summaryrefslogtreecommitdiff
path: root/benchmark
diff options
context:
space:
mode:
Diffstat (limited to 'benchmark')
-rw-r--r--benchmark/README.md72
-rw-r--r--benchmark/app_answer.rb15
-rw-r--r--benchmark/app_aobench.rb297
-rw-r--r--benchmark/app_erb.yml23
-rw-r--r--benchmark/app_factorial.rb11
-rw-r--r--benchmark/app_fib.rb10
-rw-r--r--benchmark/app_lc_fizzbuzz.rb52
-rw-r--r--benchmark/app_mandelbrot.rb23
-rw-r--r--benchmark/app_pentomino.rb130
-rw-r--r--benchmark/app_raise.rb8
-rw-r--r--benchmark/app_strconcat.rb5
-rw-r--r--benchmark/app_tak.rb13
-rw-r--r--benchmark/app_tarai.rb10
-rw-r--r--benchmark/app_uri.rb8
-rw-r--r--benchmark/array_flatten.yml19
-rw-r--r--benchmark/array_intersection.yml14
-rw-r--r--benchmark/array_max_float.yml30
-rw-r--r--benchmark/array_max_int.yml31
-rw-r--r--benchmark/array_max_str.yml30
-rw-r--r--benchmark/array_min.yml31
-rw-r--r--benchmark/array_sample.yml4
-rw-r--r--benchmark/array_sample_100k_10.rb2
-rw-r--r--benchmark/array_sample_100k_11.rb2
-rw-r--r--benchmark/array_sample_100k__100.rb2
-rw-r--r--benchmark/array_sample_100k__1k.rb2
-rw-r--r--benchmark/array_sample_100k__6k.rb2
-rw-r--r--benchmark/array_sample_100k___10k.rb2
-rw-r--r--benchmark/array_sample_100k___50k.rb2
-rw-r--r--benchmark/array_shift.rb14
-rw-r--r--benchmark/array_small_and.rb17
-rw-r--r--benchmark/array_small_diff.rb17
-rw-r--r--benchmark/array_small_or.rb17
-rw-r--r--benchmark/array_sort_block.rb2
-rw-r--r--benchmark/array_sort_float.rb2
-rw-r--r--benchmark/array_values_at_int.rb2
-rw-r--r--benchmark/array_values_at_range.rb2
-rw-r--r--benchmark/attr_accessor.yml29
-rw-r--r--benchmark/bighash.rb1
-rw-r--r--benchmark/buffer_get.yml9
-rw-r--r--benchmark/cgi_escape_html.yml40
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/enum_lazy_flat_map.yml16
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/enum_lazy_zip.yml22
-rw-r--r--benchmark/enum_tally.yml4
-rw-r--r--benchmark/erb_render.yml24
-rw-r--r--benchmark/fiber_chain.yml36
-rw-r--r--benchmark/fiber_locals.yml8
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/float_methods.yml14
-rw-r--r--benchmark/float_neg_posi.yml8
-rw-r--r--benchmark/float_to_s.yml7
-rw-r--r--benchmark/gc/aobench.rb1
-rw-r--r--benchmark/gc/binary_trees.rb1
-rw-r--r--benchmark/gc/gcbench.rb57
-rw-r--r--benchmark/gc/hash1.rb11
-rw-r--r--benchmark/gc/hash2.rb7
-rw-r--r--benchmark/gc/null.rb1
-rw-r--r--benchmark/gc/pentomino.rb1
-rw-r--r--benchmark/gc/rdoc.rb13
-rw-r--r--benchmark/gc/redblack.rb366
-rw-r--r--benchmark/gc/ring.rb29
-rw-r--r--benchmark/hash_aref_array.rb5
-rw-r--r--benchmark/hash_aref_dsym.rb4
-rw-r--r--benchmark/hash_aref_dsym_long.rb21
-rw-r--r--benchmark/hash_aref_fix.rb4
-rw-r--r--benchmark/hash_aref_flo.rb4
-rw-r--r--benchmark/hash_aref_miss.rb5
-rw-r--r--benchmark/hash_aref_str.rb4
-rw-r--r--benchmark/hash_aref_sym.rb9
-rw-r--r--benchmark/hash_aref_sym_long.rb13
-rw-r--r--benchmark/hash_defaults.yml6
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_first.yml11
-rw-r--r--benchmark/hash_flatten.rb9
-rw-r--r--benchmark/hash_ident_flo.rb4
-rw-r--r--benchmark/hash_ident_num.rb4
-rw-r--r--benchmark/hash_ident_obj.rb4
-rw-r--r--benchmark/hash_ident_str.rb4
-rw-r--r--benchmark/hash_ident_sym.rb4
-rw-r--r--benchmark/hash_keys.rb9
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_shift.rb10
-rw-r--r--benchmark/hash_shift_u16.rb10
-rw-r--r--benchmark/hash_shift_u24.rb10
-rw-r--r--benchmark/hash_shift_u32.rb10
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb9
-rw-r--r--benchmark/hash_values.rb9
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb13
-rw-r--r--benchmark/io_file_read.rb15
-rw-r--r--benchmark/io_file_write.rb14
-rw-r--r--benchmark/io_nonblock_noex.rb22
-rw-r--r--benchmark/io_nonblock_noex2.rb21
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb9
-rw-r--r--benchmark/io_select2.rb22
-rw-r--r--benchmark/io_select3.rb21
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/iseq_load_from_binary.yml25
-rw-r--r--benchmark/ivar_extend.yml23
-rw-r--r--benchmark/kernel_clone.yml6
-rw-r--r--benchmark/kernel_float.yml5
-rw-r--r--benchmark/kernel_tap.yml6
-rw-r--r--benchmark/kernel_then.yml6
-rw-r--r--benchmark/keyword_arguments.yml13
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit.rb34
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit_exec.rb237
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/ractor.rb122
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_for.rb3
-rw-r--r--benchmark/loop_generator.rb14
-rw-r--r--benchmark/loop_times.rb1
-rw-r--r--benchmark/loop_whileloop.rb4
-rw-r--r--benchmark/loop_whileloop2.rb4
-rw-r--r--benchmark/marshal_dump_flo.rb2
-rw-r--r--benchmark/marshal_dump_load_geniv.rb10
-rw-r--r--benchmark/marshal_dump_load_time.rb1
-rw-r--r--benchmark/masgn.yml29
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/method_bind_call.yml16
-rw-r--r--benchmark/mjit_exec_jt2jt.yml6
-rw-r--r--benchmark/mjit_exec_vm2jt.yml6
-rw-r--r--benchmark/mjit_exec_vm2vm.yml6
-rw-r--r--benchmark/mjit_exivar.yml18
-rw-r--r--benchmark/mjit_integer.yml32
-rw-r--r--benchmark/mjit_kernel.yml20
-rw-r--r--benchmark/mjit_leave.yml8
-rw-r--r--benchmark/mjit_opt_cc_insns.yml27
-rw-r--r--benchmark/mjit_struct_aref.yml10
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/nilclass.yml6
-rw-r--r--benchmark/num_zero_p.yml8
-rw-r--r--benchmark/numeric_methods.yml13
-rw-r--r--benchmark/object_allocate.yml21
-rw-r--r--benchmark/objspace_dump_all.yml13
-rw-r--r--benchmark/other-lang/ack.pl11
-rw-r--r--benchmark/other-lang/ack.py16
-rw-r--r--benchmark/other-lang/ack.rb12
-rw-r--r--benchmark/other-lang/ack.scm7
-rw-r--r--benchmark/other-lang/eval.rb66
-rw-r--r--benchmark/other-lang/fact.pl13
-rw-r--r--benchmark/other-lang/fact.py18
-rw-r--r--benchmark/other-lang/fact.rb13
-rw-r--r--benchmark/other-lang/fact.scm8
-rw-r--r--benchmark/other-lang/fib.pl11
-rw-r--r--benchmark/other-lang/fib.py7
-rw-r--r--benchmark/other-lang/fib.rb9
-rw-r--r--benchmark/other-lang/fib.scm7
-rw-r--r--benchmark/other-lang/loop.pl3
-rw-r--r--benchmark/other-lang/loop.py2
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/other-lang/loop.scm1
-rw-r--r--benchmark/other-lang/loop2.rb1
-rw-r--r--benchmark/other-lang/tak.pl11
-rw-r--r--benchmark/other-lang/tak.py8
-rw-r--r--benchmark/other-lang/tak.rb13
-rw-r--r--benchmark/other-lang/tak.scm10
-rw-r--r--benchmark/pm_array.yml19
-rw-r--r--benchmark/ractor_const.yml4
-rw-r--r--benchmark/ractor_float_to_s.yml8
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/realpath.yml30
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/securerandom.rb5
-rw-r--r--benchmark/so_ackermann.rb19
-rw-r--r--benchmark/so_array.rb23
-rw-r--r--benchmark/so_binary_trees.rb62
-rw-r--r--benchmark/so_concatenate.rb18
-rw-r--r--benchmark/so_count_words.yml65
-rw-r--r--benchmark/so_exception.rb61
-rw-r--r--benchmark/so_fannkuch.rb45
-rw-r--r--benchmark/so_fasta.rb81
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb47
-rw-r--r--benchmark/so_mandelbrot.rb57
-rw-r--r--benchmark/so_matrix.rb48
-rw-r--r--benchmark/so_meteor_contest.rb563
-rw-r--r--benchmark/so_nbody.rb148
-rw-r--r--benchmark/so_nested_loop.rb24
-rw-r--r--benchmark/so_nsieve.rb35
-rw-r--r--benchmark/so_nsieve_bits.rb43
-rw-r--r--benchmark/so_object.rb56
-rw-r--r--benchmark/so_partial_sums.rb31
-rw-r--r--benchmark/so_pidigits.rb92
-rw-r--r--benchmark/so_random.rb20
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb24
-rw-r--r--benchmark/so_spectralnorm.rb50
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_casecmp.yml26
-rw-r--r--benchmark/string_casecmp_p.yml26
-rw-r--r--benchmark/string_downcase.yml18
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_slice.yml11
-rw-r--r--benchmark/string_split.yml22
-rw-r--r--benchmark/string_swapcase.yml18
-rw-r--r--benchmark/string_upcase.yml18
-rw-r--r--benchmark/time_at.yml7
-rw-r--r--benchmark/time_new.yml4
-rw-r--r--benchmark/time_parse.yml8
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/vm_array.yml4
-rw-r--r--benchmark/vm_attr_ivar.yml14
-rw-r--r--benchmark/vm_attr_ivar_set.yml14
-rw-r--r--benchmark/vm_backtrace.rb22
-rw-r--r--benchmark/vm_bigarray.yml105
-rw-r--r--benchmark/vm_bighash.yml4
-rw-r--r--benchmark/vm_block.yml9
-rw-r--r--benchmark/vm_block_handler.yml27
-rw-r--r--benchmark/vm_blockparam.yml7
-rw-r--r--benchmark/vm_blockparam_call.yml8
-rw-r--r--benchmark/vm_blockparam_pass.yml12
-rw-r--r--benchmark/vm_blockparam_yield.yml8
-rw-r--r--benchmark/vm_case.yml13
-rw-r--r--benchmark/vm_case_classes.yml9
-rw-r--r--benchmark/vm_case_lit.yml23
-rw-r--r--benchmark/vm_clearmethodcache.rb8
-rw-r--r--benchmark/vm_const.yml7
-rw-r--r--benchmark/vm_cvar.yml20
-rw-r--r--benchmark/vm_defined_method.yml8
-rw-r--r--benchmark/vm_dstr.yml6
-rw-r--r--benchmark/vm_dstr_ary.rb6
-rw-r--r--benchmark/vm_dstr_bool.rb7
-rw-r--r--benchmark/vm_dstr_class_module.rb10
-rw-r--r--benchmark/vm_dstr_digit.rb7
-rw-r--r--benchmark/vm_dstr_int.rb5
-rw-r--r--benchmark/vm_dstr_nil.rb6
-rw-r--r--benchmark/vm_dstr_obj.rb6
-rw-r--r--benchmark/vm_dstr_obj_def.rb8
-rw-r--r--benchmark/vm_dstr_str.rb6
-rw-r--r--benchmark/vm_dstr_sym.rb6
-rw-r--r--benchmark/vm_ensure.yml14
-rw-r--r--benchmark/vm_eval.yml4
-rw-r--r--benchmark/vm_fiber_allocate.yml8
-rw-r--r--benchmark/vm_fiber_count.yml10
-rw-r--r--benchmark/vm_fiber_reuse.yml14
-rw-r--r--benchmark/vm_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm_fiber_switch.yml9
-rw-r--r--benchmark/vm_float_simple.yml8
-rw-r--r--benchmark/vm_freezestring.yml10
-rw-r--r--benchmark/vm_gc.rb6
-rw-r--r--benchmark/vm_gc_old_full.rb4
-rw-r--r--benchmark/vm_gc_old_immediate.rb4
-rw-r--r--benchmark/vm_gc_old_lazy.rb4
-rw-r--r--benchmark/vm_gc_short_lived.yml9
-rw-r--r--benchmark/vm_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm_gc_short_with_long.yml13
-rw-r--r--benchmark/vm_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm_gc_wb_ary.yml12
-rw-r--r--benchmark/vm_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm_gc_wb_obj.yml15
-rw-r--r--benchmark/vm_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm_iclass_super.yml20
-rw-r--r--benchmark/vm_ivar.yml6
-rw-r--r--benchmark/vm_ivar_init.yml14
-rw-r--r--benchmark/vm_ivar_of_class.yml12
-rw-r--r--benchmark/vm_ivar_of_class_set.yml11
-rw-r--r--benchmark/vm_ivar_set.yml5
-rw-r--r--benchmark/vm_ivar_set_subclass.yml17
-rw-r--r--benchmark/vm_length.yml8
-rw-r--r--benchmark/vm_lvar_init.yml21
-rw-r--r--benchmark/vm_lvar_set.yml4
-rw-r--r--benchmark/vm_method.yml8
-rw-r--r--benchmark/vm_method_missing.yml11
-rw-r--r--benchmark/vm_method_with_block.yml8
-rw-r--r--benchmark/vm_module_ann_const_set.yml4
-rw-r--r--benchmark/vm_module_const_set.yml8
-rw-r--r--benchmark/vm_mutex.yml8
-rw-r--r--benchmark/vm_neq.yml7
-rw-r--r--benchmark/vm_newlambda.yml4
-rw-r--r--benchmark/vm_not.yml6
-rw-r--r--benchmark/vm_poly_method.yml24
-rw-r--r--benchmark/vm_poly_method_ov.yml24
-rw-r--r--benchmark/vm_poly_same_method.yml25
-rw-r--r--benchmark/vm_poly_singleton.yml18
-rw-r--r--benchmark/vm_proc.yml12
-rw-r--r--benchmark/vm_raise1.yml16
-rw-r--r--benchmark/vm_raise2.yml16
-rw-r--r--benchmark/vm_regexp.yml8
-rw-r--r--benchmark/vm_rescue.yml6
-rw-r--r--benchmark/vm_send.yml14
-rw-r--r--benchmark/vm_send_cfunc.yml3
-rw-r--r--benchmark/vm_simplereturn.yml7
-rw-r--r--benchmark/vm_string_literal.yml4
-rw-r--r--benchmark/vm_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm_struct_big_aset.yml11
-rw-r--r--benchmark/vm_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm_struct_big_hset.yml11
-rw-r--r--benchmark/vm_struct_small_aref.yml7
-rw-r--r--benchmark/vm_struct_small_aset.yml11
-rw-r--r--benchmark/vm_struct_small_href.yml7
-rw-r--r--benchmark/vm_struct_small_hset.yml7
-rw-r--r--benchmark/vm_super.yml17
-rw-r--r--benchmark/vm_swap.yml7
-rw-r--r--benchmark/vm_symbol_block_pass.rb13
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb6
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb6
-rw-r--r--benchmark/vm_thread_mutex1.rb21
-rw-r--r--benchmark/vm_thread_mutex2.rb21
-rw-r--r--benchmark/vm_thread_mutex3.rb20
-rw-r--r--benchmark/vm_thread_pass.rb15
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb17
-rw-r--r--benchmark/vm_thread_queue.rb18
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--benchmark/vm_unif1.yml7
-rw-r--r--benchmark/vm_yield.yml13
-rw-r--r--benchmark/vm_zsuper.yml18
352 files changed, 7303 insertions, 0 deletions
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..c222164be3
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,72 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+Usage: benchmark-driver [options] RUBY|YAML...
