diff options
Diffstat (limited to 'benchmark')
241 files changed, 5637 insertions, 0 deletions
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb new file mode 100644 index 0000000000..3cd8a8fd37 --- /dev/null +++ b/benchmark/bm_app_answer.rb @@ -0,0 +1,15 @@ +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +def the_answer_to_life_the_universe_and_everything + (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i +end + +answer = the_answer_to_life_the_universe_and_everything diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb new file mode 100644 index 0000000000..2bd6acfaf8 --- /dev/null +++ b/benchmark/bm_app_aobench.rb @@ -0,0 +1,291 @@ +# AO render benchmark +# Original program (C) Syoyo Fujita in Javascript (and other languages) +# https://code.google.com/p/aobench/ +# Ruby(yarv2llvm) version by Hideki Miura +# + +IMAGE_WIDTH = 256 +IMAGE_HEIGHT = 256 +NSUBSAMPLES = 2 +NAO_SAMPLES = 8 + +class Vec + def initialize(x, y, z) + @x = x + @y = y + @z = z + end + + attr_accessor :x, :y, :z + + def vadd(b) + Vec.new(@x + b.x, @y + b.y, @z + b.z) + end + + def vsub(b) + Vec.new(@x - b.x, @y - b.y, @z - b.z) + end + + def vcross(b) + Vec.new(@y * b.z - @z * b.y, + @z * b.x - @x * b.z, + @x * b.y - @y * b.x) + end + + def vdot(b) + @x * b.x + @y * b.y + @z * b.z + end + + def vlength + Math.sqrt(@x * @x + @y * @y + @z * @z) + end + + def vnormalize + len = vlength + v = Vec.new(@x, @y, @z) + if len > 1.0e-17 then + v.x = v.x / len + v.y = v.y / len + v.z = v.z / len + end + v + end +end + + +class Sphere + def initialize(center, radius) + @center = center + @radius = radius + end + + attr_reader :center, :radius + + def intersect(ray, isect) + rs = ray.org.vsub(@center) + b = rs.vdot(ray.dir) + c = rs.vdot(rs) - (@radius * @radius) + d = b * b - c + if d > 0.0 then + t = - b - Math.sqrt(d) + + if t > 0.0 and t < isect.t then + isect.t = t + isect.hit = true + isect.pl = Vec.new(ray.org.x + ray.dir.x * t, + ray.org.y + ray.dir.y * t, + ray.org.z + ray.dir.z * t) + n = isect.pl.vsub(@center) + isect.n = n.vnormalize + else + 0.0 + end + end + nil + end +end + +class Plane + def initialize(p, n) + @p = p + @n = n + end + + def intersect(ray, isect) + d = -@p.vdot(@n) + v = ray.dir.vdot(@n) + v0 = v + if v < 0.0 then + v0 = -v + end + if v0 < 1.0e-17 then + return + end + + t = -(ray.org.vdot(@n) + d) / v + + if t > 0.0 and t < isect.t then + isect.hit = true + isect.t = t + isect.n = @n + isect.pl = Vec.new(ray.org.x + t * ray.dir.x, + ray.org.y + t * ray.dir.y, + ray.org.z + t * ray.dir.z) + end + nil + end +end + +class Ray + def initialize(org, dir) + @org = org + @dir = dir + end + + attr_accessor :org, :dir +end + +class Isect + def initialize + @t = 10000000.0 + @hit = false + @pl = Vec.new(0.0, 0.0, 0.0) + @n = Vec.new(0.0, 0.0, 0.0) + end + + attr_accessor :t, :hit, :pl, :n +end + +def clamp(f) + i = f * 255.5 + if i > 255.0 then + i = 255.0 + end + if i < 0.0 then + i = 0.0 + end + i.to_i +end + +def otherBasis(basis, n) + basis[2] = Vec.new(n.x, n.y, n.z) + basis[1] = Vec.new(0.0, 0.0, 0.0) + + if n.x < 0.6 and n.x > -0.6 then + basis[1].x = 1.0 + elsif n.y < 0.6 and n.y > -0.6 then + basis[1].y = 1.0 + elsif n.z < 0.6 and n.z > -0.6 then + basis[1].z = 1.0 + else + basis[1].x = 1.0 + end + + basis[0] = basis[1].vcross(basis[2]) + basis[0] = basis[0].vnormalize + + basis[1] = basis[2].vcross(basis[0]) + basis[1] = basis[1].vnormalize +end + +class Scene + def initialize + @spheres = Array.new + @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5) + @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5) + @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5) + @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0)) + end + + def ambient_occlusion(isect) + basis = Array.new + otherBasis(basis, isect.n) + + ntheta = NAO_SAMPLES + nphi = NAO_SAMPLES + eps = 0.0001 + occlusion = 0.0 + + p0 = Vec.new(isect.pl.x + eps * isect.n.x, + isect.pl.y + eps * isect.n.y, + isect.pl.z + eps * isect.n.z) + nphi.times do |j| + ntheta.times do |i| + r = rand + phi = 2.0 * 3.14159265 * rand + x = Math.cos(phi) * Math.sqrt(1.0 - r) + y = Math.sin(phi) * Math.sqrt(1.0 - r) + z = Math.sqrt(r) + + rx = x * basis[0].x + y * basis[1].x + z * basis[2].x + ry = x * basis[0].y + y * basis[1].y + z * basis[2].y + rz = x * basis[0].z + y * basis[1].z + z * basis[2].z + + raydir = Vec.new(rx, ry, rz) + ray = Ray.new(p0, raydir) + + occisect = Isect.new + @spheres[0].intersect(ray, occisect) + @spheres[1].intersect(ray, occisect) + @spheres[2].intersect(ray, occisect) + @plane.intersect(ray, occisect) + if occisect.hit then + occlusion = occlusion + 1.0 + else + 0.0 + end + end + end + + occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f) + + Vec.new(occlusion, occlusion, occlusion) + end + + def render(w, h, nsubsamples) + cnt = 0 + nsf = nsubsamples.to_f + h.times do |y| + w.times do |x| + rad = Vec.new(0.0, 0.0, 0.0) + + # Subsampling + nsubsamples.times do |v| + nsubsamples.times do |u| + + cnt = cnt + 1 + wf = w.to_f + hf = h.to_f + xf = x.to_f + yf = y.to_f + uf = u.to_f + vf = v.to_f + + px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0) + py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0) + + eye = Vec.new(px, py, -1.0).vnormalize + + ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye) + + isect = Isect.new + @spheres[0].intersect(ray, isect) + @spheres[1].intersect(ray, isect) + @spheres[2].intersect(ray, isect) + @plane.intersect(ray, isect) + if isect.hit then + col = ambient_occlusion(isect) + rad.x = rad.x + col.x + rad.y = rad.y + col.y + rad.z = rad.z + col.z + end + end + end + + r = rad.x / (nsf * nsf) + g = rad.y / (nsf * nsf) + b = rad.z / (nsf * nsf) + printf("%c", clamp(r)) + printf("%c", clamp(g)) + printf("%c", clamp(b)) + end + nil + end + + nil + end +end + +alias printf_orig printf +def printf *args +end + +# File.open("ao.ppm", "w") do |fp| + printf("P6\n") + printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT) + printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT) + Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES) +# end + +undef printf +alias printf printf_orig diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb new file mode 100644 index 0000000000..77c66a7949 --- /dev/null +++ b/benchmark/bm_app_erb.rb @@ -0,0 +1,26 @@ +# +# Create many HTML strings with ERB. +# + +require 'erb' + +data = DATA.read +max = 15_000 +title = "hello world!" +content = "hello world!