 0 +x = y = "" +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb new file mode 100644 index 0000000000..484b8f8150 --- /dev/null +++ b/benchmark/vm_dstr_sym.rb @@ -0,0 +1,6 @@ +i = 0 +x = y = :z +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml new file mode 100644 index 0000000000..4ea62f30de --- /dev/null +++ b/benchmark/vm_ensure.yml @@ -0,0 +1,14 @@ +# Not utilizing loop_count since using it for this is too unstable for now +benchmark: + vm_ensure: | + i = 0 + while i<30_000_000 + i += 1 + begin + begin + ensure + end + ensure + end + end +loop_count: 1 diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml new file mode 100644 index 0000000000..7ba1a8d1de --- /dev/null +++ b/benchmark/vm_eval.yml @@ -0,0 +1,4 @@ +benchmark: + vm_eval: | + eval("1") +loop_count: 6000000 diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml new file mode 100644 index 0000000000..b5a54e1ddf --- /dev/null +++ b/benchmark/vm_fiber_allocate.yml @@ -0,0 +1,8 @@ +prelude: | + # Disable GC to see raw throughput: + GC.disable +benchmark: + vm_fiber_allocate: | + fiber = Fiber.new{Fiber.yield} + fiber.resume +loop_count: 100000 diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml new file mode 100644 index 0000000000..b83d3152d4 --- /dev/null +++ b/benchmark/vm_fiber_count.yml @@ -0,0 +1,10 @@ +# On Linux, you will need to increase the maximum number of memory maps: +# sudo sysctl -w vm.max_map_count=200000 +prelude: | + fibers = [] +benchmark: + vm_fiber_count: | + fiber = Fiber.new{Fiber.yield} + fibers << fiber + fiber.resume +loop_count: 100000 diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml new file mode 100644 index 0000000000..4ca41085b1 --- /dev/null +++ b/benchmark/vm_fiber_reuse.yml @@ -0,0 +1,14 @@ +prelude: | + GC.disable + fibers = [] +benchmark: + vm_fiber_reuse: | + 1024.times do + fiber = Fiber.new{Fiber.yield} + fibers << fiber + fiber.resume + end + + fibers.clear + GC.start +loop_count: 200 diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml new file mode 100644 index 0000000000..892622f121 --- /dev/null +++ b/benchmark/vm_fiber_reuse_gc.yml @@ -0,0 +1,12 @@ +# https://bugs.ruby-lang.org/issues/16009 +prelude: | + fibers = [] +benchmark: + vm_fiber_reuse_gc: | + 2000.times do + fiber = Fiber.new{Fiber.yield} + fibers << fiber + fiber.resume + end + fibers.clear +loop_count: 100 diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml new file mode 100644 index 0000000000..3de36b66eb --- /dev/null +++ b/benchmark/vm_fiber_switch.yml @@ -0,0 +1,9 @@ +prelude: | + # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke + fib = Fiber.new do + loop { Fiber.yield } + end +benchmark: + vm_fiber_switch: | + fib.resume +loop_count: 20000000 diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml new file mode 100644 index 0000000000..92f5fd52ab --- /dev/null +++ b/benchmark/vm_float_simple.yml @@ -0,0 +1,8 @@ +prelude: | + f = 0.0 +benchmark: + vm_float_simple: | + f += 0.1; f -= 0.1 + f += 0.1; f -= 0.1 + f += 0.1; f -= 0.1 +loop_count: 30000000 diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml new file mode 100644 index 0000000000..facc9aa043 --- /dev/null +++ b/benchmark/vm_freezestring.yml @@ -0,0 +1,10 @@ +prelude: | + class String + def freeze + -self + end + end +benchmark: + vm_freezestring: | + "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze +loop_count: 6000000 diff --git a/benchmark/vm_gc.rb b/benchmark/vm_gc.rb new file mode 100644 index 0000000000..e668026915 --- /dev/null +++ b/benchmark/vm_gc.rb @@ -0,0 +1,6 @@ +5000.times do + 100.times do + {"xxxx"=>"yyyy"} + end + GC.start +end diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/vm_gc_old_full.rb new file mode 100644 index 0000000000..cfdfc8c5a5 --- /dev/null +++ b/benchmark/vm_gc_old_full.rb @@ -0,0 +1,4 @@ +old_object = Array.new(1_000_000){''} +100.times do + GC.start +end diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb new file mode 100644 index 0000000000..ad22feb655 --- /dev/null +++ b/benchmark/vm_gc_old_immediate.rb @@ -0,0 +1,4 @@ +old_object = Array.new(1_000_000){''} +30_000.times do + GC.start(full_mark: false, immediate_sweep: true) +end diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb new file mode 100644 index 0000000000..b74d44baf1 --- /dev/null +++ b/benchmark/vm_gc_old_lazy.rb @@ -0,0 +1,4 @@ +old_object = Array.new(1_000_000){''} +30_000.times do + GC.start(full_mark: false, immediate_sweep: false) +end diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml new file mode 100644 index 0000000000..29c803fee3 --- /dev/null +++ b/benchmark/vm_gc_short_lived.yml @@ -0,0 +1,9 @@ +benchmark: + vm_gc_short_lived: | + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' +loop_count: 30000000 diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml new file mode 100644 index 0000000000..4b6c3ed7b9 --- /dev/null +++ b/benchmark/vm_gc_short_with_complex_long.yml @@ -0,0 +1,25 @@ +prelude: | + def nested_hash h, n + if n == 0 + '' + else + 10.times{ + h[Object.new] = nested_hash(h, n-1) + } + end + end + + long_lived = Hash.new + nested_hash long_lived, 6 + + GC.start + GC.start +benchmark: + vm_gc_short_with_complex_long: | + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' +loop_count: 30000000 diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml new file mode 100644 index 0000000000..03ba0f95a9 --- /dev/null +++ b/benchmark/vm_gc_short_with_long.yml @@ -0,0 +1,13 @@ +prelude: | + long_lived = Array.new(1_000_000){|i| "#{i}"} + GC.start + GC.start +benchmark: + vm_gc_short_with_long: | + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' +loop_count: 30000000 diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml new file mode 100644 index 0000000000..129b8bf4ed --- /dev/null +++ b/benchmark/vm_gc_short_with_symbol.yml @@ -0,0 +1,13 @@ +prelude: | + 50_000.times{|i| sym = "sym#{i}".to_sym} + GC.start + GC.start +benchmark: + vm_gc_short_with_symbol: | + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' +loop_count: 30000000 diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml new file mode 100644 index 0000000000..e3293e72d0 --- /dev/null +++ b/benchmark/vm_gc_wb_ary.yml @@ -0,0 +1,12 @@ +prelude: | + short_lived_ary = [] + + if RUBY_VERSION >= "2.2.0" + GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) + end + + short_lived = '' +benchmark: + vm_gc_wb_ary: | + short_lived_ary[0] = short_lived # write barrier +loop_count: 30000000 diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml new file mode 100644 index 0000000000..003995945b --- /dev/null +++ b/benchmark/vm_gc_wb_ary_promoted.yml @@ -0,0 +1,15 @@ +prelude: | + long_lived = [] + + if RUBY_VERSION > "2.2.0" + 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) } + elsif + GC.start + end + + short_lived = '' + +benchmark: + vm_gc_wb_ary_promoted: | + long_lived[0] = short_lived # write barrier +loop_count: 30000000 diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml new file mode 100644 index 0000000000..a2a2ce2d18 --- /dev/null +++ b/benchmark/vm_gc_wb_obj.yml @@ -0,0 +1,15 @@ +prelude: | + class C + attr_accessor :foo + end + short_lived_obj = C.new + + if RUBY_VERSION >= "2.2.0" + GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) + end + + short_lived = '' +benchmark: + vm_gc_wb_obj: | + short_lived_obj.foo = short_lived # write barrier +loop_count: 30000000 diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml new file mode 100644 index 0000000000..00a454ba72 --- /dev/null +++ b/benchmark/vm_gc_wb_obj_promoted.yml @@ -0,0 +1,17 @@ +prelude: | + class C + attr_accessor :foo + end + long_lived = C.new + + if RUBY_VERSION >= "2.2.0" + 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) } + elsif + GC.start + end + + short_lived = '' +benchmark: + vm_gc_wb_obj_promoted: | + long_lived.foo = short_lived # write barrier +loop_count: 30000000 diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml new file mode 100644 index 0000000000..21bb7db247 --- /dev/null +++ b/benchmark/vm_iclass_super.yml @@ -0,0 +1,20 @@ +prelude: | + class C + def m + 1 + end + + ("A".."M").each do |module_name| + eval <<-EOM + module #{module_name} + def m; super; end + end + prepend #{module_name} + EOM + end + end + + obj = C.new +benchmark: + vm_iclass_super: obj.m +loop_count: 6000000 diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml new file mode 100644 index 0000000000..119531d5ef --- /dev/null +++ b/benchmark/vm_ivar.yml @@ -0,0 +1,6 @@ +prelude: "@a = 1\n" +benchmark: + vm_ivar: | + j = @a + k = @a +loop_count: 30000000 diff --git a/benchmark/vm_ivar_init.yml b/benchmark/vm_ivar_init.yml new file mode 100644 index 0000000000..c6f1633907 --- /dev/null +++ b/benchmark/vm_ivar_init.yml @@ -0,0 +1,14 @@ +prelude: | + class C + def initialize + @a = nil + @b = nil + @c = nil + @d = nil + @e = nil + end + end +benchmark: + vm_ivar_init: | + C.new +loop_count: 30000000 diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml new file mode 100644 index 0000000000..172e28b2fd --- /dev/null +++ b/benchmark/vm_ivar_of_class.yml @@ -0,0 +1,12 @@ +prelude: | + class C + @a = 1 + def self.a + _a = @a; _a = @a; _a = @a; _a = @a; _a = @a; + _a = @a; _a = @a; _a = @a; _a = @a; _a = @a; + end + end +benchmark: + vm_ivar_of_class: | + a = C.a +loop_count: 30000000 diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml new file mode 100644 index 0000000000..2ea5199423 --- /dev/null +++ b/benchmark/vm_ivar_of_class_set.yml @@ -0,0 +1,11 @@ +prelude: | + class C + @a = 1 + def self.a o + @a = o; @a = o; @a = o; @a = o; @a = o; @a = o; + end + end +benchmark: + vm_ivar_of_class_set: | + a = C.a(nil) +loop_count: 30000000 diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml new file mode 100644 index 0000000000..8bbb60043b --- /dev/null +++ b/benchmark/vm_ivar_set.yml @@ -0,0 +1,5 @@ +benchmark: + vm_ivar_set: | + @a = 1 + @b = 2 +loop_count: 30000000 diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml new file mode 100644 index 0000000000..2653d36ded --- /dev/null +++ b/benchmark/vm_ivar_set_subclass.yml @@ -0,0 +1,17 @@ +prelude: | + class A + def initialize + @a = nil + @b = nil + @c = nil + @d = nil + @e = nil + end + end + class B < A; end + class C < A; end +benchmark: + vm_ivar_init_subclass: | + B.new + C.new +loop_count: 3000000 diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml new file mode 100644 index 0000000000..5fd94e7d86 --- /dev/null +++ b/benchmark/vm_length.yml @@ -0,0 +1,8 @@ +prelude: | + a = 'abc' + b = [1, 2, 3] +benchmark: + vm_length: | + a.length + b.length +loop_count: 30000000 diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml new file mode 100644 index 0000000000..70a9b1c0ca --- /dev/null +++ b/benchmark/vm_lvar_init.yml @@ -0,0 +1,21 @@ +# while loop cost is not removed because `i` is used in the script +benchmark: + vm_lvar_init: | + def m v + unless v + # unreachable code + v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 = + v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 = + v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 = + v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 = + v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1 + end + end + + i = 0 + + while i<30_000_000 + i += 1 + m i + end +loop_count: 1 diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml new file mode 100644 index 0000000000..f29f763d81 --- /dev/null +++ b/benchmark/vm_lvar_set.yml @@ -0,0 +1,4 @@ +benchmark: + vm_lvar_set: | + a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1 +loop_count: 30000000 diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml new file mode 100644 index 0000000000..d45e4ec572 --- /dev/null +++ b/benchmark/vm_method.yml @@ -0,0 +1,8 @@ +prelude: | + def m + nil + end +benchmark: + vm_method: | + m; m; m; m; m; m; m; m; +loop_count: 6000000 diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml new file mode 100644 index 0000000000..3da456c0bb --- /dev/null +++ b/benchmark/vm_method_missing.yml @@ -0,0 +1,11 @@ +prelude: | + class C + def method_missing mid + end + end + + obj = C.new +benchmark: + vm_method_missing: | + obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; +loop_count: 6000000 diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml new file mode 100644 index 0000000000..281a481394 --- /dev/null +++ b/benchmark/vm_method_with_block.yml @@ -0,0 +1,8 @@ +prelude: | + def m + nil + end +benchmark: + vm_method_with_block: | + m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{}; +loop_count: 6000000 diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml new file mode 100644 index 0000000000..243229ba4a --- /dev/null +++ b/benchmark/vm_module_ann_const_set.yml @@ -0,0 +1,4 @@ +benchmark: + vm_module_ann_const_set: | + Module.new.const_set(:X, Module.new) +loop_count: 6000000 diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml new file mode 100644 index 0000000000..e5a24181a9 --- /dev/null +++ b/benchmark/vm_module_const_set.yml @@ -0,0 +1,8 @@ +prelude: | + module M + end + $VERBOSE = nil +benchmark: + vm_module_const_set: | + M.const_set(:X, Module.new) +loop_count: 6000000 diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml new file mode 100644 index 0000000000..abcf1e28ce --- /dev/null +++ b/benchmark/vm_mutex.yml @@ -0,0 +1,8 @@ +prelude: | + require 'thread' + + m = Thread::Mutex.new +benchmark: + vm_mutex: | + m.synchronize{} +loop_count: 6000000 diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml new file mode 100644 index 0000000000..fb04d15ae8 --- /dev/null +++ b/benchmark/vm_neq.yml @@ -0,0 +1,7 @@ +prelude: | + obj1 = Object.new + obj2 = Object.new +benchmark: + vm_neq: | + obj1 != obj2 +loop_count: 30000000 diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml new file mode 100644 index 0000000000..0b9787d91a --- /dev/null +++ b/benchmark/vm_newlambda.yml @@ -0,0 +1,4 @@ +benchmark: + vm_newlambda: | + lambda {} +loop_count: 6000000 diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml new file mode 100644 index 0000000000..c68dde3c50 --- /dev/null +++ b/benchmark/vm_not.yml @@ -0,0 +1,6 @@ +prelude: | + obj = Object.new +benchmark: + vm_not: | + !obj +loop_count: 30000000 diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml new file mode 100644 index 0000000000..dd2f4e71de --- /dev/null +++ b/benchmark/vm_poly_method.yml @@ -0,0 +1,24 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_poly_method: | + class C1 + def m + 1 + end + end + class C2 + def m + 2 + end + end + + o1 = C1.new + o2 = C2.new + + i = 0 + while i<6_000_000 + o = (i % 2 == 0) ? o1 : o2 + o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i += 1 + end +loop_count: 1 diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml new file mode 100644 index 0000000000..bca1b62729 --- /dev/null +++ b/benchmark/vm_poly_method_ov.yml @@ -0,0 +1,24 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_poly_method_ov: | + class C1 + def m + 1 + end + end + class C2 + def m + 2 + end + end + + o1 = C1.new + o2 = C2.new + + i = 0 + while i<6_000_000 + o = (i % 2 == 0) ? o1 : o2 + # o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i += 1 + end +loop_count: 1 diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml new file mode 100644 index 0000000000..6c5404ac84 --- /dev/null +++ b/benchmark/vm_poly_same_method.yml @@ -0,0 +1,25 @@ +prelude: | + module AR; end + class AR::Base + def create_or_update + nil + end + def save + create_or_update + end + end + class Foo < AR::Base; end + class Bar < AR::Base; end + o1 = Foo.new + o2 = Bar.new +benchmark: + vm_poly_same_method: | + o1.save; o2.save; + o1.save; o2.save; + o1.save; o2.save; + o1.save; o2.save; + o1.save; o2.save; + o1.save; o2.save; + o1.save; o2.save; + o1.save; o2.save; +loop_count: 6000000 diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml new file mode 100644 index 0000000000..c7923160fb --- /dev/null +++ b/benchmark/vm_poly_singleton.yml @@ -0,0 +1,18 