+ -r, --runner TYPE Specify runner type: ips, time, memory, once (default: ips)
+ -o, --output TYPE Specify output type: compare, simple, markdown, record (default: compare)
+ -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+ --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+ --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
+ --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
+ --bundler Install and use gems specified in Gemfile
+ --filter REGEXP Filter out benchmarks with given regexp
+ --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
+ -v, --verbose Verbose mode. Multiple -v options increase visibility (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/app_answer.rb b/benchmark/app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+def the_answer_to_life_the_universe_and_everything
+ (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..16296af12b
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsampling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+ # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ # $fp = fp
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n")
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+benchmark:
+ app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+ if(n > 1)
+ n * fact(n-1)
+ else
+ 1
+ end
+end
+
+100.times {
+ fact(5000)
+}
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
+
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+# "Understanding Computation" by Tom Stuart
+# http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST = -> l { LEFT[RIGHT[l]] }
+IF = -> b { b }
+LEFT = -> p { p[-> x { -> y { x } } ] }
+RIGHT = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY = LEFT
+REST = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+ proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+ IF[proc][true][false]
+end
+
+def to_array(proc)
+ array = []
+
+ until to_boolean(IS_EMPTY[proc])
+ array.push(FIRST[proc])
+ proc = REST[proc]
+ end
+
+ array
+end
+
+def to_char(c)
+ '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+ to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+ to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+ i = 0
+ while i<100
+ i += 1
+ z = z * z
+ return false if z.abs > 2
+ end
+ true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+ (0..1000).each{|dy|
+ x = dx / 50.0
+ y = dy / 50.0
+ c = Complex(x, y)
+ ary << c if mandelbrot?(c)
+ }
+}
+
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+ i += 1
+ begin
+ raise
+ rescue
+ end
+end
diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+ "#{1+1} #{1+1} #{1+1}"
+ i += 1
+end
diff --git a/benchmark/app_tak.rb b/benchmark/app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/app_tarai.rb b/benchmark/app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+ if x <= y
+ then y
+ else tarai(tarai(x-1, y, z),
+ tarai(y-1, z, x),
+ tarai(z-1, x, y))
+ end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/app_uri.rb b/benchmark/app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+ uri = URI.parse('http://www.ruby-lang.org')
+ uri.scheme
+ uri.host
+ uri.port
+}
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+ small_flat_ary = 5.times.to_a
+ large_flat_ary = 100.times.to_a
+ small_pairs_ary = [[1, 2]] * 5
+ large_pairs_ary = [[1, 2]] * 100
+ mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+ small_flat_ary.flatten: small_flat_ary.flatten
+ small_flat_ary.flatten!: small_flat_ary.flatten!
+ large_flat_ary.flatten: large_flat_ary.flatten
+ large_flat_ary.flatten!: large_flat_ary.flatten!
+ small_pairs_ary.flatten: small_pairs_ary.flatten
+ small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+ large_pairs_ary.flatten: large_pairs_ary.flatten
+ large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+ mostly_flat_ary.flatten: mostly_flat_ary.flatten
+ mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+ small1 = [1, 2, 3]
+ small2 = [1, 2, 3, 4, 5]
+ small3 = [2, 3, 4, 5]
+ small4 = [2]
+ big1 = [1, 2, 3, 4] * 64
+ big2 = [1, 2, 3] * 64
+ big3 = [1, 2] * 64
+
+benchmark:
+ small-&: small1 & small2 & small3 & small4
+ small-intersection: small1.intersection(small2, small3, small4)
+ big-&: big1 & big2 & big3
+ big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_f).shuffle
+ ary10 = 10.times.map(&:to_f).shuffle
+ ary100 = 100.times.map(&:to_f).shuffle
+ ary500 = 500.times.map(&:to_f).shuffle
+ ary1000 = 1000.times.map(&:to_f).shuffle
+ ary2000 = 2500.times.map(&:to_f).shuffle
+ ary3000 = 2500.times.map(&:to_f).shuffle
+ ary5000 = 5000.times.map(&:to_f).shuffle
+ ary10000 = 10000.times.map(&:to_f).shuffle
+ ary20000 = 20000.times.map(&:to_f).shuffle
+ ary50000 = 50000.times.map(&:to_f).shuffle
+ ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+ ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_s).shuffle
+ ary10 = 10.times.map(&:to_s).shuffle
+ ary100 = 100.times.map(&:to_s).shuffle
+ ary500 = 500.times.map(&:to_s).shuffle
+ ary1000 = 1000.times.map(&:to_s).shuffle
+ ary2000 = 2500.times.map(&:to_s).shuffle
+ ary3000 = 2500.times.map(&:to_s).shuffle
+ ary5000 = 5000.times.map(&:to_s).shuffle
+ ary10000 = 10000.times.map(&:to_s).shuffle
+ ary20000 = 20000.times.map(&:to_s).shuffle
+ ary50000 = 50000.times.map(&:to_s).shuffle
+ ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.min: ary2.min
+ ary10.min: ary10.min
+ ary100.min: ary100.min
+ ary500.min: ary500.min
+ ary1000.min: ary1000.min
+ ary2000.min: ary2000.min
+ ary3000.min: ary3000.min
+ ary5000.min: ary5000.min
+ ary10000.min: ary10000.min
+ ary20000.min: ary20000.min
+ ary50000.min: ary50000.min
+ ary100000.min: ary100000.min
+ ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+ - ary.sample
+ - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+ [10_000,1_000_000,100_000_000].each do |n|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift"){ ary.shift }
+ (0..4).each do |i|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+ end
+ end
+end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 & arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 - arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 | arr2
+ end
+ end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+ class C
+ attr_accessor :x
+ def initialize
+ @x = nil
+ end
+ class_eval <<-END
+ def ar
+ #{'x;'*256}
+ end
+ def aw
+ #{'self.x = nil;'*256}
+ end
+ def arm
+ m = method(:x)
+ #{'m.call;'*256}
+ end
+ def awm
+ m = method(:x=)
+ #{'m.call(nil);'*256}
+ end
+ END
+ end
+ obj = C.new
+benchmark:
+ attr_reader: "obj.ar"
+ attr_writer: "obj.aw"
+ attr_reader_method: "obj.arm"
+ attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..e375dcf85d
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,9 @@
+benchmark:
+ - name: buffer.get
+ prelude: buffer = IO::Buffer.new(32, IO::Buffer::MAPPED)
+ script: buffer.get(:U32, 0)
+ loop_count: 20000000
+ - name: string.unpack
+ prelude: string = "\0" * 32
+ script: string.unpack("C")
+ loop_count: 20000000
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..af6abd08ac
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,40 @@
+prelude: require 'cgi/escape'
+benchmark:
+ - name: escape_html_blank
+ prelude: str = ""
+ script: CGI.escapeHTML(str)
+ loop_count: 20000000
+ - name: escape_html_short_none
+ prelude: str = "abcde"
+ script: CGI.escapeHTML(str)
+ loop_count: 20000000
+ - name: escape_html_short_one
+ prelude: str = "abcd<"
+ script: CGI.escapeHTML(str)
+ loop_count: 20000000
+ - name: escape_html_short_all
+ prelude: str = "'&\"<>"
+ script: CGI.escapeHTML(str)
+ loop_count: 5000000
+ - name: escape_html_long_none
+ prelude: str = "abcde" * 300
+ script: CGI.escapeHTML(str)
+ loop_count: 1000000
+ - name: escape_html_long_all
+ prelude: str = "'&\"<>" * 10
+ script: CGI.escapeHTML(str)
+ loop_count: 1000000
+ - name: escape_html_real
+ prelude: | # http://example.com/
+ str = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: CGI.escapeHTML(str)
+ loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+ max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+ num = (1..).lazy.take(100)
+ ary2 = [[1,2]].cycle.lazy.take(10)
+ ary10 = [[*1..10]].cycle.lazy.take(10)
+ ary20 = [[*1..20]].cycle.lazy.take(10)
+ ary50 = [[*1..50]].cycle.lazy.take(10)
+ ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+ num3: num.flat_map {|x| x}.take(3).to_a
+ num10: num.flat_map {|x| x}.take(3).to_a
+ ary2: ary2.flat_map {|x| x}.take(3).to_a
+ ary10: ary10.flat_map {|x| x}.take(3).to_a
+ ary20: ary20.flat_map {|x| x}.take(3).to_a
+ ary50: ary50.flat_map {|x| x}.take(3).to_a
+ ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+ a = (1..3).lazy
+ b = a.map {|x| x}
+
+benchmark:
+ first_ary: a.zip(["a", "b", "c"]).first
+ first_nonary: a.zip("a".."c").first
+ first_noarg: a.zip.first
+
+ take3_ary: a.zip(["a", "b", "c"]).take(3).force
+ take3_nonary: a.zip("a".."c").take(3).force
+ take3_noarg: a.zip.take(3).force
+
+ chain-first_ary: b.zip(["a", "b", "c"]).first
+ chain-first_nonary: b.zip("a".."c").first
+ chain-first_noarg: b.zip.first
+
+ chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+ chain-take3_nonary: b.zip("a".."c").take(3).force
+ chain-take3_noarg: b.zip.take(3).force
+
+ block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+ list = ("aaa".."zzz").to_a*10
+benchmark:
+ tally: list.tally
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+
+ src = "def self.render(title, content); #{ERB.new(data).src}; end"
+ mod = Module.new
+ mod.instance_eval(src, "(ERB)")
+benchmark:
+ erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+ def make_link(previous)
+ Fiber.new do
+ while message = previous.resume
+ Fiber.yield(message)
+ end
+ end
+ end
+
+ def make_chain(length = 1000, &block)
+ chain = Fiber.new(&block)
+
+ (length - 1).times do
+ chain = make_link(chain)
+ end
+
+ return chain
+ end
+
+ message = "Hello World!"