\n" * 10 + +max.times{ + ERB.new(data).result(binding) +} + +__END__ + +<html> + <head> <%= title %> </head> + <body> + <h1> <%= title %> </h1> + <p> + <%= content %> + </p> + </body> +</html> diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb new file mode 100644 index 0000000000..45f471dfdb --- /dev/null +++ b/benchmark/bm_app_factorial.rb @@ -0,0 +1,11 @@ +def fact(n) + if(n > 1) + n * fact(n-1) + else + 1 + end +end + +100.times { + fact(5000) +} diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb new file mode 100644 index 0000000000..34a7b2e725 --- /dev/null +++ b/benchmark/bm_app_fib.rb @@ -0,0 +1,10 @@ +def fib n + if n < 3 + 1 + else + fib(n-1) + fib(n-2) + end +end + +fib(34) + diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb new file mode 100644 index 0000000000..f09574bbeb --- /dev/null +++ b/benchmark/bm_app_lc_fizzbuzz.rb @@ -0,0 +1,52 @@ +# +# FizzBuzz program using only lambda calculus +# +# This program is quoted from +# "Understanding Computation" by Tom Stuart +# http://computationbook.com/ +# +# You can understand why this program works fine by reading this book. +# + +solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }] + +FIRST = -> l { LEFT[RIGHT[l]] } +IF = -> b { b } +LEFT = -> p { p[-> x { -> y { x } } ] } +RIGHT = -> p { p[-> x { -> y { y } } ] } +IS_EMPTY = LEFT +REST = -> l { RIGHT[RIGHT[l]] } + +def to_integer(proc) + proc[-> n { n + 1 }][0] +end + +def to_boolean(proc) + IF[proc][true][false] +end + +def to_array(proc) + array = [] + + until to_boolean(IS_EMPTY[proc]) + array.push(FIRST[proc]) + proc = REST[proc] + end + + array +end + +def to_char(c) + '0123456789BFiuz'.slice(to_integer(c)) +end + +def to_string(s) + to_array(s).map { |c| to_char(c) }.join +end + +answer = to_array(solution).map do |p| + to_string(p) +end + +answer_ary = answer.to_a +# puts answer_ary diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb new file mode 100644 index 0000000000..801b75e8e2 --- /dev/null +++ b/benchmark/bm_app_mandelbrot.rb @@ -0,0 +1,23 @@ +require 'complex' + +def mandelbrot? z + i = 0 + while i<100 + i += 1 + z = z * z + return false if z.abs > 2 + end + true +end + +ary = [] + +(0..1000).each{|dx| + (0..1000).each{|dy| + x = dx / 50.0 + y = dy / 50.0 + c = Complex(x, y) + ary << c if mandelbrot?(c) + } +} + diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb new file mode 100644 index 0000000000..59c63f358e --- /dev/null +++ b/benchmark/bm_app_pentomino.rb @@ -0,0 +1,259 @@ +#!/usr/local/bin/ruby +# This program is contributed by Shin Nishiyama + + +# modified by K.Sasada + +NP = 5 +ROW = 8 + NP +COL = 8 + +$p = [] +$b = [] +$no = 0 + +def piece(n, a, nb) + nb.each{|x| + a[n] = x + if n == NP-1 + $p << [a.sort] + else + nbc=nb.dup + [-ROW, -1, 1, ROW].each{|d| + if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) + nbc << x+d + end + } + nbc.delete x + piece(n+1,a[0..n],nbc) + end + } +end + +def kikaku(a) + a.collect {|x| x - a[0]} +end +def ud(a) + kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) +end +def rl(a) + kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) +end +def xy(a) + kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) +end + +def mkpieces + piece(0,[],[0]) + $p.each do |a| + a0 = a[0] + a[1] = ud(a0) + a[2] = rl(a0) + a[3] = ud(rl(a0)) + a[4] = xy(a0) + a[5] = ud(xy(a0)) + a[6] = rl(xy(a0)) + a[7] = ud(rl(xy(a0))) + a.sort! + a.uniq! + end + $p.uniq!.sort! {|x,y| x[0] <=> y[0] } +end + +def mkboard + (0...ROW*COL).each{|i| + if i % ROW >= ROW-NP + $b[i] = -2 + else + $b[i] = -1 + end + $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 + } +end + +def pboard + return # skip print + print "No. #$no\n" + (0...COL).each{|i| + print "|" + (0...ROW-NP).each{|j| + x = $b[i*ROW+j] + if x < 0 + print "..|" + else + printf "%2d|",x+1 + end + } + print "\n" + } + print "\n" +end + +$pnum=[] +def setpiece(a,pos) + if a.length == $p.length then + $no += 1 + pboard + return + end + while $b[pos] != -1 + pos += 1 + end + ($pnum - a).each do |i| + $p[i].each do |x| + f = 0 + x.each{|s| + if $b[pos+s] != -1 + f=1 + break + end + } + if f == 0 then + x.each{|s| + $b[pos+s] = i + } + a << i + setpiece(a.dup, pos) + a.pop + x.each{|s| + $b[pos+s] = -1 + } + end + end + end +end + +mkpieces +mkboard +$p[4] = [$p[4][0]] +$pnum = (0...$p.length).to_a +setpiece([],0) + + +__END__ + +# original + +NP = 5 +ROW = 8 + NP +COL = 8 + +$p = [] +$b = [] +$no = 0 + +def piece(n,a,nb) + for x in nb + a[n] = x + if n == NP-1 + $p << [a.sort] + else + nbc=nb.dup + for d in [-ROW, -1, 1, ROW] + if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) + nbc << x+d + end + end + nbc.delete x + piece(n+1,a[0..n],nbc) + end + end +end + +def kikaku(a) + a.collect {|x| x - a[0]} +end +def ud(a) + kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) +end +def rl(a) + kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) +end +def xy(a) + kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) +end + +def mkpieces + piece(0,[],[0]) + $p.each do |a| + a0 = a[0] + a[1] = ud(a0) + a[2] = rl(a0) + a[3] = ud(rl(a0)) + a[4] = xy(a0) + a[5] = ud(xy(a0)) + a[6] = rl(xy(a0)) + a[7] = ud(rl(xy(a0))) + a.sort! + a.uniq! + end + $p.uniq!.sort! {|x,y| x[0] <=> y[0] } +end + +def mkboard + for i in 0...ROW*COL + if i % ROW >= ROW-NP + $b[i] = -2 + else + $b[i] = -1 + end + $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 + end +end + +def pboard + print "No. #$no\n" + for i in 0...COL + print "|" + for j in 0...ROW-NP + x = $b[i*ROW+j] + if x < 0 + print "..