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_poly_singleton: | + class C1 + def m; 1; end + end + + o1 = C1.new + o2 = C1.new + o2.singleton_class + + i = 0 + while i<6_000_000 # benchmark loop 2 + o = (i % 2 == 0) ? o1 : o2 + o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i += 1 + end +loop_count: 1 diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml new file mode 100644 index 0000000000..2f8de6c272 --- /dev/null +++ b/benchmark/vm_proc.yml @@ -0,0 +1,12 @@ +prelude: | + def m &b + b + end + + pr = m{ + a = 1 + } +benchmark: + vm_proc: | + pr.call +loop_count: 6000000 diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml new file mode 100644 index 0000000000..247d9f70ee --- /dev/null +++ b/benchmark/vm_raise1.yml @@ -0,0 +1,16 @@ +prelude: | + def rec n + if n > 0 + rec n-1 + else + raise + end + end +benchmark: + vm_raise1: | + begin + rec 1 + rescue + # ignore + end +loop_count: 6000000 diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml new file mode 100644 index 0000000000..f0fa047b3c --- /dev/null +++ b/benchmark/vm_raise2.yml @@ -0,0 +1,16 @@ +prelude: | + def rec n + if n > 0 + rec n-1 + else + raise + end + end +benchmark: + vm_raise2: | + begin + rec 10 + rescue + # ignore + end +loop_count: 6000000 diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml new file mode 100644 index 0000000000..2aa3d94dbd --- /dev/null +++ b/benchmark/vm_regexp.yml @@ -0,0 +1,8 @@ +prelude: | + str = 'xxxhogexxx' +benchmark: + vm_regexp: | + /hoge/ =~ str + vm_regexp_invert: | + str =~ /hoge/ +loop_count: 6000000 diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml new file mode 100644 index 0000000000..b4a0af521f --- /dev/null +++ b/benchmark/vm_rescue.yml @@ -0,0 +1,6 @@ +benchmark: + vm_rescue: | + begin + rescue + end +loop_count: 30000000 diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml new file mode 100644 index 0000000000..f31bc7ac89 --- /dev/null +++ b/benchmark/vm_send.yml @@ -0,0 +1,14 @@ +prelude: | + class C + def m + end + end + + o = C.new + m = :m +benchmark: + vm_send: | + o.__send__ :m + vm_send_var: | + o.__send__ m +loop_count: 6000000 diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml new file mode 100644 index 0000000000..b114ac317d --- /dev/null +++ b/benchmark/vm_send_cfunc.yml @@ -0,0 +1,3 @@ +benchmark: + vm_send_cfunc: self.class +loop_count: 100000000 diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml new file mode 100644 index 0000000000..c9829cff0b --- /dev/null +++ b/benchmark/vm_simplereturn.yml @@ -0,0 +1,7 @@ +prelude: | + def m + return 1 + end +benchmark: + vm_simplereturn: m +loop_count: 30000000 diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml new file mode 100644 index 0000000000..64439c7980 --- /dev/null +++ b/benchmark/vm_string_literal.yml @@ -0,0 +1,4 @@ +benchmark: + vm_string_literal: | + x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx" +loop_count: 6000000 diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml new file mode 100644 index 0000000000..4cf78970cb --- /dev/null +++ b/benchmark/vm_struct_big_aref_hi.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(*('a'..'z').map { |x| x.to_sym }) + x = s.new +benchmark: + vm_struct_big_aref_hi: | + x.z # x[25] +loop_count: 6000000 diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml new file mode 100644 index 0000000000..c91af27fa5 --- /dev/null +++ b/benchmark/vm_struct_big_aref_lo.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(*('a'..'z').map { |x| x.to_sym }) + x = s.new +benchmark: + vm_struct_big_aref_lo: | + x.k # x[10] +loop_count: 6000000 diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml new file mode 100644 index 0000000000..69550d14ea --- /dev/null +++ b/benchmark/vm_struct_big_aset.yml @@ -0,0 +1,11 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_struct_big_aset: | + s = Struct.new(*('a'..'z').map { |x| x.to_sym }) + x = s.new + i = 0 + while i<6_000_000 + i += 1 + x.k = i # x[10] = i + end +loop_count: 1 diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml new file mode 100644 index 0000000000..09b764dd13 --- /dev/null +++ b/benchmark/vm_struct_big_href_hi.