+
+ chain = make_chain do
+ while true
+ Fiber.yield(message)
+ end
+ end
+benchmark:
+ make_chain: |
+ make_chain(100) do
+ while true
+ Fiber.yield(message)
+ end
+ end
+ resume_chain: |
+ chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+ th = Thread.current
+ th[:key] = :val
+benchmark:
+ key?: th.key?(:key)
+ []: th[:key]
+ keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+ File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+ File.rename(a, b)
+ File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ to_f: |
+ flo.to_f
+ abs: |
+ flo.abs
+ magnitude: |
+ flo.magnitude
+ -@: |
+ -flo
+ zero?: |
+ flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ negative?: |
+ flo.negative?
+ positive?: |
+ flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+ floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+ to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..275f58b924
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..83347cdd20
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..23d0b91c6c
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,57 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = false
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+ GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+ load script
+}
+
+gc_time = 0
+
+if $gcprof
+ gc_time = GC::Profiler.total_time
+ GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+ GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+ puts
+ puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts " (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+ h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+ ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+ h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..8ebdff7d1d
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../app_pentomino'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+ dir = File.join(d, 'rdocbench')
+ args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+ args << '--op' << dir
+
+ r = RDoc::RDoc.new
+ r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+ class Node
+ attr_accessor :color
+ attr_accessor :key
+ attr_accessor :left
+ attr_accessor :right
+ attr_accessor :parent
+
+ RED = :red
+ BLACK = :black
+ COLORS = [RED, BLACK].freeze
+
+ def initialize(key, color = RED)
+ raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+ @color = color
+ @key = key
+ @left = @right = @parent = NilNode.instance
+ end
+
+ def black?
+ return color == BLACK
+ end
+
+ def red?
+ return color == RED
+ end
+ end
+
+ class NilNode < Node
+ class << self
+ private :new
+
+ # it's not thread safe
+ def instance
+ @instance ||= begin
+ def instance
+ return @instance
+ end
+
+ new
+ end
+ end
+ end
+
+ def initialize
+ self.color = BLACK
+ self.key = 0
+ self.left = nil
+ self.right = nil
+ self.parent = nil
+ end
+
+ def nil?
+ return true
+ end
+ end
+
+ include Enumerable
+
+ attr_accessor :root
+ attr_accessor :size
+
+ def initialize
+ self.root = NilNode.instance
+ self.size = 0
+ end
+
+ def add(key)
+ insert(Node.new(key))
+ end
+
+ def insert(x)
+ insert_helper(x)
+
+ x.color = Node::RED
+ while x != root && x.parent.color == Node::RED
+ if x.parent == x.parent.parent.left
+ y = x.parent.parent.right
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.right
+ x = x.parent
+ left_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ right_rotate(x.parent.parent)
+ end
+ else
+ y = x.parent.parent.left
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.left
+ x = x.parent
+ right_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ left_rotate(x.parent.parent)
+ end
+ end
+ end
+ root.color = Node::BLACK
+ end
+
+ alias << insert
+
+ def delete(z)
+ y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+ x = y.left.nil? ? y.right : y.left
+ x.parent = y.parent
+
+ if y.parent.nil?
+ self.root = x
+ else
+ if y == y.parent.left
+ y.parent.left = x
+ else
+ y.parent.right = x
+ end
+ end
+
+ z.key = y.key if y != z
+
+ if y.color == Node::BLACK
+ delete_fixup(x)
+ end
+
+ self.size -= 1
+ return y
+ end
+
+ def minimum(x = root)
+ while !x.left.nil?
+ x = x.left
+ end
+ return x
+ end
+
+ def maximum(x = root)
+ while !x.right.nil?
+ x = x.right
+ end
+ return x
+ end
+
+ def successor(x)
+ if !x.right.nil?
+ return minimum(x.right)
+ end
+ y = x.parent
+ while !y.nil? && x == y.right
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def predecessor(x)
+ if !x.left.nil?
+ return maximum(x.left)
+ end
+ y = x.parent
+ while !y.nil? && x == y.left
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def inorder_walk(x = root)
+ x = self.minimum
+ while !x.nil?
+ yield x.key
+ x = successor(x)
+ end
+ end
+
+ alias each inorder_walk
+
+ def reverse_inorder_walk(x = root)
+ x = self.maximum
+ while !x.nil?
+ yield x.key
+ x = predecessor(x)
+ end
+ end
+
+ alias reverse_each reverse_inorder_walk
+
+ def search(key, x = root)
+ while !x.nil? && x.key != key
+ key < x.key ? x = x.left : x = x.right
+ end
+ return x
+ end
+
+ def empty?
+ return self.root.nil?
+ end
+
+ def black_height(x = root)
+ height = 0
+ while !x.nil?
+ x = x.left
+ height +=1 if x.nil? || x.black?
+ end
+ return height
+ end
+
+private
+
+ def left_rotate(x)
+ raise "x.right is nil!" if x.right.nil?
+ y = x.right
+ x.right = y.left
+ y.left.parent = x if !y.left.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.left = x
+ x.parent = y
+ end
+
+ def right_rotate(x)
+ raise "x.left is nil!" if x.left.nil?
+ y = x.left
+ x.left = y.right
+ y.right.parent = x if !y.right.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.right = x
+ x.parent = y
+ end
+
+ def insert_helper(z)
+ y = NilNode.instance
+ x = root
+ while !x.nil?
+ y = x
+ z.key < x.key ? x = x.left : x = x.right
+ end
+ z.parent = y
+ if y.nil?
+ self.root = z
+ else
+ z.key < y.key ? y.left = z : y.right = z
+ end
+ self.size += 1
+ end
+
+ def delete_fixup(x)
+ while x != root && x.color == Node::BLACK
+ if x == x.parent.left
+ w = x.parent.right
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ left_rotate(x.parent)
+ w = x.parent.right
+ end
+ if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.right.color == Node::BLACK
+ w.left.color = Node::BLACK
+ w.color = Node::RED
+ right_rotate(w)
+ w = x.parent.right
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.right.color = Node::BLACK
+ left_rotate(x.parent)
+ x = root
+ end
+ else
+ w = x.parent.left
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ right_rotate(x.parent)
+ w = x.parent.left
+ end
+ if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.left.color == Node::BLACK
+ w.right.color = Node::BLACK
+ w.color = Node::RED
+ left_rotate(w)
+ w = x.parent.left
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.left.color = Node::BLACK
+ right_rotate(x.parent)
+ x = root
+ end
+ end
+ end
+ x.color = Node::BLACK
+ end
+end
+
+def rbt_bm
+ n = 100_000
+ a1 = []; n.times { a1 << rand(999_999) }
+ a2 = []; n.times { a2 << rand(999_999) }
+
+ start = Time.now
+
+ tree = RedBlackTree.new
+
+ n.times {|i| tree.add(i) }
+ n.times { tree.delete(tree.root) }
+
+ tree = RedBlackTree.new
+ a1.each {|e| tree.add(e) }
+ a2.each {|e| tree.search(e) }
+ tree.inorder_walk {|key| key + 1 }
+ tree.reverse_inorder_walk {|key| key + 1 }
+ n.times { tree.minimum }
+ n.times { tree.maximum }
+
+ return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+ # puts rbt_bm.to_f
+ rbt_bm.to_f
+ # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+ attr_reader :next_ring
+ def initialize n = nil
+ @next_ring = n
+ end
+
+
+ def size
+ s = 1
+ ring = self
+ while ring.next_ring
+ s += 1
+ ring = ring.next_ring
+ end
+ s
+ end
+end
+
+ring = Ring.new
+
+max.times{
+ ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+ "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+ symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+ symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+ syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+ syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+ syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+ syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+ h = Hash.new { :foo }
+benchmark:
+ default_aref: h[1]
+ default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+ small_hash = { a: 1 }
+ larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+ dup_small: small_hash.dup
+ dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+ hash1 = 1_000_000.times.to_h { [rand, true]}
+ hash2 = hash1.dup
+ hash2.keys[1..100_000].each { hash2.delete _1 }
+ hash2.delete hash2.first[0]
+
+benchmark:
+ hash1: hash1.first
+ hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+1000.times do
+ h.flatten
+end
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.keys
+end
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+50000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do |i|
+ [i].map(&h)
+end
diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.values
+end
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ src = Zero.new
+ dst = File.open(IO::NULL, 'wb')
+ n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+ # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ require 'socket'
+ src = Zero.new
+ rd, wr = UNIXSocket.pair
+ pid = fork do
+ wr.close
+ buf = String.new
+ while rd.read(16384, buf)
+ end
+ end
+ rd.close
+ IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+ # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+ wr.close if wr
+ Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+ f = open(file, 'w')
+ f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+ f.seek 0
+ f.read
+}
diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+ f.seek 0
+ f.write str
+}
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, noex)
+ r.read_nonblock(1, buf, noex)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, exception: false)
+ r.read_nonblock(1, buf, exception: false)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+ i += 1
+ w.write(src)
+ r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+ IO.select nil, w
+}
+
diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+ ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+ IO.select nil, last
+end
+
diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+ r, w = IO.pipe
+ r.close
+ ios.push w
+end
+
+nr.times do
+ IO.select nil, ios
+end
+
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'irb/color'
+ code = <<~'CODE'
+ def self.foo # bar
+ :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+ end
+ CODE
+benchmark:
+ irb_color_complete: |
+ IRB::Color.colorize_code(code, complete: true)
+ irb_color_incomplete: |
+ IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'rbconfig'
+ irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+ irb_exec: |
+ IO.popen(irb_f, 'w') do |io|
+ io.write('exit')
+ end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+ symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+ define_method = RubyVM::InstructionSequence.compile(%{
+ def foo; end
+ def bar; end
+ def baz; end
+ def egg; end
+ def spam; end
+ }).to_binary
+
+ all = RubyVM::InstructionSequence.compile(%{
+ module Foo; def foo; :foo; end; end
+ module Bar; def bar; :bar; end; end
+ module Baz; def baz; :baz; end; end
+ class Egg; def egg; :egg; end; end
+ class Spaml; def spam; :spam; end; end
+ }).to_binary
+
+benchmark:
+ symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+ define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+ all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+ class Embedded
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ end
+ end
+
+ class Extended
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ @d = 1
+ @e = 1
+ @f = 1
+ end
+ end
+benchmark:
+ embedded: Embedded.new
+ extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+ clone: "object.clone"
+ clone_true: "object.clone(freeze: true)"
+ clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+ float: "Float(42)"
+ float_true: "Float(42, exception: true)"
+ float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+ x = nil
+benchmark:
+ kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+ kernel_then: 1.then { |i| i + 1 }
+ kernel_then_enum: 1.then
+ kernel_yield_self: 1.yield_self { |i| i + 1 }
+ kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+ h = {a: 1}
+ def kw(a: 1) a end
+ def kws(**kw) kw end
+benchmark:
+ kw_to_kw: "kw(a: 1)"
+ kw_splat_to_kw: "kw(**h)"
+ kw_to_kw_splat: "kws(a: 1)"
+ kw_splat_to_kw_splat: "kws(**h)"
+ kw_and_splat_to_kw: "kw(a: 1, **h)"
+ kw_splats_to_kw: "kw(**h, **h)"
+ kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+ kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+ def initialize(*)
+ super
+ @stdout = $stdout
+ @strio = StringIO.new
+ $stdout = IOMultiplexer.new(@stdout, @strio)
+ end
+
+ def with_benchmark(*)
+ super
+ ensure
+ logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+ puts "\nLog file: #{logfile}"
+
+ $stdout = @stdout
+ File.write(logfile, @strio.tap(&:rewind).read)
+ end
+
+ class IOMultiplexer
+ def initialize(io1, io2)
+ @io1 = io1
+ @io2 = io2
+ end
+
+ [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+ define_method(method) do |*args|
+ @io1.send(method, *args)
+ @io2.send(method, *args)
+ end
+ end
+ end
+ private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cstime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cutime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit.rb b/benchmark/lib/benchmark_driver/runner/mjit.rb
new file mode 100644
index 0000000000..1d4693e8be
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/mjit.rb
@@ -0,0 +1,34 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'erb'
+
+# A runner to measure after-JIT performance easily
+class BenchmarkDriver::Runner::Mjit < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(**)
+ jobs = super
+ jobs.map do |job|
+ job = job.dup
+ job.prelude = "#{job.prelude}\n#{<<~EOS}"
+ if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+ __bmdv_ruby_i = 0
+ while __bmdv_ruby_i < 10000 # jit_min_calls
+ #{job.script}
+ __bmdv_ruby_i += 1
+ end
+ RubyVM::MJIT.pause # compile
+ #{job.script}
+ RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile
+ #{job.script}
+ RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile 2
+ end
+ EOS
+ job
+ end
+ end
+ })
+end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit_exec.rb b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb
new file mode 100644
index 0000000000..eac3dfba84
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb
@@ -0,0 +1,237 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'erb'
+
+# A special runner dedicated for measuring mjit_exec overhead.