|" + else + printf "%2d|",x+1 + end + end + print "\n" + end + print "\n" +end + +$pnum=[] +def setpiece(a,pos) + if a.length == $p.length then + $no += 1 + pboard + return + end + while $b[pos] != -1 + pos += 1 + end + ($pnum - a).each do |i| + $p[i].each do |x| + f = 0 + for s in x do + if $b[pos+s] != -1 + f=1 + break + end + end + if f == 0 then + for s in x do + $b[pos+s] = i + end + a << i + setpiece(a.dup, pos) + a.pop + for s in x do + $b[pos+s] = -1 + end + end + end + end +end + +mkpieces +mkboard +$p[4] = [$p[4][0]] +$pnum = (0...$p.length).to_a +setpiece([],0) diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb new file mode 100644 index 0000000000..5db8f95d50 --- /dev/null +++ b/benchmark/bm_app_raise.rb @@ -0,0 +1,8 @@ +i = 0 +while i<300000 + i += 1 + begin + raise + rescue + end +end diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb new file mode 100644 index 0000000000..7eed7c1aed --- /dev/null +++ b/benchmark/bm_app_strconcat.rb @@ -0,0 +1,5 @@ +i = 0 +while i<2_000_000 + "#{1+1} #{1+1} #{1+1}" + i += 1 +end diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb new file mode 100644 index 0000000000..efe5380f4e --- /dev/null +++ b/benchmark/bm_app_tak.rb @@ -0,0 +1,13 @@ + +def tak x, y, z + unless y < x + z + else + tak( tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) + end +end + +tak(18, 9, 0) + diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb new file mode 100644 index 0000000000..4c146f5ccf --- /dev/null +++ b/benchmark/bm_app_tarai.rb @@ -0,0 +1,10 @@ +def tarai( x, y, z ) + if x <= y + then y + else tarai(tarai(x-1, y, z), + tarai(y-1, z, x), + tarai(z-1, x, y)) + end +end + +tarai(12, 6, 0) diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb new file mode 100644 index 0000000000..586edfd5dc --- /dev/null +++ b/benchmark/bm_app_uri.rb @@ -0,0 +1,8 @@ +require 'uri' + +100_000.times{ + uri = URI.parse('http://www.ruby-lang.org') + uri.scheme + uri.host + uri.port +} diff --git a/benchmark/bm_array_sample_100k_10.rb b/benchmark/bm_array_sample_100k_10.rb new file mode 100644 index 0000000000..5f41ecc32b --- /dev/null +++ b/benchmark/bm_array_sample_100k_10.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 10} diff --git a/benchmark/bm_array_sample_100k_11.rb b/benchmark/bm_array_sample_100k_11.rb new file mode 100644 index 0000000000..18b1715319 --- /dev/null +++ b/benchmark/bm_array_sample_100k_11.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 11} diff --git a/benchmark/bm_array_sample_100k__100.rb b/benchmark/bm_array_sample_100k__100.rb new file mode 100644 index 0000000000..22863afe89 --- /dev/null +++ b/benchmark/bm_array_sample_100k__100.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 100} diff --git a/benchmark/bm_array_sample_100k__1k.rb b/benchmark/bm_array_sample_100k__1k.rb new file mode 100644 index 0000000000..4cd79e6c67 --- /dev/null +++ b/benchmark/bm_array_sample_100k__1k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 1000} diff --git a/benchmark/bm_array_sample_100k__6k.rb b/benchmark/bm_array_sample_100k__6k.rb new file mode 100644 index 0000000000..b3d264249e --- /dev/null +++ b/benchmark/bm_array_sample_100k__6k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 6000} diff --git a/benchmark/bm_array_sample_100k___10k.rb b/benchmark/bm_array_sample_100k___10k.rb new file mode 100644 index 0000000000..5dd55ec058 --- /dev/null +++ b/benchmark/bm_array_sample_100k___10k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 10_000} diff --git a/benchmark/bm_array_sample_100k___50k.rb b/benchmark/bm_array_sample_100k___50k.rb new file mode 100644 index 0000000000..1506732c3c --- /dev/null +++ b/benchmark/bm_array_sample_100k___50k.rb @@ -0,0 +1,2 @@ +arr = [*0...100000] +10_000.times {arr.sample 50_000} diff --git a/benchmark/bm_array_shift.rb b/benchmark/bm_array_shift.rb new file mode 100644 index 0000000000..798bb9e3f4 --- /dev/null +++ b/benchmark/bm_array_shift.rb @@ -0,0 +1,14 @@ +require 'benchmark' + +Benchmark.bm do |x| + [10_000,1_000_000,100_000_000].each do |n| + ary = Array.new(n,0) + GC.start + x.report("#{n}:shift"){ ary.shift } + (0..4).each do |i| + ary = Array.new(n,0) + GC.start + x.report("#{n}:shift(#{i})"){ ary.shift(i) } + end + end +end diff --git a/benchmark/bm_array_small_and.rb b/benchmark/bm_array_small_and.rb new file mode 100644 index 0000000000..e53a6edae6 --- /dev/null +++ b/benchmark/bm_array_small_and.rb @@ -0,0 +1,17 @@ +MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i +MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i +ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i + +ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1| + (MIN_SIZE..MAX_SIZE).map do |size2| + [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }] + end +end + +ITERATIONS.times do + ARRAYS.each do |group| + group.each do |arr1, arr2| + arr1 & arr2 + end + end +end diff --git a/benchmark/bm_array_small_diff.rb b/benchmark/bm_array_small_diff.rb new file mode 100644 index 0000000000..9661ee48db --- /dev/null +++ b/benchmark/bm_array_small_diff.rb @@ -0,0 +1,17 @@ +MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i +MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i +ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i + +ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1| + (MIN_SIZE..MAX_SIZE).map do |size2| + [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }] + end +end + +ITERATIONS.times do + ARRAYS.each do |group| + group.each do |arr1, arr2| + arr1 - arr2 + end + end +end diff --git a/benchmark/bm_array_small_or.rb b/benchmark/bm_array_small_or.rb new file mode 100644 index 0000000000..c58b5fd1ff --- /dev/null +++ b/benchmark/bm_array_small_or.rb @@ -0,0 +1,17 @@ +MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i +MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i +ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i + +ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1| + (MIN_SIZE..MAX_SIZE).map do |size2| + [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }] + end +end + +ITERATIONS.times do + ARRAYS.each do |group| + group.each do |arr1, arr2| + arr1 | arr2 + end + end +end diff --git a/benchmark/bm_array_sort_block.rb b/benchmark/bm_array_sort_block.rb new file mode 100644 index 0000000000..3579786056 --- /dev/null +++ b/benchmark/bm_array_sort_block.rb @@ -0,0 +1,2 @@ +ary = Array.new(1000) { rand(1000) } +10000.times { ary.sort { |a, b| a <=> b } } diff --git a/benchmark/bm_array_sort_float.rb b/benchmark/bm_array_sort_float.rb new file mode 100644 index 0000000000..9a6e2f8bd2 --- /dev/null +++ b/benchmark/bm_array_sort_float.rb @@ -0,0 +1,2 @@ +arr = Array.new(1000) { rand } +10000.times { arr.sort } diff --git a/benchmark/bm_bighash.rb b/benchmark/bm_bighash.rb new file mode 100644 index 0000000000..e2ad5a5c94 --- /dev/null +++ b/benchmark/bm_bighash.rb @@ -0,0 +1 @@ +h = {}; 5000000.times {|n| h[n] = n } diff --git a/benchmark/bm_dir_empty_p.rb b/benchmark/bm_dir_empty_p.rb new file mode 100644 index 0000000000..8329c757cf --- /dev/null +++ b/benchmark/bm_dir_empty_p.rb @@ -0,0 +1,5 @@ +require 'tmpdir' +max = 100_000 +Dir.mktmpdir('bm_dir_empty_p') do |dir| + max.times { Dir.empty?(dir) } +end diff --git a/benchmark/bm_erb_render.rb b/benchmark/bm_erb_render.rb new file mode 100644 index 0000000000..d2929b0553 --- /dev/null +++ b/benchmark/bm_erb_render.rb @@ -0,0 +1,26 @@ +require 'erb' + +data = DATA.read +max = 1_500_000 +title = "hello world!" +content = "hello world!\n" * 10 + +src = "def self.render(title, content); #{ERB.new(data).src}; end" +mod = Module.new +mod.instance_eval(src, "(ERB)") + +max.times do + mod.render(title, content) +end + +__END__ + +<html> + <head> <%= title %> </head> + <body> + <h1> <%= title %> </h1> + <p> + <%= content %> + </p> + </body> +</html> diff --git a/benchmark/bm_file_chmod.rb b/benchmark/bm_file_chmod.rb new file mode 100644 index 0000000000..1cd4760c9d --- /dev/null +++ b/benchmark/bm_file_chmod.rb @@ -0,0 +1,9 @@ +# chmod file +require 'tempfile' +max = 200_000 +tmp = Tempfile.new('chmod') +path = tmp.path +max.times do + File.chmod(0777, path) +end +tmp.close! diff --git a/benchmark/bm_file_rename.rb b/benchmark/bm_file_rename.rb new file mode 100644 index 0000000000..3bf6a5ef35 --- /dev/null +++ b/benchmark/bm_file_rename.rb @@ -0,0 +1,11 @@ +# rename file +require 'tempfile' + +max = 100_000 +tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ] +a, b = tmp.map { |x| x.path } +max.times do + File.rename(a, b) + File.rename(b, a) +end +tmp.each { |t| t.close! } diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb new file mode 100644 index 0000000000..af4f8c36d4 --- /dev/null +++ b/benchmark/bm_hash_aref_dsym.rb @@ -0,0 +1,4 @@ +h = {} +syms = ('a'..'z').map { |s| s.to_sym } +syms.each { |s| h[s] = 1 } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb new file mode 100644 index 0000000000..9d7759379e --- /dev/null +++ b/benchmark/bm_hash_aref_dsym_long.rb @@ -0,0 +1,21 @@ +# [ruby-core:70129] [Bug #11396] +collection_size = 200000 +sample_size = 10000 + +values = (1..collection_size).to_a.map do |x| + "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}" +end + +symbol_hash = {} + +values.each do |x| + symbol_hash[x.to_sym] = 1 +end + +# use the same samples each time to minimize deviations +rng = Random.new(0) +symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym) + +3000.times do + symbol_sample_array.each { |x| symbol_hash[x] } +end diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb new file mode 100644 index 0000000000..1346890582 --- /dev/null +++ b/benchmark/bm_hash_aref_fix.rb @@ -0,0 +1,4 @@ +h = {} +nums = (1..26).to_a +nums.each { |i| h[i] = i } +200_000.times { nums.each { |s| h[s] } } diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb new file mode 100644 index 0000000000..2217274c82 --- /dev/null +++ b/benchmark/bm_hash_aref_flo.rb @@ -0,0 +1,4 @@ +h = {} +strs = [*1..10000].map! {|i| i.fdiv(10)} +strs.each { |s| h[s] = s } +50.times { strs.each { |s| h[s] } } diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb new file mode 100644 index 0000000000..b0913dd4bb --- /dev/null +++ b/benchmark/bm_hash_aref_miss.rb @@ -0,0 +1,5 @@ +h = {} +strs = ('a'..'z').to_a.map!(&:freeze) +strs.each { |s| h[s] = s } +strs = ('A'..'Z').to_a +200_000.times { strs.each { |s| h[s] } } diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb new file mode 100644 index 0000000000..19439b061b --- /dev/null +++ b/benchmark/bm_hash_aref_str.rb @@ -0,0 +1,4 @@ +h = {} +strs = ('a'..'z').to_a.map!(&:freeze) +strs.each { |s| h[s] = s } +200_000.times { strs.each { |s| h[s] } } diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb new file mode 100644 index 0000000000..f75d163fe6 --- /dev/null +++ b/benchmark/bm_hash_aref_sym.rb @@ -0,0 +1,9 @@ +h = {} +syms = ('a'..'z').to_a +begin + syms = eval("%i[#{syms.join(' ')}]") +rescue SyntaxError # <= 1.9.3 + syms.map!(&:to_sym) +end +syms.each { |s| h[s] = s } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb new file mode 100644 index 0000000000..9dab8df7be --- /dev/null +++ b/benchmark/bm_hash_aref_sym_long.rb @@ -0,0 +1,13 @@ +h = {} +syms = %w[puts warn syswrite write stat bacon lettuce tomato +some symbols in this array may already be interned others should not be +hash browns make good breakfast but not cooked using prime numbers +shift for division entries delete_if keys exist? +] +begin + syms = eval("%i[#{syms.join(' ')}]") +rescue SyntaxError # <= 1.9.3 + syms.map!(&:to_sym) +end +syms.each { |s| h[s] = s } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb new file mode 100644 index 0000000000..e944aae9f2 --- /dev/null +++ b/benchmark/bm_hash_flatten.