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(*('a'..'z').map { |x| x.to_sym }) + x = s.new +benchmark: + vm_struct_big_href_hi: | + x[:z] +loop_count: 6000000 diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml new file mode 100644 index 0000000000..d2f00b220f --- /dev/null +++ b/benchmark/vm_struct_big_href_lo.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(*('a'..'z').map { |x| x.to_sym }) + x = s.new +benchmark: + vm_struct_big_href_lo: | + x[:k] +loop_count: 6000000 diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml new file mode 100644 index 0000000000..fc45cbee9c --- /dev/null +++ b/benchmark/vm_struct_big_hset.yml @@ -0,0 +1,11 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_struct_big_hset: | + s = Struct.new(*('a'..'z').map { |x| x.to_sym }) + x = s.new + i = 0 + while i<6_000_000 + i += 1 + x[:k] = i + end +loop_count: 1 diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml new file mode 100644 index 0000000000..5a83251d1e --- /dev/null +++ b/benchmark/vm_struct_small_aref.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(:a, :b, :c) + x = s.new +benchmark: + vm_struct_small_aref: | + x.a +loop_count: 6000000 diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml new file mode 100644 index 0000000000..74f435f126 --- /dev/null +++ b/benchmark/vm_struct_small_aset.yml @@ -0,0 +1,11 @@ +# loop_count is not utilized since `i` is involved in the script +benchmark: + vm_struct_small_aset: | + s = Struct.new(:a, :b, :c) + x = s.new + i = 0 + while i<6_000_000 + i += 1 + x.a = i + end +loop_count: 1 diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml new file mode 100644 index 0000000000..6b7d7f39e7 --- /dev/null +++ b/benchmark/vm_struct_small_href.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(:a, :b, :c) + x = s.new +benchmark: + vm_struct_small_href: | + x[:a] +loop_count: 6000000 diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml new file mode 100644 index 0000000000..5d43b150de --- /dev/null +++ b/benchmark/vm_struct_small_hset.yml @@ -0,0 +1,7 @@ +prelude: | + s = Struct.new(:a, :b, :c) + x = s.new +benchmark: + vm_struct_small_hset: | + x[:a] = 1 +loop_count: 6000000 diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml new file mode 100644 index 0000000000..0d1e965c6e --- /dev/null +++ b/benchmark/vm_super.yml @@ -0,0 +1,17 @@ +prelude: | + class C + def m + 1 + end + end + + class CC < C + def m + super() + end + end + + obj = CC.new +benchmark: + vm_super: obj.m +loop_count: 6000000 diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml new file mode 100644 index 0000000000..e824a65e0a --- /dev/null +++ b/benchmark/vm_swap.yml @@ -0,0 +1,7 @@ +prelude: | + a = 1 + b = 2 +benchmark: + vm_swap: | + a, b = b, a +loop_count: 30000000 diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb new file mode 100644 index 0000000000..1d433353e1 --- /dev/null +++ b/benchmark/vm_symbol_block_pass.rb @@ -0,0 +1,13 @@ +class C + 1000.times {|i| + eval("def i#{i};end") + } +end + +c = C.new +m = C.instance_methods(false) +5_000.times do + m.each do |n| + c.tap(&n) + end +end diff --git a/benchmark/vm_thread_alive_check.yml b/benchmark/vm_thread_alive_check.yml new file mode 100644 index 0000000000..d21737d3e8 --- /dev/null +++ b/benchmark/vm_thread_alive_check.yml @@ -0,0 +1,8 @@ +benchmark: + vm_thread_alive_check: | + t = Thread.new{} + while t.alive? + Thread.pass + end +loop_count: 50_000 + diff --git a/benchmark/vm_thread_close.rb b/benchmark/vm_thread_close.rb new file mode 100644 index 0000000000..3e9a265ce8 --- /dev/null +++ b/benchmark/vm_thread_close.rb @@ -0,0 +1,6 @@ +1000.times { Thread.new { sleep } } +i = 0 +while i<100_000 # benchmark loop 3 + i += 1 + IO.pipe.each(&:close) +end diff --git a/benchmark/vm_thread_condvar1.rb b/benchmark/vm_thread_condvar1.rb new file mode 100644 index 