+class BenchmarkDriver::Runner::MjitExec
+ METRIC = BenchmarkDriver::Metric.new(name: 'Iteration per second', unit: 'i/s')
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = ::BenchmarkDriver::Struct.new(
+ :name, # @param [String] name - This is mandatory for all runner
+ :metrics, # @param [Array<BenchmarkDriver::Metric>]
+ :num_methods, # @param [Integer] num_methods - The number of methods to be defined
+ :loop_count, # @param [Integer] loop_count
+ :from_jit, # @param [TrueClass,FalseClass] from_jit - Whether the mjit_exec() is from JIT or not
+ :to_jit, # @param [TrueClass,FalseClass] to_jit - Whether the mjit_exec() is to JIT or not
+ )
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ class << JobParser = Module.new
+ # @param [Array,String] num_methods
+ # @param [Integer] loop_count
+ # @param [TrueClass,FalseClass] from_jit
+ # @param [TrueClass,FalseClass] to_jit
+ def parse(num_methods:, loop_count:, from_jit:, to_jit:)
+ if num_methods.is_a?(String)
+ num_methods = eval(num_methods)
+ end
+
+ num_methods.map do |num|
+ if num_methods.size > 1
+ suffix = "[#{'%4d' % num}]"
+ else
+ suffix = "_#{num}"
+ end
+ Job.new(
+ name: "mjit_exec_#{from_jit ? 'JT' : 'VM'}2#{to_jit ? 'JT' : 'VM'}#{suffix}",
+ metrics: [METRIC],
+ num_methods: num,
+ loop_count: loop_count,
+ from_jit: from_jit,
+ to_jit: to_jit,
+ )
+ end
+ end
+ end
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ @contexts.each do |context|
+ result = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: true, rest_on_average: :average) do
+ run_benchmark(job, context: context)
+ end
+ value, duration = result.value
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { METRIC => value }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ if job.from_jit
+ if job.to_jit
+ benchmark = BenchmarkJT2JT.new(num_methods: job.num_methods, loop_count: job.loop_count)
+ else
+ raise NotImplementedError, "JT2VM is not implemented yet"
+ end
+ else
+ if job.to_jit
+ benchmark = BenchmarkVM2JT.new(num_methods: job.num_methods, loop_count: job.loop_count)
+ else
+ benchmark = BenchmarkVM2VM.new(num_methods: job.num_methods, loop_count: job.loop_count)
+ end
+ end
+
+ duration = Tempfile.open(['benchmark_driver-result', '.txt']) do |f|
+ with_script(benchmark.render(result: f.path)) do |path|
+ opt = []
+ if context.executable.command.any? { |c| c.start_with?('--jit') }
+ opt << '--jit-min-calls=2'
+ end
+ IO.popen([*context.executable.command, '--disable-gems', *opt, path], &:read)
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+
+ [job.loop_count.to_f / duration, duration]
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [Integer] num_methods
+ # @param [Integer] loop_count
+ BenchmarkVM2VM = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:)
+ ERB.new(<<~EOS, trim_mode: '%').result(binding)
+ % num_methods.times do |i|
+ def a<%= i %>
+ nil
+ end
+ % end
+ RubyVM::MJIT.pause if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+
+ def vm
+ t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+ i = 0
+ while i < <%= loop_count / 1000 %>
+ % 1000.times do |i|
+ a<%= i % num_methods %>
+ % end
+ i += 1
+ end
+ % (loop_count % 1000).times do |i|
+ a<%= i % num_methods %>
+ % end
+ Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
+ end
+
+ vm # warmup call cache
+ File.write(<%= result.dump %>, vm)
+ EOS
+ end
+ end
+ private_constant :BenchmarkVM2VM
+
+ # @param [Integer] num_methods
+ # @param [Integer] loop_count
+ BenchmarkVM2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:)
+ ERB.new(<<~EOS, trim_mode: '%').result(binding)
+ % num_methods.times do |i|
+ def a<%= i %>
+ nil
+ end
+ a<%= i %>
+ a<%= i %> # --jit-min-calls=2
+ % end
+ RubyVM::MJIT.pause if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+
+ def vm
+ t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+ i = 0
+ while i < <%= loop_count / 1000 %>
+ % 1000.times do |i|
+ a<%= i % num_methods %>
+ % end
+ i += 1
+ end
+ % (loop_count % 1000).times do |i|
+ a<%= i % num_methods %>
+ % end
+ Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
+ end
+
+ vm # warmup call cache
+ File.write(<%= result.dump %>, vm)
+ EOS
+ end
+ end
+ private_constant :BenchmarkVM2JT
+
+ # @param [Integer] num_methods
+ # @param [Integer] loop_count
+ BenchmarkJT2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:)
+ ERB.new(<<~EOS, trim_mode: '%').result(binding)
+ % num_methods.times do |i|
+ def a<%= i %>
+ nil
+ end
+ % end
+
+ # You may need to:
+ # * Increase `JIT_ISEQ_SIZE_THRESHOLD` to 10000000 in mjit.h
+ # * Always return false in `inlinable_iseq_p()` of mjit_compile.c
+ def jit
+ t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+ i = 0
+ while i < <%= loop_count / 1000 %>
+ % 1000.times do |i|
+ a<%= i % num_methods %>
+ % end
+ i += 1
+ end
+ % (loop_count % 1000).times do |i|
+ a<%= i % num_methods %>
+ % end
+ Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
+ end
+
+ jit
+ jit
+ RubyVM::MJIT.pause if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+ File.write(<%= result.dump %>, jit)
+ EOS
+ end
+ end
+ private_constant :BenchmarkJT2JT
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ jobs = jobs.map do |job|
+ job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+ end
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => value }, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render) do |path|
+ output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+ if $?.success?
+ Integer(f.read)
+ else
+ $stdout.print(output)
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def target
+ 'peak'
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def metric
+ METRIC
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ def render
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+ key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+ key = ms.respond_to?(:rss) ? :rss : :size
+else
+ raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ end
+
+ if times > 1
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ else
+ content
+ end
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..c730b8e4a5
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob) do
+ attr_accessor :ractor
+ end
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(ractor: 1, **kwargs)
+ super(**kwargs).each do |job|
+ job.ractor = ractor
+ end
+ end
+ })
+
+ private
+
+ unless private_instance_methods.include?(:run_benchmark)
+ raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+ end
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ results = job.ractor.times.map do
+ Tempfile.open('benchmark_driver_result')
+ end
+ duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+ success = execute(*context.executable.command, path, exception: false)
+ if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+ value
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ results.each(&:close)
+
+ value_duration(
+ loop_count: job.loop_count,
+ duration: duration,
+ )
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(results:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+ __bmdv_loop_before = 0
+ __bmdv_loop_after = 0
+else
+ __bmdv_loop_before = Time.new
+ #{while_loop('', loop_count, id: 0)}
+ __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+ __bmdv_time = Time
+ __bmdv_script_before = __bmdv_time.new
+ #{while_loop(script, loop_count, id: 1)}
+ __bmdv_script_after = __bmdv_time.new
+
+ (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:take)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+ RUBY
+ end
+
+ private
+
+ # id is to prevent:
+ # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+ def while_loop(content, times, id:)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+ #{content}
+ __bmdv_i#{id} += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Peak#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Peak#target
+ def target
+ 'size'
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :stime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ raise 'missing loop_count is not supported in Ruby repository'
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render(result: f.path, target: target)) do |path|
+ IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # This method is overridden by some subclasses
+ def metric
+ METRIC
+ end
+
+ # This method is overridden by some subclasses
+ def target
+ :total
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:, target:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+ #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :utime
+ end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+# 1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+ x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+ x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+ x.report %q{
+ h = {a: 1, b: 2, c: 3, d: 4}
+ }
+}
+=end
+#
+# 2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_for.rb b/benchmark/loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+ #
+end
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+ gen = (1..max).each
+ loop do
+ gen.next
+ end
+else
+ require 'generator'
+ gen = Generator.new((0..max))
+ while gen.next?
+ gen.next
+ end
+end
diff --git a/benchmark/loop_times.rb b/benchmark/loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+ i += 1
+end
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+ i += 1
+end
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+ @a = :a
+ @b = :b
+ @c = :c
+end
+100000.times do
+ a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..4be9333e23
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,29 @@
+prelude: |
+ a = [nil] * 3
+ b = Class.new{attr_writer :a, :b, :c}.new
+ c, d, e, f = nil, nil, nil, nil
+benchmark:
+ array2_2: "c = (a[0], a[1] = 1, 2)"
+ array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+ array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+ array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+ attr2_2: "c = (b.a, b.b = 1, 2)"
+ attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+ attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+ attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+ lvar2_2: "c = (d, e = 1, 2)"
+ lvar2_3: "c = (d, e = 1, 2, 3)"
+ lvar3_2: "c = (d, e, f = 1, 2)"
+ lvar3_3: "c = (d, e, f = 1, 2, 3)"
+ array2_2p: "(a[0], a[1] = 1, 2; nil)"
+ array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+ array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+ array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+ attr2_2p: "(b.a, b.b = 1, 2; nil)"
+ attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+ attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+ attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+ lvar2_2p: "(d, e = 1, 2; nil)"
+ lvar2_3p: "(d, e = 1, 2, 3; nil)"
+ lvar3_2p: "(d, e, f = 1, 2; nil)"
+ lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+ named_module = Kernel
+
+ module FakeName
+ def self.name
+ "NotMyame".freeze
+ end
+ end
+
+ MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+ fastpath: MOD_NAME.bind_call(Kernel)
+ slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/mjit_exec_jt2jt.yml b/benchmark/mjit_exec_jt2jt.yml
new file mode 100644
index 0000000000..6c303c7a44
--- /dev/null
+++ b/benchmark/mjit_exec_jt2jt.yml
@@ -0,0 +1,6 @@
+type: lib/benchmark_driver/runner/mjit_exec
+num_methods: [1]
+#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
+loop_count: 50000000
+from_jit: true
+to_jit: true
diff --git a/benchmark/mjit_exec_vm2jt.yml b/benchmark/mjit_exec_vm2jt.yml
new file mode 100644
index 0000000000..764883f070
--- /dev/null
+++ b/benchmark/mjit_exec_vm2jt.yml
@@ -0,0 +1,6 @@
+type: lib/benchmark_driver/runner/mjit_exec
+num_methods: [1]
+#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
+loop_count: 50000000
+from_jit: false
+to_jit: true
diff --git a/benchmark/mjit_exec_vm2vm.yml b/benchmark/mjit_exec_vm2vm.yml
new file mode 100644
index 0000000000..030aa76c1c
--- /dev/null
+++ b/benchmark/mjit_exec_vm2vm.yml
@@ -0,0 +1,6 @@
+type: lib/benchmark_driver/runner/mjit_exec
+num_methods: [1]
+#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
+loop_count: 50000000
+from_jit: false
+to_jit: false
diff --git a/benchmark/mjit_exivar.yml b/benchmark/mjit_exivar.yml
new file mode 100644
index 0000000000..2584fa6410
--- /dev/null
+++ b/benchmark/mjit_exivar.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ class Bench < Hash
+ def initialize
+ @exivar = nil
+ end
+
+ def exivar
+ @exivar
+ end
+ end
+
+ bench = Bench.new
+
+benchmark:
+ mjit_exivar: bench.exivar
+
+loop_count: 200000000
diff --git a/benchmark/mjit_integer.yml b/benchmark/mjit_integer.yml
new file mode 100644
index 0000000000..a6b5c9ee16
--- /dev/null
+++ b/benchmark/mjit_integer.yml
@@ -0,0 +1,32 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_abs(int) int.abs end
+ def mjit_bit_length(int) int.bit_length end
+ def mjit_comp(int) ~int end
+ def mjit_even?(int) int.even? end
+ def mjit_integer?(int) int.integer? end
+ def mjit_magnitude(int) int.magnitude end
+ def mjit_odd?(int) int.odd? end
+ def mjit_ord(int) int.ord end
+ def mjit_size(int) int.size end
+ def mjit_to_i(int) int.to_i end
+ def mjit_to_int(int) int.to_int end
+ def mjit_uminus(int) -int end
+ def mjit_zero?(int) int.zero? end
+
+benchmark:
+ - mjit_abs(-1)
+ - mjit_bit_length(100)
+ - mjit_comp(1)
+ - mjit_even?(2)
+ - mjit_integer?(0)
+ - mjit_magnitude(-1)
+ - mjit_odd?(1)
+ - mjit_ord(1)
+ - mjit_size(1)
+ - mjit_to_i(1)
+ - mjit_to_int(1)
+ - mjit_uminus(1)
+ - mjit_zero?(0)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_kernel.yml b/benchmark/mjit_kernel.yml
new file mode 100644
index 0000000000..7720e65c2c
--- /dev/null
+++ b/benchmark/mjit_kernel.yml
@@ -0,0 +1,20 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_class(obj)
+ obj.class
+ end
+
+ def mjit_frozen?(obj)
+ obj.frozen?