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +1000.times do + h.flatten +end diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb new file mode 100644 index 0000000000..0c7edfed3e --- /dev/null +++ b/benchmark/bm_hash_ident_flo.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +strs = (1..10000).to_a.map!(&:to_f) +strs.each { |s| h[s] = s } +50.times { strs.each { |s| h[s] } } diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb new file mode 100644 index 0000000000..b226736c6f --- /dev/null +++ b/benchmark/bm_hash_ident_num.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +nums = (1..26).to_a +nums.each { |n| h[n] = n } +200_000.times { nums.each { |n| h[n] } } diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb new file mode 100644 index 0000000000..4b3b58edec --- /dev/null +++ b/benchmark/bm_hash_ident_obj.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +objs = 26.times.map { Object.new } +objs.each { |o| h[o] = o } +200_000.times { objs.each { |o| h[o] } } diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb new file mode 100644 index 0000000000..8582b38e31 --- /dev/null +++ b/benchmark/bm_hash_ident_str.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +strs = ('a'..'z').to_a +strs.each { |s| h[s] = s } +200_000.times { strs.each { |s| h[s] } } diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb new file mode 100644 index 0000000000..4c81e3d28e --- /dev/null +++ b/benchmark/bm_hash_ident_sym.rb @@ -0,0 +1,4 @@ +h = {}.compare_by_identity +syms = ('a'..'z').to_a.map(&:to_sym) +syms.each { |s| h[s] = s } +200_000.times { syms.each { |s| h[s] } } diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb new file mode 100644 index 0000000000..6863cd01f9 --- /dev/null +++ b/benchmark/bm_hash_keys.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +5000.times do + h.keys +end diff --git a/benchmark/bm_hash_long.rb b/benchmark/bm_hash_long.rb new file mode 100644 index 0000000000..03d9109602 --- /dev/null +++ b/benchmark/bm_hash_long.rb @@ -0,0 +1,4 @@ +k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong"; +k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping"; +h = {k1 => 0, k2 => 0}; +3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1} diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb new file mode 100644 index 0000000000..a645671a5b --- /dev/null +++ b/benchmark/bm_hash_shift.rb @@ -0,0 +1,10 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +50000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb new file mode 100644 index 0000000000..ec800d0342 --- /dev/null +++ b/benchmark/bm_hash_shift_u16.rb @@ -0,0 +1,10 @@ +h = {} + +(16384..65536).each do |i| + h[i] = nil +end + +300000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb new file mode 100644 index 0000000000..de4e0fa696 --- /dev/null +++ b/benchmark/bm_hash_shift_u24.rb @@ -0,0 +1,10 @@ +h = {} + +(0xff4000..0xffffff).each do |i| + h[i] = nil +end + +300000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb new file mode 100644 index 0000000000..656aa55583 --- /dev/null +++ b/benchmark/bm_hash_shift_u32.rb @@ -0,0 +1,10 @@ +h = {} + +(0xffff4000..0xffffffff).each do |i| + h[i] = nil +end + +300000.times do + k, v = h.shift + h[k] = v +end diff --git a/benchmark/bm_hash_small2.rb b/benchmark/bm_hash_small2.rb new file mode 100644 index 0000000000..45485d9c71 --- /dev/null +++ b/benchmark/bm_hash_small2.rb @@ -0,0 +1 @@ +1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a} diff --git a/benchmark/bm_hash_small4.rb b/benchmark/bm_hash_small4.rb new file mode 100644 index 0000000000..acd4084334 --- /dev/null +++ b/benchmark/bm_hash_small4.rb @@ -0,0 +1 @@ +1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a} diff --git a/benchmark/bm_hash_small8.rb b/benchmark/bm_hash_small8.rb new file mode 100644 index 0000000000..9cffcc91b6 --- /dev/null +++ b/benchmark/bm_hash_small8.rb @@ -0,0 +1 @@ +1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a} diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb new file mode 100644 index 0000000000..2b675bf509 --- /dev/null +++ b/benchmark/bm_hash_to_proc.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +5000.times do |i| + [i].map(&h) +end diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb new file mode 100644 index 0000000000..069441302f --- /dev/null +++ b/benchmark/bm_hash_values.rb @@ -0,0 +1,9 @@ +h = {} + +10000.times do |i| + h[i] = nil +end + +5000.times do + h.values +end diff --git a/benchmark/bm_int_quo.rb b/benchmark/bm_int_quo.rb new file mode 100644 index 0000000000..e22a3f8c30 --- /dev/null +++ b/benchmark/bm_int_quo.rb @@ -0,0 +1 @@ +5000000.times { 42.quo(3) } diff --git a/benchmark/bm_io_copy_stream_write.rb b/benchmark/bm_io_copy_stream_write.rb new file mode 100644 index 0000000000..3fd87250a4 --- /dev/null +++ b/benchmark/bm_io_copy_stream_write.rb @@ -0,0 +1,24 @@ +# The goal of this is to use a synthetic (non-IO) reader +# to trigger the read/write loop of IO.copy_stream, +# bypassing in-kernel mechanisms like sendfile for zero copy, +# so we wrap the /dev/zero IO object: + +class Zero + def initialize + @n = 100000 + @in = File.open('/dev/zero', 'rb') + end + + def read(len, buf) + return if (@n -= 1) == 0 + @in.read(len, buf) + end +end + +begin + src = Zero.new + dst = File.open(IO::NULL, 'wb') + n = IO.copy_stream(src, dst) +rescue Errno::ENOENT + # not *nix +end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL) diff --git a/benchmark/bm_io_copy_stream_write_socket.rb b/benchmark/bm_io_copy_stream_write_socket.rb new file mode 100644 index 0000000000..11f369bd0d --- /dev/null +++ b/benchmark/bm_io_copy_stream_write_socket.rb @@ -0,0 +1,35 @@ +# The goal of this is to use a synthetic (non-IO) reader +# to trigger the read/write loop of IO.copy_stream, +# bypassing in-kernel mechanisms like sendfile for zero copy, +# so we wrap the /dev/zero IO object: +class Zero + def initialize + @n = 100000 + @in = File.open('/dev/zero', 'rb') + end + + def read(len, buf) + return if (@n -= 1) == 0 + @in.read(len, buf) + end +end + +begin + require 'socket' + src = Zero.new + rd, wr = UNIXSocket.pair + pid = fork do + wr.close + buf = String.new + while rd.read(16384, buf) + end + end + rd.close + IO.copy_stream(src, wr) +rescue Errno::ENOENT, NotImplementedError, NameError + # not *nix: missing /dev/zero, fork, or UNIXSocket +rescue LoadError # no socket? +ensure + wr.close if wr + Process.waitpid(pid) if pid +end if IO.respond_to?