0000000000..feed27c3ad --- /dev/null +++ b/benchmark/vm_thread_condvar1.rb @@ -0,0 +1,28 @@ +# two threads, two mutex, two condvar ping-pong +require 'thread' +m1 = Thread::Mutex.new +m2 = Thread::Mutex.new +cv1 = Thread::ConditionVariable.new +cv2 = Thread::ConditionVariable.new +max = 100000 +i = 0 +wait = nil +m2.synchronize do + wait = Thread.new do + m1.synchronize do + m2.synchronize { cv2.signal } + while (i += 1) < max + cv1.wait(m1) + cv2.signal + end + end + end + cv2.wait(m2) +end +m1.synchronize do + while i < max + cv1.signal + cv2.wait(m1) + end +end +wait.join diff --git a/benchmark/vm_thread_condvar2.rb b/benchmark/vm_thread_condvar2.rb new file mode 100644 index 0000000000..6590c4134b --- /dev/null +++ b/benchmark/vm_thread_condvar2.rb @@ -0,0 +1,35 @@ +# many threads, one mutex, many condvars +require 'thread' +m = Thread::Mutex.new +cv1 = Thread::ConditionVariable.new +cv2 = Thread::ConditionVariable.new +max = 1000 +n = 100 +waiting = 0 +scvs = [] +waiters = n.times.map do |i| + start_cv = Thread::ConditionVariable.new + scvs << start_cv + start_mtx = Thread::Mutex.new + start_mtx.synchronize do + th = Thread.new(start_mtx, start_cv) do |sm, scv| + m.synchronize do + sm.synchronize { scv.signal } + max.times do + cv2.signal if (waiting += 1) == n + cv1.wait(m) + end + end + end + start_cv.wait(start_mtx) + th + end +end +m.synchronize do + max.times do + cv2.wait(m) until waiting == n + waiting = 0 + cv1.broadcast + end +end +waiters.each(&:join) diff --git a/benchmark/vm_thread_create_join.rb b/benchmark/vm_thread_create_join.rb new file mode 100644 index 0000000000..393cd45df9 --- /dev/null +++ b/benchmark/vm_thread_create_join.rb @@ -0,0 +1,6 @@ +i = 0 +while i<100_000 # benchmark loop 3 + i += 1 + Thread.new{ + }.join +end diff --git a/benchmark/vm_thread_mutex1.rb b/benchmark/vm_thread_mutex1.rb new file mode 100644 index 0000000000..66e42c85e1 --- /dev/null +++ b/benchmark/vm_thread_mutex1.rb @@ -0,0 +1,21 @@ +# one thread, one mutex (no contention) + +require 'thread' +m = Thread::Mutex.new +r = 0 +max = 2000 +lmax = max * max +(1..1).map{ + Thread.new{ + i = 0 + while i<lmax + i += 1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/benchmark/vm_thread_mutex2.rb b/benchmark/vm_thread_mutex2.rb new file mode 100644 index 0000000000..6e6c804c31 --- /dev/null +++ b/benchmark/vm_thread_mutex2.rb @@ -0,0 +1,21 @@ +# two threads, one mutex + +require 'thread' +m = Thread::Mutex.new +r = 0 +max = 2000 +lmax = (max * max)/2 +(1..2).map{ + Thread.new{ + i = 0 + while i<lmax + i += 1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/benchmark/vm_thread_mutex3.rb b/benchmark/vm_thread_mutex3.rb new file mode 100644 index 0000000000..c750dc542a --- /dev/null +++ b/benchmark/vm_thread_mutex3.rb @@ -0,0 +1,20 @@ +# 1000 threads, one mutex + +require 'thread' +m = Thread::Mutex.new +r = 0 +max = 2000 +(1..max).map{ + Thread.new{ + i = 0 + while i<max + i += 1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/benchmark/vm_thread_pass.rb b/benchmark/vm_thread_pass.rb new file mode 100644 index 0000000000..438bd08d45 --- /dev/null +++ b/benchmark/vm_thread_pass.rb @@ -0,0 +1,15 @@ +# Plenty Thread.pass +# A performance may depend on GVL implementation. + +tmax = (ARGV.shift || 8).to_i +lmax = 400_000 / tmax + +(1..tmax).map{ + Thread.new{ + lmax.times{ + Thread.pass + } + } +}.each{|t| t.join} + + diff --git a/benchmark/vm_thread_pass_flood.rb b/benchmark/vm_thread_pass_flood.rb new file mode 100644 index 0000000000..65df8e6154 --- /dev/null +++ b/benchmark/vm_thread_pass_flood.rb @@ -0,0 +1,10 @@ +# n.b. this is a good test for GVL when pinned to a single CPU + +5_000.times{ + Thread.new{loop{Thread.pass}} +} + +i = 0 +while i<10_000 + i += 1 +end diff --git a/benchmark/vm_thread_pipe.rb b/benchmark/vm_thread_pipe.rb new file mode 100644 index 0000000000..112a621905 --- /dev/null +++ b/benchmark/vm_thread_pipe.rb @@ -0,0 +1,17 @@ +# Measure small and plenty pipe read/write. +# A performance