+ end
+
+ str = ""
+ fstr = "".freeze
+
+benchmark:
+ - mjit_class(self)
+ - mjit_class(1)
+ - mjit_frozen?(str)
+ - mjit_frozen?(fstr)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_leave.yml b/benchmark/mjit_leave.yml
new file mode 100644
index 0000000000..9ac68b164b
--- /dev/null
+++ b/benchmark/mjit_leave.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def leave
+ nil
+ end
+benchmark:
+ mjit_leave: leave
+loop_count: 200000000
diff --git a/benchmark/mjit_opt_cc_insns.yml b/benchmark/mjit_opt_cc_insns.yml
new file mode 100644
index 0000000000..fed6d34bd5
--- /dev/null
+++ b/benchmark/mjit_opt_cc_insns.yml
@@ -0,0 +1,27 @@
+# opt_* insns using vm_method_cfunc_is with send-compatible operands:
+# * opt_nil_p
+# * opt_not
+# * opt_eq
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_nil?(obj)
+ obj.nil?
+ end
+
+ def mjit_not(obj)
+ !obj
+ end
+
+ def mjit_eq(a, b)
+ a == b
+ end
+
+benchmark:
+ - script: mjit_nil?(1)
+ loop_count: 40000000
+ - script: mjit_not(1)
+ loop_count: 40000000
+ - script: mjit_eq(1, nil)
+ loop_count: 8000000
+ - script: mjit_eq(nil, 1)
+ loop_count: 8000000
diff --git a/benchmark/mjit_struct_aref.yml b/benchmark/mjit_struct_aref.yml
new file mode 100644
index 0000000000..bfba1323f2
--- /dev/null
+++ b/benchmark/mjit_struct_aref.yml
@@ -0,0 +1,10 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_struct_aref(struct)
+ struct.aa
+ end
+ struct = Struct.new(:a0, :a1, :a2, :a3, :a4, :a5, :a6, :a7, :a8, :a9, :aa).new
+
+benchmark: mjit_struct_aref(struct)
+
+loop_count: 40000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+ class Niller; def nil?; true; end; end
+ xnil, notnil = nil, Object.new
+ niller = Niller.new
+benchmark:
+ - xnil.nil?
+ - notnil.nil?
+ - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..fba67a5f6a
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,6 @@
+benchmark:
+ to_i: |
+ nil.to_i
+ to_f: |
+ nil.to_f
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+ - 0.zero?
+ - 1.zero?
+ - 0r.zero?
+ - 1r.zero?
+ - 0i.zero?
+ - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..433c2268a3
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,13 @@
+prelude: |
+ int = 42
+ flo = 4.2
+benchmark:
+ real?: |
+ int.real?
+ integer?: |
+ flo.integer?
+ finite?: |
+ int.finite?
+ infinite?: |
+ int.infinite?
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..93ff463e41
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,21 @@
+prelude: |
+ class Eight
+ 8.times { include(Module.new) }
+ end
+ class ThirtyTwo
+ 32.times { include(Module.new) }
+ end
+ class SixtyFour
+ 64.times { include(Module.new) }
+ end
+ class OneTwentyEight
+ 128.times { include(Module.new) }
+ end
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ allocate_8_deep: Eight.new
+ allocate_32_deep: ThirtyTwo.new
+ allocate_64_deep: SixtyFour.new
+ allocate_128_deep: OneTwentyEight.new
+loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'objspace'
+ require 'tempfile'
+ $objs = 1_000.times.map { Object.new }
+ $strings = 1_000.times.map { |i| "string #{i}" }
+ $file = Tempfile.new('heap')
+ $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+ dump_all_string: "ObjectSpace.dump_all(output: :string)"
+ dump_all_file: "ObjectSpace.dump_all(output: $file)"
+ dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+ return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+ : Ack($_[0]-1, 1))
+ : $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+ if (not M):
+ return( N + 1 )
+ if (not N):
+ return( Ack(M-1, 1) )
+ return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+ NUM = 9
+ sys.setrecursionlimit(10000)
+ Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+ (cond ((zero? m) (+ n 1))
+ ((zero? n) (ack (- m 1) 1))
+ (else (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+ loop
+ ack
+ fib
+ tak
+ fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+ ruby-cyg
+ ../../../test6/miniruby
+ perl
+ python
+ gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+ .rb
+ .rb
+ .pl
+ .py
+ .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+ m = Benchmark.measure{
+ #p cmd
+ system(cmd)
+ }
+ [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+ r = []
+ Lang.each_with_index{|l, idx|
+ cmd = "#{l} #{b}#{Ext[idx]}"
+ r << bench(cmd)
+ }
+ Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+ print b, "\t"
+ puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+ print b, "\t"
+ puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+ my $n = @_[0];
+ if($n < 2){
+ return 1;
+ }
+ else{
+ return $n * fact($n-1);
+ }
+}
+
+for($i=0; $i<10000; $i++){
+ &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..1ce9f76275
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+ r = 1
+ for x in range(2, n+1):
+ r *= x
+ return r
+
+def factR(n):
+ if n < 2:
+ return 1
+ else:
+ return n * factR(n-1)
+
+for i in range(10000):
+ factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..6cedc752cd
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+ if n < 2
+ 1
+ else
+ n * fact(n-1)
+ end
+end
+
+i = 0
+while i<10000
+ i += 1
+ fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+ (if (< n 2)
+ 1
+ (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+ (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+ my $n = $_[0];
+ if($n < 3){
+ return 1;
+ }
+ else{
+ return fib($n-1) + fib($n-2);
+ }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+ if n < 3:
+ return 1
+ else:
+ return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+ (if (< n 3)
+ 1
+ (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+ pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..b367b9dbf3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30000000
+ i += 1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+ local($x, $y, $z) = @_;
+ if (!($y < $x)) {
+ return $z;
+ } else {
+ return &tak(&tak($x - 1, $y, $z),
+ &tak($y - 1, $z, $x),
+ &tak($z - 1, $x, $y));
+ }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+ if not(y<x):
+ return z
+ else:
+ return tak(tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+ (if (not (< y x))
+ z
+ (tak (tak (- x 1) y z)
+ (tak (- y 1) z x)
+ (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+ def call(*val)
+ case val
+ in [String => body]
+ [200, {}, [body]]
+ in [Integer => status]
+ [status, {}, [""]]
+ in [Integer, String] => response
+ [response[0], {}, [response[1]]]
+ in [Integer, Hash, String] => response
+ [response[0], response[1], [response[2]]]
+ end
+ end
+
+benchmark:
+ first_match: call("ok")
+ second_match: call(401)
+ third_match: call(200, "ok")
+ fourth_match: call(201, {}, "created")
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+ ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+ FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+ ractor_float_to_s: |
+ FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - (1..1_000_000).last(100)
+ - (1..1_000_000).last(1000)
+ - (1..1_000_000).last(10000)
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..90a029d5b9
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,30 @@
+prelude: |
+ f = File
+ pwd = Dir.pwd
+ Dir.mkdir('b') unless f.directory?('b')
+ f.write('b/a', '') unless f.file?('b/a')
+
+ relative = 'b/a'
+ absolute = File.join(pwd, relative)
+ dir = 'b'
+ file = 'a'
+
+ relative_dir = 'b/c'
+ absolute_dir = File.join(pwd, relative_dir)
+ file_dir = 'c'
+benchmark:
+ relative_nil: "f.realpath(relative, nil)"
+ absolute_nil: "f.realpath(absolute, nil)"
+ relative_relative: "f.realpath(file, dir)"
+ absolute_relative: "f.realpath(absolute, dir)"
+ relative_absolute: "f.realpath(relative, pwd)"
+ relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+ absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+ relative_relative_dir: "f.realdirpath(file_dir, dir)"
+ absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+ relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+ relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+ absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+ relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+ absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+ relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ 1.upto(10000) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require_thread: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ i=0
+ t = Thread.new do
+ while true
+ i = i+1 # dummy loop
+ end
+ end
+
+ 1.upto(100) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+ t.kill
+loop_count: 1
diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+ SecureRandom.random_number(100)
+end
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+ # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+ tree[1]
+ else
+ tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+ item_item = 2 * item
+ depth -= 1
+ [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+ [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+ temp_tree = bottom_up_tree(i, depth)
+ check += item_check(temp_tree)
+
+ temp_tree = bottom_up_tree(-i, depth)
+ check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+ i += 1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..99683505f9
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,65 @@
+prelude: |
+ #!/usr/bin/ruby
+
+ wc_input_base = <<EOS
+ Subject: Re: Who was Izchak Miller?
+ From: "Jane D. Anonymous" <nobody@yale.edu>
+ Date: 1996/04/28
+ Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
+ References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+ To: 75176.2330@compuserve.com
+ Content-Type: text/plain; charset=us-ascii
+ Organization: Yale University
+ X-Url: news:4lk6vl$gde@ns.oar.net
+ Mime-Version: 1.0
+ Newsgroups: rec.games.roguelike.nethack
+ X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+ Hello there, Izchak Miller was my father. When I was younger I spent
+ many a night, hunched over the keyboard with a cup of tea, playing
+ nethack with him and my brother. my dad was a philosopher with a strong
+ weakness for fantasy/sci fi. I remember when he started to get involved
+ with the Nethack team- my brother's Dungeons and Dragons monster book
+ found a regular place beside my dad's desk. it's nice to see him living
+ on in the game he loved so much :-).
+ Tamar Miller
+
+ The following is a really long word of 5000 characters:
+
+ wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+ EOS
+
+ # prepare 'wc.input'
+
+ def prepare_wc_input(wcbase)
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ unless FileTest.exist?(wcinput)
+ data = wcbase.dup
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+ end
+
+ prepare_wc_input(wc_input_base)
+
+benchmark:
+ so_count_words: |
+ # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+ # http://www.bagley.org/~doug/shootout/
+ # with help from Paul Brannan
+ input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+ nl = nw = nc = 0
+ while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+ end
+ # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i += 1
+ some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+ maxFlips, m, r, check = 0, n-1, n, 0
+ count = (1..n).to_a
+ perm = (1..n).to_a
+
+ while true
+ if check < 30
+ puts "#{perm}"
+ check += 1
+ end
+
+ while r != 1
+ count[r-1] = r
+ r -= 1
+ end
+
+ if perm[0] != 1 and perm[m] != n
+ perml = perm.clone #.dup
+ flips = 0
+ while (k = perml.first ) != 1
+ perml = perml.slice!(0, k).reverse + perml
+ flips += 1
+ end
+ maxFlips = flips if flips > maxFlips
+ end
+ while true
+ if r==n then return maxFlips end
+ perm.insert r,perm.shift
+ break if (count[r] -= 1) > 0
+ r += 1
+ end
+ end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_k_nucleotide
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(100_000)
+ script: |
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org
+ #
+ # contributed by jose fco. gonzalez
+ # modified by Sokolov Yura
+
+ seq = String.new
+
+ def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+ end
+
+ def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+ end
+
+ def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+ line = input.gets while line !~ /^>THREE/
+ line = input.gets
+
+ while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+ end
+
+ [1,2].each {|i| sort_by_freq( seq,i ) }
+
+ %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+ loop_count: 1
diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+ # create a list of integers (Li1) from 1 to SIZE
+ li1 = (1..SIZE).to_a
+ # copy the list to li2 (not by individual items)
+ li2 = li1.dup
+ # remove each individual item from left side of li2 and
+ # append to right side of li3 (preserving order)
+ li3 = Array.new
+ while (not li2.empty?)
+ li3.push(li2.shift)
+ end
+ # li2 must now be empty
+ # remove each individual item from right side of li3 and
+ # append to right side of li2 (reversing list)
+ while (not li3.empty?)
+ li2.push(li3.pop)
+ end
+ # li3 must now be empty
+ # reverse li1 in place
+ li1.reverse!
+ # check that first item is now SIZE
+ if li1[0] != SIZE then
+ p "not SIZE"
+ 0
+ else
+ # compare li1 and li2 for equality
+ if li1 != li2 then
+ return(0)
+ else
+ # return the length of the list
+ li1.length
+ end
+ end
+end
+
+i = 0
+while i<NUM
+ i += 1
+ result = test_lists()
+end
+
+result
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/so_mandelbrot.rb
@@ -0,0 +1,57 @@
+# The Computer Language Benchmarks Game
+# http://shootout.alioth.debian.org/
+#
+# contributed by Karl von Laudermann
+# modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49 # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1 # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+ for x in 0..count_size
+ zr = 0.0
+ zi = 0.0
+ cr = (2.0*x/size)-1.5
+ ci = (2.0*y/size)-1.0
+ escape = false
+
+ # To make use of the for..in code, we use a dummy variable,
+ # like one would in C
+ for dummy in 0..ITER
+ tr = zr*zr - zi*zi + cr
+ ti = 2*zr*zi + ci
+ zr, zi = tr, ti
+
+ if (zr*zr+zi*zi) > LIMIT_SQUARED
+ escape = true
+ break
+ end
+ end
+
+ byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+ bit_num += 1
+
+ # Code is very similar for these cases, but using separate blocks
+ # ensures we skip the shifting when it's unnecessary, which is most cases.