(:copy_stream) diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb new file mode 100644 index 0000000000..2f205c1333 --- /dev/null +++ b/benchmark/bm_io_file_create.rb @@ -0,0 +1,13 @@ +# +# Create files +# + +max = 200_000 +file = './tmpfile_of_bm_io_file_create' + +max.times{ + f = open(file, 'w') + f.close#(true) +} +File.unlink(file) + diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb new file mode 100644 index 0000000000..b9e796ed30 --- /dev/null +++ b/benchmark/bm_io_file_read.rb @@ -0,0 +1,15 @@ +# +# Seek and Read file. +# + +require 'tempfile' + +max = 200_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') +f.write str + +max.times{ + f.seek 0 + f.read +} diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb new file mode 100644 index 0000000000..aa1be0e5fe --- /dev/null +++ b/benchmark/bm_io_file_write.rb @@ -0,0 +1,14 @@ +# +# Seek and Write file. +# + +require 'tempfile' + +max = 200_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') + +max.times{ + f.seek 0 + f.write str +} diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb new file mode 100644 index 0000000000..da9357fdc6 --- /dev/null +++ b/benchmark/bm_io_nonblock_noex.rb @@ -0,0 +1,22 @@ +nr = 1_000_000 +i = 0 +msg = '.' +buf = '.' +noex = { exception: false } +begin + r, w = IO.pipe + while i < nr + i += 1 + w.write_nonblock(msg, noex) + r.read_nonblock(1, buf, noex) + end +rescue ArgumentError # old Rubies + while i < nr + i += 1 + w.write_nonblock(msg) + r.read_nonblock(1, buf) + end +ensure + r.close + w.close +end diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb new file mode 100644 index 0000000000..56819d049b --- /dev/null +++ b/benchmark/bm_io_nonblock_noex2.rb @@ -0,0 +1,21 @@ +nr = 1_000_000 +i = 0 +msg = '.' +buf = '.' +begin + r, w = IO.pipe + while i < nr + i += 1 + w.write_nonblock(msg, exception: false) + r.read_nonblock(1, buf, exception: false) + end +rescue ArgumentError # old Rubies + while i < nr + i += 1 + w.write_nonblock(msg) + r.read_nonblock(1, buf) + end +ensure + r.close + w.close +end diff --git a/benchmark/bm_io_pipe_rw.rb b/benchmark/bm_io_pipe_rw.rb new file mode 100644 index 0000000000..6862a8ae61 --- /dev/null +++ b/benchmark/bm_io_pipe_rw.rb @@ -0,0 +1,13 @@ +# Measure uncontended GVL performance via read/write with 1:1 threading +# If we switch to M:N threading, this will benchmark something else... +r, w = IO.pipe +src = '0'.freeze +dst = String.new +i = 0 +while i < 1_000_000 + i += 1 + w.write(src) + r.read(1, dst) +end +w.close +r.close diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb new file mode 100644 index 0000000000..19248daeb1 --- /dev/null +++ b/benchmark/bm_io_select.rb @@ -0,0 +1,9 @@ +# IO.select performance + +w = [ IO.pipe[1] ]; + +nr = 1000000 +nr.times { + IO.select nil, w +} + diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb new file mode 100644 index 0000000000..10e37d71b2 --- /dev/null +++ b/benchmark/bm_io_select2.rb @@ -0,0 +1,22 @@ +# IO.select performance. worst case of single fd. + +ios = [] +nr = 1000000 +if defined?(Process::RLIMIT_NOFILE) + max = Process.getrlimit(Process::RLIMIT_NOFILE)[0] +else + max = 64 +end +puts "max fd: #{max} (results not apparent with <= 1024 max fd)" + +((max / 2) - 10).times do + ios.concat IO.pipe +end + +last = [ ios[-1] ] +puts "last IO: #{last[0].inspect}" + +nr.times do + IO.select nil, last +end + diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb new file mode 100644 index 0000000000..7d0ba1f092 --- /dev/null +++ b/benchmark/bm_io_select3.rb @@ -0,0 +1,21 @@ +# IO.select performance. a lot of fd + +ios = [] +nr = 100 +if defined?(Process::RLIMIT_NOFILE) + max = Process.getrlimit(Process::RLIMIT_NOFILE)[0] +else + max = 64 +end +puts "max fd: #{max} (results not apparent with <= 1024 max fd)" + +(max - 10).times do + r, w = IO.pipe + r.close + ios.push w +end + +nr.times do + IO.select nil, ios +end + diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb new file mode 100644 index 0000000000..0fc4cc1511 --- /dev/null +++ b/benchmark/bm_loop_for.rb @@ -0,0 +1,3 @@ +for i in 1..30_000_000 + # +end diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb new file mode 100644 index 0000000000..d3375c744c --- /dev/null +++ b/benchmark/bm_loop_generator.rb @@ -0,0 +1,14 @@ +max = 600000 + +if defined? Fiber + gen = (1..max).each + loop do + gen.next + end +else + require 'generator' + gen = Generator.new((0..max)) + while gen.next? + gen.next + end +end diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb new file mode 100644 index 0000000000..521f72ad1a --- /dev/null +++ b/benchmark/bm_loop_times.rb @@ -0,0 +1 @@ +30_000_000.times{|e|} diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb new file mode 100644 index 0000000000..0072822c06 --- /dev/null +++ b/benchmark/bm_loop_whileloop.rb @@ -0,0 +1,4 @@ +i = 0 +while i<30_000_000 # benchmark loop 1 + i += 1 +end diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb new file mode 100644 index 0000000000..47d02dffc4 --- /dev/null +++ b/benchmark/bm_loop_whileloop2.rb @@ -0,0 +1,4 @@ +i = 0 +while i< 6_000_000 # benchmark loop 2 + i += 1 +end diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb new file mode 100644 index 0000000000..9b8d0c6afb --- /dev/null +++ b/benchmark/bm_marshal_dump_flo.rb @@ -0,0 +1,2 @@ +bug10761 = 10000.times.map { |x| x.to_f } +100.times { Marshal.dump(bug10761) } diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb new file mode 100644 index 0000000000..8252ad90fa --- /dev/null +++ b/benchmark/bm_marshal_dump_load_geniv.rb @@ -0,0 +1,10 @@ +a = '' +a.instance_eval do + @a = :a + @b = :b + @c = :c +end +100000.times do + a = Marshal.load(Marshal.dump(a)) +end +#p(a.instance_eval { @a == :a && @b == :b && @c == :c }) diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb new file mode 100644 index 0000000000..e29743b791 --- /dev/null +++ b/benchmark/bm_marshal_dump_load_time.rb @@ -0,0 +1 @@ +100000.times { Marshal.load(Marshal.dump(Time.now)) } diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb new file mode 100644 index 0000000000..b8abc88f41 --- /dev/null +++ b/benchmark/bm_require.rb @@ -0,0 +1,7 @@ +$:.push File.join(File.dirname(__FILE__), "bm_require.data") + +1.upto(10000) do |i| + require "c#{i}" +end + +$:.pop diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb new file mode 100644 index 0000000000..e54db6c6e5 --- /dev/null +++ b/benchmark/bm_require_thread.rb @@ -0,0 +1,15 @@ +$:.push File.join(File.dirname(__FILE__), "bm_require.data") + +i=0 +t = Thread.new do + while true + i = i+1 # dummy loop + end +end + +1.upto(100) do |i| + require "c#{i}" +end + +$:.pop +t.kill diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb new file mode 100644 index 0000000000..a082ea6d5b --- /dev/null +++ b/benchmark/bm_securerandom.rb @@ -0,0 +1,5 @@ +require "securerandom" + +20_0000.times do + SecureRandom.random_number(100) +end diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb new file mode 100644 index 0000000000..7db5be9050 --- /dev/null +++ b/benchmark/bm_so_ackermann.rb @@ -0,0 +1,19 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +NUM = 9 +ack(3, NUM) + + diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb new file mode 100644 index 0000000000..2b8fce8f99 --- /dev/null +++ b/benchmark/bm_so_array.rb @@ -0,0 +1,23 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Paul Brannan and Mark Hubbart + +n = 9000 # Integer(ARGV.shift || 1) + +x = Array.new(n) +y = Array.new(n, 0) + +n.times{|bi| + x[bi] = bi + 1 +} + +(0 .. 999).each do |e| + (n-1).step(0,-1) do |bi| + y[bi] += x.at(bi) + end +end +# puts "#{y.first} #{y.last}" + + diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb new file mode 100644 index 0000000000..b1693e4109 --- /dev/null +++ b/benchmark/bm_so_binary_trees.rb @@ -0,0 +1,62 @@ +# The Computer Language Shootout Benchmarks +# http://shootout.alioth.debian.org +# +# contributed by Jesse Millikan + +# disable output +alias puts_orig puts +def puts str + # disable puts +end + +def item_check(tree) + if tree[0] == nil + tree[1] + else + tree[1] + item_check(tree[0]) - item_check(tree[2]) + end +end + +def bottom_up_tree(item, depth) + if depth > 0 + item_item = 2 * item + depth -= 1 + [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)] + else + [nil, item, nil] + end +end + +max_depth = 16 # ARGV[0].to_i +min_depth = 4 + +max_depth = min_depth + 2 if min_depth + 2 > max_depth + +stretch_depth = max_depth + 1 +stretch_tree = bottom_up_tree(0, stretch_depth) + +puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}" +stretch_tree = nil + +long_lived_tree = bottom_up_tree(0, max_depth) + +min_depth.step(max_depth + 1, 2) do |depth| + iterations = 2**(max_depth - depth + min_depth) + + check = 0 + + for i in 1..iterations + temp_tree = bottom_up_tree(i, depth) + check += item_check(temp_tree) + + temp_tree = bottom_up_tree(-i, depth) + check += item_check(temp_tree) + end + + puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}" +end + +puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}" + +undef puts +alias puts puts_orig diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb new file mode 100644 index 0000000000..873214de7c --- /dev/null +++ b/benchmark/bm_so_concatenate.rb @@ -0,0 +1,18 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# based on code from Aristarkh A Zagorodnikov and Dat Nguyen + +STUFF = "hello\n" +i = 0 +while i<10 + i += 1 + hello = '' + 4_000_000.times do |e| + hello << STUFF + end +end +# puts hello.length + + diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb new file mode 100644 index 0000000000..65f6337a4a --- /dev/null +++ b/benchmark/bm_so_count_words.rb @@ -0,0 +1,19 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Paul Brannan + +input = open(File.join(File.dirname($0), 'wc.input'), 'rb') + +nl = nw = nc = 0 +while true + tmp = input.read(4096) or break + data = tmp << (input.gets || "") + nc += data.length + nl += data.count("\n") + ((data.strip! || data).tr!("\n", " ") || data).squeeze! + nw += data.count(" ") + 1 +end +# STDERR.puts "#{nl} #{nw} #{nc}" + diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb new file mode 100644 index 0000000000..deb003a594 --- /dev/null +++ b/benchmark/bm_so_exception.rb @@ -0,0 +1,61 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +$HI = 0 +$LO = 0 +NUM = 250000 # Integer(ARGV[0] || 1) + + +class Lo_Exception < Exception + def initialize(num) + @value = num + end +end + +class Hi_Exception < Exception + def initialize(num) + @value = num + end +end + +def some_function(num) + begin + hi_function(num) + rescue + print "We shouldn't get here, exception is: #{$!.type}\n" + end +end + +def hi_function(num) + begin + lo_function(num) + rescue Hi_Exception + $HI = $HI + 1 + end +end + +def lo_function(num) + begin + blowup(num) + rescue Lo_Exception + $LO = $LO + 1 + end +end + +def blowup(num) + if num % 2 == 0 + raise Lo_Exception.new(num) + else + raise Hi_Exception.new(num) + end +end + + +i = 1 +max = NUM+1 +while i < max + i += 1 + some_function(i+1) +end diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb new file mode 100644 index 0000000000..bac5ecd44c --- /dev/null +++ b/benchmark/bm_so_fannkuch.rb @@ -0,0 +1,45 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura +# Modified by Ryan Williams + +def fannkuch(n) + maxFlips, m, r, check = 0, n-1, n, 0 + count = (1..n).to_a + perm = (1..n).to_a + + while true + if check < 30 + puts "#{perm}" + check += 1 + end + + while r != 1 + count[r-1] = r + r -= 1 + end + + if perm[0] != 1 and perm[m] != n + perml = perm.clone #.dup + flips = 0 + while (k = perml.first ) != 1 + perml = perml.slice!