may depend on GVL implementation. + +lmax = 100_000 +r, w = IO.pipe +[Thread.new{ + lmax.times{ + w.write('a') + } + p "w:exit" +}, Thread.new{ + lmax.times{ + r.read(1) + } + p "r:exit" +}].each{|t| t.join} + diff --git a/benchmark/vm_thread_queue.rb b/benchmark/vm_thread_queue.rb new file mode 100644 index 0000000000..1dd3696a3c --- /dev/null +++ b/benchmark/vm_thread_queue.rb @@ -0,0 +1,18 @@ +require 'thread' + +n = 10_000_000 +q = Thread::Queue.new +consumer = Thread.new{ + while q.pop + # consuming + end +} + +producer = Thread.new{ + n.times{ + q.push true + } + q.push nil +} + +consumer.join diff --git a/benchmark/vm_thread_sized_queue.rb b/benchmark/vm_thread_sized_queue.rb new file mode 100644 index 0000000000..7b9af5482b --- /dev/null +++ b/benchmark/vm_thread_sized_queue.rb @@ -0,0 +1,20 @@ +require 'thread' +# on producer, one consumer + +n = 1_000_000 +q = Thread::SizedQueue.new(100) +consumer = Thread.new{ + while q.pop + # consuming + end +} + +producer = Thread.new{ + while n > 0 + q.push true + n -= 1 + end + q.push nil +} + +consumer.join diff --git a/benchmark/vm_thread_sized_queue2.rb b/benchmark/vm_thread_sized_queue2.rb new file mode 100644 index 0000000000..de9f55e978 --- /dev/null +++ b/benchmark/vm_thread_sized_queue2.rb @@ -0,0 +1,23 @@ +require 'thread' +# one producer, many consumers +n = 1_000_000 +m = 10 +q = Thread::SizedQueue.new(100) +consumers = m.times.map do + Thread.new do + while q.pop + # consuming + end + end +end + +producer = Thread.new do + while n > 0 + q.push true + n -= 1 + end + m.times { q.push nil } +end + +producer.join +consumers.each(&:join) diff --git a/benchmark/vm_thread_sized_queue3.rb b/benchmark/vm_thread_sized_queue3.rb new file mode 100644 index 0000000000..ce5f1796d8 --- /dev/null +++ b/benchmark/vm_thread_sized_queue3.rb @@ -0,0 +1,22 @@ +require 'thread' +# many producers, one consumer +n = 1_000_000 +m = 10 +q = Thread::SizedQueue.new(100) +consumer = Thread.new do + while q.pop + # consuming + end +end + +producers = m.times.map do + Thread.new do + while n > 0 + q.push true + n -= 1 + end + end +end +producers.each(&:join) +q.push nil +consumer.join diff --git a/benchmark/vm_thread_sized_queue4.rb b/benchmark/vm_thread_sized_queue4.rb new file mode 100644 index 0000000000..a9b7d80ec0 --- /dev/null +++ b/benchmark/vm_thread_sized_queue4.rb @@ -0,0 +1,26 @@ +require 'thread' +# many producers, many consumers +nr = 1_000_000 +n = 10 +m = 10 +q = Thread::SizedQueue.new(100) +consumers = n.times.map do + Thread.new do + while q.pop + # consuming + end + end +end + +producers = m.times.map do + Thread.new do + while nr > 0 + q.push true + nr -= 1 + end + end +end + +producers.each(&:join) +n.times { q.push nil } +consumers.each(&:join) diff --git a/benchmark/vm_thread_sleep.yml b/benchmark/vm_thread_sleep.yml new file mode 100644 index 0000000000..96901d8466 --- /dev/null +++ b/benchmark/vm_thread_sleep.yml @@ -0,0 +1,4 @@ +benchmark: + vm_thread_sleep: | + Thread.new { sleep } +loop_count: 10_000 diff --git a/benchmark/vm_unif1.yml b/benchmark/vm_unif1.yml new file mode 100644 index 0000000000..04187bb0e2 --- /dev/null +++ b/benchmark/vm_unif1.yml @@ -0,0 +1,7 @@ +prelude: | + def m a, b + end +benchmark: + vm_unif1: | + m 100, 200 +loop_count: 6000000 diff --git a/benchmark/vm_yield.yml b/benchmark/vm_yield.yml new file mode 100644 index 0000000000..230be3d84f --- /dev/null +++ b/benchmark/vm_yield.yml @@ -0,0 +1,13 @@ +# while loop cost is not removed due to benchmark_driver.gem's limitation +benchmark: + vm_yield: | + def m + i = 0 + while i<30_000_000 + i += 1 + yield + end + end + + m{} +loop_count: 1 diff --git a/benchmark/vm_zsuper.yml b/benchmark/vm_zsuper.yml new file mode 100644 index 0000000000..bfb5837578 --- /dev/null +++ b/benchmark/vm_zsuper.yml @@ -0,0 +1,18 @@ +prelude: | + class C + def m a + 1 + end + end + + class CC < C + def m a + super + end + end + + obj = CC.new +benchmark: + vm_zsuper: | + obj.m 10 +loop_count: 6000000 |