+ if (bit_num == 8)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ elsif (x == count_size)
+ byte_acc <<= (8 - bit_num)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ end
+ end
+end
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..8c136baa6c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop across the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the current row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # following reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is achieved via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticeable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+ e = 0.0
+ nbodies = bodies.size
+
+ for i in 0 ... nbodies
+ b = bodies[i]
+ e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+ for j in (i + 1) ... nbodies
+ b2 = bodies[j]
+ dx = b.x - b2.x
+ dy = b.y - b2.y
+ dz = b.z - b2.z
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ e -= (b.mass * b2.mass) / distance
+ end
+ end
+ e
+end
+
+def offset_momentum(bodies)
+ px, py, pz = 0.0, 0.0, 0.0
+
+ for b in bodies
+ m = b.mass
+ px += b.vx * m
+ py += b.vy * m
+ pz += b.vz * m
+ end
+
+ b = bodies[0]
+ b.vx = - px / SOLAR_MASS
+ b.vy = - py / SOLAR_MASS
+ b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+ # sun
+ Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+ # jupiter
+ Planet.new(
+ 4.84143144246472090e+00,
+ -1.16032004402742839e+00,
+ -1.03622044471123109e-01,
+ 1.66007664274403694e-03,
+ 7.69901118419740425e-03,
+ -6.90460016972063023e-05,
+ 9.54791938424326609e-04),
+
+ # saturn
+ Planet.new(
+ 8.34336671824457987e+00,
+ 4.12479856412430479e+00,
+ -4.03523417114321381e-01,
+ -2.76742510726862411e-03,
+ 4.99852801234917238e-03,
+ 2.30417297573763929e-05,
+ 2.85885980666130812e-04),
+
+ # uranus
+ Planet.new(
+ 1.28943695621391310e+01,
+ -1.51111514016986312e+01,
+ -2.23307578892655734e-01,
+ 2.96460137564761618e-03,
+ 2.37847173959480950e-03,
+ -2.96589568540237556e-05,
+ 4.36624404335156298e-05),
+
+ # neptune
+ Planet.new(
+ 1.53796971148509165e+01,
+ -2.59193146099879641e+01,
+ 1.79258772950371181e-01,
+ 2.68067772490389322e-03,
+ 1.62824170038242295e-03,
+ -9.51592254519715870e-05,
+ 5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+ i = 0
+ while i < nbodies
+ b = BODIES[i]
+ b.move_from_i(BODIES, nbodies, dt, i + 1)
+ i += 1
+ end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ x += 1
+ end
+ end
+ end
+ end
+ end
+end
+# puts x
+
+
diff --git a/benchmark/so_nsieve.rb b/benchmark/so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+ flags = Flags.dup[0,m]
+ count = 0
+ pmax = m - 1
+ p = 2
+ while p <= pmax
+ unless flags[p].zero?
+ count += 1
+ mult = p
+ while mult <= pmax
+ flags[mult] = 0
+ mult += p
+ end
+ end
+ p += 1
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+ break if exponent < 0
+ m = (1 << exponent) * 10_000
+ # m = (2 ** exponent) * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+ items = "\xFF" * ((m / BitsPerChar) + 1)
+ masks = ""
+ BitsPerChar.times do |b|
+ masks << (1 << b).chr
+ end
+
+ count = 0
+ pmax = m - 1
+ 2.step(pmax, 1) do |p|
+ if items[p >> CharExponent][p & LowMask] == 1
+ count += 1
+ p.step(pmax, p) do |mult|
+ a = mult >> CharExponent
+ b = mult & LowMask
+ items[a] -= masks[b] if items[a][b] != 0
+ end
+ end
+ end
+ count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+ break if exponent < 0
+ m = 2 ** exponent * 10_000
+ count = sieve(m)
+ printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+ def initialize(start_state)
+ @bool = start_state
+ end
+
+ def value
+ @bool
+ end
+
+ def activate
+ @bool = !@bool
+ self
+ end
+end
+
+class NthToggle < Toggle
+ def initialize(start_state, max_counter)
+ super start_state
+ @count_max = max_counter
+ @counter = 0
+ end
+
+ def activate
+ @counter += 1
+ if @counter >= @count_max
+ @bool = !@bool
+ @counter = 0
+ end
+ self
+ end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+ toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+ ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/so_partial_sums.rb b/benchmark/so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+ d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+ s0 += (2.0 / 3.0) ** (d - 1.0)
+ s1 += 1.0 / Math.sqrt(d)
+ s2 += 1.0 / (d * (d + 1.0))
+ s3 += 1.0 / (d3 * ds * ds)
+ s4 += 1.0 / (d3 * dc * dc)
+ s5 += 1.0 / d
+ s6 += 1.0 / d2
+ s7 += alt / d
+ s8 += alt / (2.0 * d - 1.0)
+
+ alt = -alt
+end
+
+if false
+ printf("%.9f\t(2/3)^k\n", s0)
+ printf("%.9f\tk^-0.5\n", s1)
+ printf("%.9f\t1/k(k+1)\n", s2)
+ printf("%.9f\tFlint Hills\n", s3)
+ printf("%.9f\tCookson Hills\n", s4)
+ printf("%.9f\tHarmonic\n", s5)
+ printf("%.9f\tRiemann Zeta\n", s6)
+ printf("%.9f\tAlternating Harmonic\n", s7)
+ printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+ def initialize()
+ @z = Transformation.new 1,0,0,1
+ @x = Transformation.new 0,0,0,0
+ @inverse = Transformation.new 0,0,0,0
+ end
+
+ def next!
+ @y = @z.extract(3)
+ if safe? @y
+ @z = produce(@y)
+ @y
+ else
+ @z = consume @x.next!()
+ next!()
+ end
+ end
+
+ def safe?(digit)
+ digit == @z.extract(4)
+ end
+
+ def produce(i)
+ @inverse.qrst(10,-10*i,0,1).compose(@z)
+ end
+
+ def consume(a)
+ @z.compose(a)
+ end
+end
+
+
+class Transformation
+ attr_reader :q, :r, :s, :t
+ def initialize(q, r, s, t)
+ @q,@r,@s,@t,@k = q,r,s,t,0
+ end
+
+ def next!()
+ @q = @k = @k + 1
+ @r = 4 * @k + 2
+ @s = 0
+ @t = 2 * @k + 1
+ self
+ end
+
+ def extract(j)
+ (@q * j + @r) / (@s * j + @t)
+ end
+
+ def compose(a)
+ self.class.new( @q * a.q,
+ @q * a.r + r * a.t,
+ @s * a.q + t * a.s,
+ @s * a.r + t * a.t
+ )
+ end
+
+ def qrst *args
+ initialize *args
+ self
+ end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+ if n >= WIDTH
+ WIDTH.times {print digits.next!}
+ j += WIDTH
+ else
+ n.times {print digits.next!}
+ (WIDTH-n).times {print " "}
+ j += n
+ end
+ puts "\t:"+j.to_s
+ n -= WIDTH
+end
+
diff --git a/benchmark/so_random.rb b/benchmark/so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+ (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+ i +=1
+ gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_reverse_complement
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(2_500_000)
+ script: |
+ # The Great Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ #
+ # Contributed by Peter Bjarke Olsen
+ # Modified by Doug King
+
+ seq=Array.new
+
+ def revcomp(seq)
+ seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+ stringlen=seq.length
+ 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+ while input.gets
+ if $_ =~ />/
+ if seq.length != 0
+ revcomp(seq.join)
+ seq=Array.new
+ end
+ puts $_
+ else
+ $_.sub(/\n/,'')
+ seq.push $_
+ end
+ end
+ revcomp(seq.join)
+ loop_count: 1
diff --git a/benchmark/so_sieve.rb b/benchmark/so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+ k += 1
+ count = 0
+ flags = flags0.dup
+ i = 2
+ while i<8192
+ i += 1
+ if flags[i]
+ # remove all multiples of prime: i
+ j = i*i
+ while j < 8192
+ j += i
+ flags[j] = nil
+ end
+ count += 1
+ end
+ end
+end
+count
diff --git a/benchmark/so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+ return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+ v, i = nil, nil
+ (0..u.length-1).collect { |i|
+ v = 0
+ for j in 0..u.length-1
+ v += eval_A(i,j)*u[j]
+ end
+ v
+ }
+end
+
+def eval_At_times_u(u)
+ v, i = nil, nil
+ (0..u.length-1).collect{|i|
+ v = 0
+ for j in 0..u.length-1
+ v += eval_A(j,i)*u[j]
+ end
+ v
+ }
+end
+
+def eval_AtA_times_u(u)
+ return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+ v=eval_AtA_times_u(u)
+ u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+ vBv += u[i]*v[i]
+ vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+ str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ capitalize-1: str1.capitalize
+ capitalize-10: str10.capitalize
+ capitalize-100: str100.capitalize
+ capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..2354040a04
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp-1: lstr1.casecmp(ustr1)
+ casecmp-10: lstr10.casecmp(ustr10)
+ casecmp-100: lstr100.casecmp(ustr100)
+ casecmp-1000: lstr1000.casecmp(ustr1000)
+ casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+ casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+ casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+ casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp_p-1: lstr1.casecmp?(ustr1)
+ casecmp_p-10: lstr10.casecmp?(ustr10)
+ casecmp_p-100: lstr100.casecmp?(ustr100)
+ casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+ casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+ casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+ casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+ casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"A".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ downcase-1: str1.upcase
+ downcase-10: str10.upcase
+ downcase-100: str100.upcase
+ downcase-1000: str1000.upcase
+ downcase-nonascii1: nonascii1.downcase
+ downcase-nonascii10: nonascii10.downcase
+ downcase-nonascii100: nonascii100.downcase
+ downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "あ" * 1024 + "い" # not single byte optimizable
+str2 = "い"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+ long_string = "x"*1000+"-hår"
+benchmark:
+ regexp-short: |
+ "x-hår".slice!(/-(.)(.)(.)/, 3)
+ regexp-long: |
+ long_string.dup.slice!(/-(.)(.)(.)/, 3)
+ string-short: |
+ "x-hår".slice!("r")
+ string-long: |
+ long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+ str1 = [*0..5].join(" ") + " "
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ to_chars-1: str1.split('')
+ to_chars-10: str10.split('')
+ to_chars-100: str100.split('')
+ to_chars-1000: str1000.split('')
+ to_words-1: str1.split(' ')
+ to_words-10: str10.split(' ')
+ to_words-100: str100.split(' ')
+ to_words-1000: str1000.split(' ')
+ re_chars-1: str1.split(//)
+ re_chars-10: str10.split(//)
+ re_chars-100: str100.split(//)
+ re_chars-1000: str1000.split(//)
+ re_space-1: str1.split(/ /)
+ re_space-10: str10.split(/ /)
+ re_space-100: str100.split(/ /)
+ re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ swapcase-1: str1.swapcase
+ swapcase-10: str10.swapcase
+ swapcase-100: str100.swapcase
+ swapcase-1000: str1000.swapcase
+ swapcase-nonascii1: nonascii1.swapcase
+ swapcase-nonascii10: nonascii10.swapcase
+ swapcase-nonascii100: nonascii100.swapcase
+ swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"a".."z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ upcase-1: str1.upcase
+ upcase-10: str10.upcase
+ upcase-100: str100.upcase
+ upcase-1000: str1000.upcase
+ upcase-nonascii1: nonascii1.upcase
+ upcase-nonascii10: nonascii10.upcase
+ upcase-nonascii100: nonascii100.upcase
+ upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ - 'Time.at(0)'
+ - 'Time.at(0, 500)'
+ - 'Time.at(0, in: "+09:00")'
+ - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - 'Time.new(2021)'
+ - 'Time.new(2021, 8, 22)'
+ - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..a6d6948b9c
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,8 @@
+prelude: |
+ require 'time'
+ inspect = "2021-08-23 09:57:02 +0900"
+ iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+ - Time.iso8601(iso8601)
+ - Time.parse(iso8601)
+ - Time.parse(inspect)
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'time'
+benchmark:
+ - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+ - Time.strptime("1", "%s")
+ - Time.strptime("0 +0100", "%s %z")
+ - Time.strptime("0 UTC", "%s %z")
+ - Time.strptime("1.5", "%s.%N")
+ - Time.strptime("1.000000000001", "%s.%N")
+ - Time.strptime("20010203 -0200", "%Y%m%d %z")
+ - Time.strptime("20010203 UTC", "%Y%m%d %z")
+ - Time.strptime("2018-365", "%Y-%j")
+ - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_array: |
+ a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ attr_reader :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+ end
+ obj = C.new
+benchmark:
+ vm_attr_ivar: |
+ j = obj.a
+ k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ attr_accessor :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+ end
+ obj = C.new
+benchmark:
+ vm_attr_ivar_set: |
+ obj.a = 1
+ obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_backtrace.rb b/benchmark/vm_backtrace.rb
new file mode 100644
index 0000000000..0fbf73e1ca
--- /dev/null
+++ b/benchmark/vm_backtrace.rb
@@ -0,0 +1,22 @@
+# get last backtrace
+
+begin
+ caller(0, 0)
+rescue ArgumentError
+ alias caller_orig caller
+ def caller lev, n
+ caller_orig(lev)[0..n]
+ end
+end
+
+def rec n
+ if n < 0
+ 100_000.times{
+ caller(0, 1)
+ }
+ else
+ rec(n-1)
+ end
+end
+
+rec 50
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+ vm_bigarray: |
+ a = [
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_bighash: |
+ a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+ def m
+ yield
+ end
+benchmark:
+ vm_block: |
+ m{
+ }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+ p = proc{_1}
+ o = Object.new
+ def o.each
+ i = 0
+ while i < 3_000_000 do
+ yield i
+ i += 1
+ end
+ end
+
+benchmark:
+ - name: block_handler_type_iseq
+ script: |
+ o.each{_1}
+
+ - name: block_handler_type_symbol
+ script: |
+ o.each(&:itself)
+
+ - name: block_handler_type_proc
+ script: |
+ o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m &b
+ end
+benchmark:
+ vm_blockparam: |
+ m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m &b
+ b.call
+ end
+benchmark:
+ vm_blockparam_call: |
+ m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+ def bp_yield
+ yield
+ end
+
+ def bp_pass &b
+ bp_yield &b
+ end
+benchmark:
+ vm_blockparam_pass: |
+ bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def bp_yield &b
+ yield
+ end
+benchmark:
+ vm_blockparam_yield: |
+ bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+ vm_case: |
+ case :foo
+ when :bar
+ raise
+ when :baz
+ raise
+ when :boo
+ raise
+ when :foo
+ # noop
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+ vm_case_classes: |
+ case :foo
+ when Hash
+ raise
+ when Array
+ raise
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_case_lit: |
+ i = 0
+ @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+ def foo(i)
+ @ret[i % @ret.size]
+ end
+
+ while i<6_000_000
+ case foo(i)
+ when "foo" then :foo
+ when true then true
+ when false then false
+ when :sym then :sym
+ when 6 then :fix
+ when nil then nil
+ when 0.1 then :float
+ when 0xffffffffffffffff then :big
+ end
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
new file mode 100644
index 0000000000..9661323cd2
--- /dev/null
+++ b/benchmark/vm_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<200_000
+ i += 1
+
+ Class.new{
+ def m; end
+ }
+end
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..6064d4eed0
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,7 @@
+prelude: |
+ Const = 1
+benchmark:
+ vm_const: |
+ j = Const
+ k = Const
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class A
+ @@foo = 1
+
+ def self.foo
+ @@foo
+ end
+
+ ("A".."Z").each do |module_name|
+ eval <<-EOM
+ module #{module_name}
+ end
+
+ include #{module_name}
+ EOM
+ end
+ end
+benchmark:
+ vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+ class Object
+ define_method(:m){}
+ end
+benchmark:
+ vm_defined_method: |
+ m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+ x = y = 'z'
+benchmark:
+ vm_dstr: |
+ str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb
new file mode 100644
index 0000000000..1d3aa3b97b
--- /dev/null
+++ b/benchmark/vm_dstr_ary.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = []
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb
new file mode 100644
index 0000000000..631ca54755
--- /dev/null
+++ b/benchmark/vm_dstr_bool.rb
@@ -0,0 +1,7 @@
+i = 0
+x = true
+y = false
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb
new file mode 100644
index 0000000000..ed380d7595
--- /dev/null
+++ b/benchmark/vm_dstr_int.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{i}bar#{i}baz"
+end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb
new file mode 100644
index 0000000000..45fc107892
--- /dev/null
+++ b/benchmark/vm_dstr_str.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = ""
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb
new file mode 100644
index 0000000000..484b8f8150
--- /dev/null
+++ b/benchmark/vm_dstr_sym.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = :z
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+ vm_ensure: |
+ i = 0
+ while i<30_000_000
+ i += 1
+ begin
+ begin
+ ensure
+ end
+ ensure
+ end
+ end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_eval: |
+ eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ vm_fiber_allocate: |
+ fiber = Fiber.new{Fiber.yield}
+ fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+ fibers = []
+benchmark:
+ vm_fiber_count: |
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+ GC.disable
+ fibers = []
+benchmark:
+ vm_fiber_reuse: |
+ 1024.times do
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+ end
+
+ fibers.clear
+ GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+ fibers = []
+benchmark:
+ vm_fiber_reuse_gc: |
+ 2000.times do
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+ end
+ fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+ # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+ fib = Fiber.new do
+ loop { Fiber.yield }
+ end
+benchmark:
+ vm_fiber_switch: |
+ fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+ f = 0.0
+benchmark:
+ vm_float_simple: |
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+ class String
+ def freeze
+ -self
+ end
+ end
+benchmark:
+ vm_freezestring: |
+ "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/vm_gc.rb b/benchmark/vm_gc.rb
new file mode 100644
index 0000000000..e668026915
--- /dev/null
+++ b/benchmark/vm_gc.rb
@@ -0,0 +1,6 @@
+5000.times do
+ 100.times do
+ {"xxxx"=>"yyyy"}
+ end
+ GC.start
+end
diff --git a/benchmark/vm_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
new file mode 100644
index 0000000000..cfdfc8c5a5
--- /dev/null
+++ b/benchmark/vm_gc_old_full.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+100.times do
+ GC.start
+end
diff --git a/benchmark/vm_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
new file mode 100644
index 0000000000..ad22feb655
--- /dev/null
+++ b/benchmark/vm_gc_old_immediate.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+ GC.start(full_mark: false, immediate_sweep: true)
+end
diff --git a/benchmark/vm_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
new file mode 100644
index 0000000000..b74d44baf1
--- /dev/null
+++ b/benchmark/vm_gc_old_lazy.rb
@@ -0,0 +1,4 @@
+old_object = Array.new(1_000_000){''}
+30_000.times do
+ GC.start(full_mark: false, immediate_sweep: false)
+end
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+ vm_gc_short_lived: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+ def nested_hash h, n
+ if n == 0
+ ''
+ else
+ 10.times{
+ h[Object.new] = nested_hash(h, n-1)
+ }
+ end
+ end
+
+ long_lived = Hash.new
+ nested_hash long_lived, 6
+
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_complex_long: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+ long_lived = Array.new(1_000_000){|i| "#{i}"}
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_long: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+ 50_000.times{|i| sym = "sym#{i}".to_sym}
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_symbol: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+ short_lived_ary = []
+
+ if RUBY_VERSION >= "2.2.0"
+ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_ary: |
+ short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+ long_lived = []
+
+ if RUBY_VERSION > "2.2.0"
+ 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+ elsif
+ GC.start
+ end
+
+ short_lived = ''
+
+benchmark:
+ vm_gc_wb_ary_promoted: |
+ long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+ class C
+ attr_accessor :foo
+ end
+ short_lived_obj = C.new
+
+ if RUBY_VERSION >= "2.2.0"
+ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_obj: |
+ short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C
+ attr_accessor :foo
+ end
+ long_lived = C.new
+
+ if RUBY_VERSION >= "2.2.0"
+ 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+ elsif
+ GC.start
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_obj_promoted: |
+ long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class C
+ def m
+ 1
+ end
+
+ ("A".."M").each do |module_name|
+ eval <<-EOM
+ module #{module_name}
+ def m; super; end
+ end
+ prepend #{module_name}
+ EOM
+ end
+ end
+
+ obj = C.new
+benchmark:
+ vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+ vm_ivar: |
+ j = @a
+ k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_init.yml b/benchmark/vm_ivar_init.yml
new file mode 100644
index 0000000000..c6f1633907
--- /dev/null
+++ b/benchmark/vm_ivar_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ def initialize
+ @a = nil
+ @b = nil
+ @c = nil
+ @d = nil
+ @e = nil
+ end
+ end
+benchmark:
+ vm_ivar_init: |
+ C.new
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class C
+ @a = 1
+ def self.a
+ _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+ _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+ end
+ end
+benchmark:
+ vm_ivar_of_class: |
+ a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+ class C
+ @a = 1
+ def self.a o
+ @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+ end
+ end
+benchmark:
+ vm_ivar_of_class_set: |
+ a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+ vm_ivar_set: |
+ @a = 1
+ @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..2653d36ded
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class A
+ def initialize
+ @a = nil
+ @b = nil
+ @c = nil
+ @d = nil
+ @e = nil
+ end
+ end
+ class B < A; end
+ class C < A; end
+benchmark:
+ vm_ivar_init_subclass: |
+ B.new
+ C.new
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+ a = 'abc'
+ b = [1, 2, 3]
+benchmark:
+ vm_length: |
+ a.length
+ b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+ vm_lvar_init: |
+ def m v
+ unless v
+ # unreachable code
+ v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+ v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+ v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+ v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+ v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+ end
+ end
+
+ i = 0
+
+ while i<30_000_000
+ i += 1
+ m i
+ end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_lvar_set: |
+ a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m
+ nil
+ end
+benchmark:
+ vm_method: |
+ m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+ class C
+ def method_missing mid
+ end
+ end
+
+ obj = C.new
+benchmark:
+ vm_method_missing: |
+ obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m
+ nil
+ end
+benchmark:
+ vm_method_with_block: |
+ m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_module_ann_const_set: |
+ Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+ module M
+ end
+ $VERBOSE = nil
+benchmark:
+ vm_module_const_set: |
+ M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+ require 'thread'
+
+ m = Thread::Mutex.new
+benchmark:
+ vm_mutex: |
+ m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+ obj1 = Object.new
+ obj2 = Object.new
+benchmark:
+ vm_neq: |
+ obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_newlambda: |
+ lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+benchmark:
+ vm_not: |
+ !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_method: |
+ class C1
+ def m
+ 1
+ end
+ end
+ class C2
+ def m
+ 2
+ end
+ end
+
+ o1 = C1.new
+ o2 = C2.new
+
+ i = 0
+ while i<6_000_000
+ o = (i % 2 == 0) ? o1 : o2
+ o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_method_ov: |
+ class C1
+ def m
+ 1
+ end
+ end
+ class C2
+ def m
+ 2
+ end
+ end
+
+ o1 = C1.new
+ o2 = C2.new
+
+ i = 0
+ while i<6_000_000
+ o = (i % 2 == 0) ? o1 : o2
+ # o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+ module AR; end
+ class AR::Base
+ def create_or_update
+ nil
+ end
+ def save
+ create_or_update
+ end
+ end
+ class Foo < AR::Base; end
+ class Bar < AR::Base; end
+ o1 = Foo.new
+ o2 = Bar.new
+benchmark:
+ vm_poly_same_method: |
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml
@@ -0,0 +1,18 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_singleton: |
+ class C1
+ def m; 1; end
+ end
+
+ o1 = C1.new
+ o2 = C1.new
+ o2.singleton_class
+
+ i = 0
+ while i<6_000_000 # benchmark loop 2
+ o = (i % 2 == 0) ? o1 : o2
+ o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml
new file mode 100644
index 0000000000..2f8de6c272
--- /dev/null
+++ b/benchmark/vm_proc.yml
@@ -0,0 +1,12 @@
+prelude: |
+ def m &b
+ b
+ end
+
+ pr = m{
+ a = 1
+ }
+benchmark:
+ vm_proc: |
+ pr.call
+loop_count: 6000000
diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml
new file mode 100644
index 0000000000..247d9f70ee
--- /dev/null
+++ b/benchmark/vm_raise1.yml
@@ -0,0 +1,16 @@
+prelude: |
+ def rec n
+ if n > 0
+ rec n-1
+ else
+ raise
+ end
+ end
+benchmark:
+ vm_raise1: |
+ begin
+ rec 1
+ rescue
+ # ignore
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml
new file mode 100644
index 0000000000..f0fa047b3c
--- /dev/null
+++ b/benchmark/vm_raise2.yml
@@ -0,0 +1,16 @@
+prelude: |
+ def rec n
+ if n > 0
+ rec n-1
+ else
+ raise
+ end
+ end
+benchmark:
+ vm_raise2: |
+ begin
+ rec 10
+ rescue
+ # ignore
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml
new file mode 100644
index 0000000000..2aa3d94dbd
--- /dev/null
+++ b/benchmark/vm_regexp.yml
@@ -0,0 +1,8 @@
+prelude: |
+ str = 'xxxhogexxx'
+benchmark:
+ vm_regexp: |
+ /hoge/ =~ str
+ vm_regexp_invert: |
+ str =~ /hoge/
+loop_count: 6000000
diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml
new file mode 100644
index 0000000000..b4a0af521f
--- /dev/null
+++ b/benchmark/vm_rescue.yml
@@ -0,0 +1,6 @@
+benchmark:
+ vm_rescue: |
+ begin
+ rescue
+ end
+loop_count: 30000000
diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml
new file mode 100644
index 0000000000..f31bc7ac89
--- /dev/null
+++ b/benchmark/vm_send.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ def m
+ end
+ end
+
+ o = C.new
+ m = :m
+benchmark:
+ vm_send: |
+ o.__send__ :m
+ vm_send_var: |
+ o.__send__ m
+loop_count: 6000000
diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml
new file mode 100644
index 0000000000..b114ac317d
--- /dev/null
+++ b/benchmark/vm_send_cfunc.yml
@@ -0,0 +1,3 @@
+benchmark:
+ vm_send_cfunc: self.class
+loop_count: 100000000
diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml
new file mode 100644
index 0000000000..c9829cff0b
--- /dev/null
+++ b/benchmark/vm_simplereturn.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m
+ return 1
+ end
+benchmark:
+ vm_simplereturn: m
+loop_count: 30000000
diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml
new file mode 100644
index 0000000000..64439c7980
--- /dev/null
+++ b/benchmark/vm_string_literal.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_string_literal: |
+ x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml
new file mode 100644
index 0000000000..4cf78970cb
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_aref_hi: |
+ x.z # x[25]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml
new file mode 100644
index 0000000000..c91af27fa5
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_aref_lo: |
+ x.k # x[10]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml
new file mode 100644
index 0000000000..69550d14ea
--- /dev/null
+++ b/benchmark/vm_struct_big_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_struct_big_aset: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+ i = 0
+ while i<6_000_000
+ i += 1
+ x.k = i # x[10] = i
+ end
+loop_count: 1
diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml
new file mode 100644
index 0000000000..09b764dd13
--- /dev/null
+++ b/benchmark/vm_struct_big_href_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_href_hi: |
+ x[:z]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml
new file mode 100644
index 0000000000..d2f00b220f
--- /dev/null
+++ b/benchmark/vm_struct_big_href_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+benchmark:
+ vm_struct_big_href_lo: |
+ x[:k]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml
new file mode 100644
index 0000000000..fc45cbee9c
--- /dev/null
+++ b/benchmark/vm_struct_big_hset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_struct_big_hset: |
+ s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+ x = s.new
+ i = 0
+ while i<6_000_000
+ i += 1
+ x[:k] = i
+ end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml
new file mode 100644
index 0000000000..5a83251d1e
--- /dev/null
+++ b/benchmark/vm_struct_small_aref.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+benchmark:
+ vm_struct_small_aref: |
+ x.a
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml
new file mode 100644
index 0000000000..74f435f126
--- /dev/null
+++ b/benchmark/vm_struct_small_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_struct_small_aset: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+ i = 0
+ while i<6_000_000
+ i += 1
+ x.a = i
+ end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml
new file mode 100644
index 0000000000..6b7d7f39e7
--- /dev/null
+++ b/benchmark/vm_struct_small_href.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+benchmark:
+ vm_struct_small_href: |
+ x[:a]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml
new file mode 100644
index 0000000000..5d43b150de
--- /dev/null
+++ b/benchmark/vm_struct_small_hset.yml
@@ -0,0 +1,7 @@
+prelude: |
+ s = Struct.new(:a, :b, :c)
+ x = s.new
+benchmark:
+ vm_struct_small_hset: |
+ x[:a] = 1
+loop_count: 6000000
diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml
new file mode 100644
index 0000000000..0d1e965c6e
--- /dev/null
+++ b/benchmark/vm_super.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C
+ def m
+ 1
+ end
+ end
+
+ class CC < C
+ def m
+ super()
+ end
+ end
+
+ obj = CC.new
+benchmark:
+ vm_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml
new file mode 100644
index 0000000000..e824a65e0a
--- /dev/null
+++ b/benchmark/vm_swap.yml
@@ -0,0 +1,7 @@
+prelude: |
+ a = 1
+ b = 2
+benchmark:
+ vm_swap: |
+ a, b = b, a
+loop_count: 30000000
diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb
new file mode 100644
index 0000000000..1d433353e1
--- /dev/null
+++ b/benchmark/vm_symbol_block_pass.rb
@@ -0,0 +1,13 @@
+class C
+ 1000.times {|i|
+ eval("def i#{i};end")
+ }
+end
+
+c = C.new
+m = C.instance_methods(false)
+5_000.times do
+ m.each do |n|
+ c.tap(&n)
+ end
+end
diff --git a/benchmark/vm_thread_alive_check.yml b/benchmark/vm_thread_alive_check.yml
new file mode 100644
index 0000000000..d21737d3e8
--- /dev/null
+++ b/benchmark/vm_thread_alive_check.yml
@@ -0,0 +1,8 @@
+benchmark:
+ vm_thread_alive_check: |
+ t = Thread.new{}
+ while t.alive?
+ Thread.pass
+ end
+loop_count: 50_000
+
diff --git a/benchmark/vm_thread_close.rb b/benchmark/vm_thread_close.rb
new file mode 100644
index 0000000000..3e9a265ce8
--- /dev/null
+++ b/benchmark/vm_thread_close.rb
@@ -0,0 +1,6 @@
+1000.times { Thread.new { sleep } }
+i = 0
+while i<100_000 # benchmark loop 3
+ i += 1
+ IO.pipe.each(&:close)
+end
diff --git a/benchmark/vm_thread_condvar1.rb b/benchmark/vm_thread_condvar1.rb
new file mode 100644
index 0000000000..feed27c3ad
--- /dev/null
+++ b/benchmark/vm_thread_condvar1.rb
@@ -0,0 +1,28 @@
+# two threads, two mutex, two condvar ping-pong
+require 'thread'
+m1 = Thread::Mutex.new
+m2 = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 100000
+i = 0
+wait = nil
+m2.synchronize do
+ wait = Thread.new do
+ m1.synchronize do
+ m2.synchronize { cv2.signal }
+ while (i += 1) < max
+ cv1.wait(m1)
+ cv2.signal
+ end
+ end
+ end
+ cv2.wait(m2)
+end
+m1.synchronize do
+ while i < max
+ cv1.signal
+ cv2.wait(m1)
+ end
+end
+wait.join
diff --git a/benchmark/vm_thread_condvar2.rb b/benchmark/vm_thread_condvar2.rb
new file mode 100644
index 0000000000..6590c4134b
--- /dev/null
+++ b/benchmark/vm_thread_condvar2.rb
@@ -0,0 +1,35 @@
+# many threads, one mutex, many condvars
+require 'thread'
+m = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 1000
+n = 100
+waiting = 0
+scvs = []
+waiters = n.times.map do |i|
+ start_cv = Thread::ConditionVariable.new
+ scvs << start_cv
+ start_mtx = Thread::Mutex.new
+ start_mtx.synchronize do
+ th = Thread.new(start_mtx, start_cv) do |sm, scv|
+ m.synchronize do
+ sm.synchronize { scv.signal }
+ max.times do
+ cv2.signal if (waiting += 1) == n
+ cv1.wait(m)
+ end
+ end
+ end
+ start_cv.wait(start_mtx)
+ th
+ end
+end
+m.synchronize do
+ max.times do
+ cv2.wait(m) until waiting == n
+ waiting = 0
+ cv1.broadcast
+ end
+end
+waiters.each(&:join)
diff --git a/benchmark/vm_thread_create_join.rb b/benchmark/vm_thread_create_join.rb
new file mode 100644
index 0000000000..393cd45df9
--- /dev/null
+++ b/benchmark/vm_thread_create_join.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<100_000 # benchmark loop 3
+ i += 1
+ Thread.new{
+ }.join
+end
diff --git a/benchmark/vm_thread_mutex1.rb b/benchmark/vm_thread_mutex1.rb
new file mode 100644
index 0000000000..66e42c85e1
--- /dev/null
+++ b/benchmark/vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+ Thread.new{
+ i = 0
+ while i<lmax
+ i += 1
+ m.synchronize{
+ r += 1
+ }
+ end
+ }
+}.each{|e|
+ e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_mutex2.rb b/benchmark/vm_thread_mutex2.rb
new file mode 100644
index 0000000000..6e6c804c31
--- /dev/null
+++ b/benchmark/vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+ Thread.new{
+ i = 0
+ while i<lmax
+ i += 1
+ m.synchronize{
+ r += 1
+ }
+ end
+ }
+}.each{|e|
+ e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_mutex3.rb b/benchmark/vm_thread_mutex3.rb
new file mode 100644
index 0000000000..c750dc542a
--- /dev/null
+++ b/benchmark/vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Thread::Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+ Thread.new{
+ i = 0
+ while i<max
+ i += 1
+ m.synchronize{
+ r += 1
+ }
+ end
+ }
+}.each{|e|
+ e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/vm_thread_pass.rb b/benchmark/vm_thread_pass.rb
new file mode 100644
index 0000000000..438bd08d45
--- /dev/null
+++ b/benchmark/vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 8).to_i
+lmax = 400_000 / tmax
+
+(1..tmax).map{
+ Thread.new{
+ lmax.times{
+ Thread.pass
+ }
+ }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/vm_thread_pass_flood.rb b/benchmark/vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..65df8e6154
--- /dev/null
+++ b/benchmark/vm_thread_pass_flood.rb
@@ -0,0 +1,10 @@
+# n.b. this is a good test for GVL when pinned to a single CPU
+
+5_000.times{
+ Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10_000
+ i += 1
+end
diff --git a/benchmark/vm_thread_pipe.rb b/benchmark/vm_thread_pipe.rb
new file mode 100644
index 0000000000..112a621905
--- /dev/null
+++ b/benchmark/vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Measure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+ lmax.times{
+ w.write('a')
+ }
+ p "w:exit"
+}, Thread.new{
+ lmax.times{
+ r.read(1)
+ }
+ p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/vm_thread_queue.rb b/benchmark/vm_thread_queue.rb
new file mode 100644
index 0000000000..1dd3696a3c
--- /dev/null
+++ b/benchmark/vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 10_000_000
+q = Thread::Queue.new
+consumer = Thread.new{
+ while q.pop
+ # consuming
+ end
+}
+
+producer = Thread.new{
+ n.times{
+ q.push true
+ }
+ q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue.rb b/benchmark/vm_thread_sized_queue.rb
new file mode 100644
index 0000000000..7b9af5482b
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue.rb
@@ -0,0 +1,20 @@
+require 'thread'
+# on producer, one consumer
+
+n = 1_000_000
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new{
+ while q.pop
+ # consuming
+ end
+}
+
+producer = Thread.new{
+ while n > 0
+ q.push true
+ n -= 1
+ end
+ q.push nil
+}
+
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue2.rb b/benchmark/vm_thread_sized_queue2.rb
new file mode 100644
index 0000000000..de9f55e978
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue2.rb
@@ -0,0 +1,23 @@
+require 'thread'
+# one producer, many consumers
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = m.times.map do
+ Thread.new do
+ while q.pop
+ # consuming
+ end
+ end
+end
+
+producer = Thread.new do
+ while n > 0
+ q.push true
+ n -= 1
+ end
+ m.times { q.push nil }
+end
+
+producer.join
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sized_queue3.rb b/benchmark/vm_thread_sized_queue3.rb
new file mode 100644
index 0000000000..ce5f1796d8
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue3.rb
@@ -0,0 +1,22 @@
+require 'thread'
+# many producers, one consumer
+n = 1_000_000
+m = 10
+q = Thread::SizedQueue.new(100)
+consumer = Thread.new do
+ while q.pop
+ # consuming
+ end
+end
+
+producers = m.times.map do
+ Thread.new do
+ while n > 0
+ q.push true
+ n -= 1
+ end
+ end
+end
+producers.each(&:join)
+q.push nil
+consumer.join
diff --git a/benchmark/vm_thread_sized_queue4.rb b/benchmark/vm_thread_sized_queue4.rb
new file mode 100644
index 0000000000..a9b7d80ec0
--- /dev/null
+++ b/benchmark/vm_thread_sized_queue4.rb
@@ -0,0 +1,26 @@
+require 'thread'
+# many producers, many consumers
+nr = 1_000_000
+n = 10
+m = 10
+q = Thread::SizedQueue.new(100)
+consumers = n.times.map do
+ Thread.new do
+ while q.pop
+ # consuming
+ end
+ end
+end
+
+producers = m.times.map do
+ Thread.new do
+ while nr > 0
+ q.push true
+ nr -= 1
+ end
+ end
+end
+
+producers.each(&:join)
+n.times { q.push nil }
+consumers.each(&:join)
diff --git a/benchmark/vm_thread_sleep.yml b/benchmark/vm_thread_sleep.yml
new file mode 100644
index 0000000000..96901d8466
--- /dev/null
+++ b/benchmark/vm_thread_sleep.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_thread_sleep: |
+ Thread.new { sleep }
+loop_count: 10_000
diff --git a/benchmark/vm_unif1.yml b/benchmark/vm_unif1.yml
new file mode 100644
index 0000000000..04187bb0e2
--- /dev/null
+++ b/benchmark/vm_unif1.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m a, b
+ end
+benchmark:
+ vm_unif1: |
+ m 100, 200
+loop_count: 6000000
diff --git a/benchmark/vm_yield.yml b/benchmark/vm_yield.yml
new file mode 100644
index 0000000000..230be3d84f
--- /dev/null
+++ b/benchmark/vm_yield.yml
@@ -0,0 +1,13 @@
+# while loop cost is not removed due to benchmark_driver.gem's limitation
+benchmark:
+ vm_yield: |
+ def m
+ i = 0
+ while i<30_000_000
+ i += 1
+ yield
+ end
+ end
+
+ m{}
+loop_count: 1
diff --git a/benchmark/vm_zsuper.yml b/benchmark/vm_zsuper.yml
new file mode 100644
index 0000000000..bfb5837578
--- /dev/null
+++ b/benchmark/vm_zsuper.yml
@@ -0,0 +1,18 @@
+prelude: |
+ class C
+ def m a
+ 1
+ end
+ end
+
+ class CC < C
+ def m a
+ super
+ end
+ end
+
+ obj = CC.new
+benchmark:
+ vm_zsuper: |
+ obj.m 10
+loop_count: 6000000