(0, k).reverse + perml + flips += 1 + end + maxFlips = flips if flips > maxFlips + end + while true + if r==n then return maxFlips end + perm.insert r,perm.shift + break if (count[r] -= 1) > 0 + r += 1 + end + end +end + +def puts *args +end + +N = 9 # (ARGV[0] || 1).to_i +puts "Pfannkuchen(#{N}) = #{fannkuch(N)}" + diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb new file mode 100644 index 0000000000..dcc6b39507 --- /dev/null +++ b/benchmark/bm_so_fasta.rb @@ -0,0 +1,81 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +$last = 42.0 +def gen_random(max, im=139968, ia=3877, ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im +end + +alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + +iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], +] +homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], +] + +def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) +end + +def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end +end + + +n = (ARGV[0] or 250_000).to_i + +make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) +make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) +make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb new file mode 100644 index 0000000000..dadab3e79c --- /dev/null +++ b/benchmark/bm_so_k_nucleotide.rb @@ -0,0 +1,48 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# contributed by jose fco. gonzalez +# modified by Sokolov Yura + +seq = String.new + +def frecuency( seq,length ) + n, table = seq.length - length + 1, Hash.new(0) + f, i = nil, nil + (0 ... length).each do |f| + (f ... n).step(length) do |i| + table[seq[i,length]] += 1 + end + end + [n,table] + +end + +def sort_by_freq( seq,length ) + n,table = frecuency( seq,length ) + a, b, v = nil, nil, nil + table.sort{|a,b| b[1] <=> a[1]}.each do |v| + puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] + end + puts +end + +def find_seq( seq,s ) + n,table = frecuency( seq,s.length ) + puts "#{table[s].to_s}\t#{s.upcase}" +end + +input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') + +line = input.gets while line !~ /^>THREE/ +line = input.gets + +while (line !~ /^>/) & line do + seq << line.chomp + line = input.gets +end + +[1,2].each {|i| sort_by_freq( seq,i ) } + +%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } + diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb new file mode 100644 index 0000000000..e8f4a2a5f7 --- /dev/null +++ b/benchmark/bm_so_lists.rb @@ -0,0 +1,47 @@ +#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby + +NUM = 300 +SIZE = 10000 + +def test_lists() + # create a list of integers (Li1) from 1 to SIZE + li1 = (1..SIZE).to_a + # copy the list to li2 (not by individual items) + li2 = li1.dup + # remove each individual item from left side of li2 and + # append to right side of li3 (preserving order) + li3 = Array.new + while (not li2.empty?) + li3.push(li2.shift) + end + # li2 must now be empty + # remove each individual item from right side of li3 and + # append to right side of li2 (reversing list) + while (not li3.empty?) + li2.push(li3.pop) + end + # li3 must now be empty + # reverse li1 in place + li1.reverse! + # check that first item is now SIZE + if li1[0] != SIZE then + p "not SIZE" + 0 + else + # compare li1 and li2 for equality + if li1 != li2 then + return(0) + else + # return the length of the list + li1.length + end + end +end + +i = 0 +while i<NUM + i += 1 + result = test_lists() +end + +result diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb new file mode 100644 index 0000000000..76331c64b8 --- /dev/null +++ b/benchmark/bm_so_mandelbrot.rb @@ -0,0 +1,57 @@ +# The Computer Language Benchmarks Game +# http://shootout.alioth.debian.org/ +# +# contributed by Karl von Laudermann +# modified by Jeremy Echols + +size = 600 # ARGV[0].to_i + +puts "P4\n#{size} #{size}" + +ITER = 49 # Iterations - 1 for easy for..in looping +LIMIT_SQUARED = 4.0 # Presquared limit + +byte_acc = 0 +bit_num = 0 + +count_size = size - 1 # Precomputed size for easy for..in looping + +# For..in loops are faster than .upto, .downto, .times, etc. +for y in 0..count_size + for x in 0..count_size + zr = 0.0 + zi = 0.0 + cr = (2.0*x/size)-1.5 + ci = (2.0*y/size)-1.0 + escape = false + + # To make use of the for..in code, we use a dummy variable, + # like one would in C + for dummy in 0..ITER + tr = zr*zr - zi*zi + cr + ti = 2*zr*zi + ci + zr, zi = tr, ti + + if (zr*zr+zi*zi) > LIMIT_SQUARED + escape = true + break + end + end + + byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1) + bit_num += 1 + + # Code is very similar for these cases, but using separate blocks + # ensures we skip the shifting when it's unnecessary, which is most cases. + if (bit_num == 8) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + elsif (x == count_size) + byte_acc <<= (8 - bit_num) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + end + end +end diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb new file mode 100644 index 0000000000..e2c5c8e559 --- /dev/null +++ b/benchmark/bm_so_matrix.rb @@ -0,0 +1,48 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +n = 60 #Integer(ARGV.shift || 1) + +size = 40 + +def mkmatrix(rows, cols) + count = 1 + mx = Array.new(rows) + (0 .. (rows - 1)).each do |bi| + row = Array.new(cols, 0) + (0 .. (cols - 1)).each do |j| + row[j] = count + count += 1 + end + mx[bi] = row + end + mx +end + +def mmult(rows, cols, m1, m2) + m3 = Array.new(rows) + (0 .. (rows - 1)).each do |bi| + row = Array.new(cols, 0) + (0 .. (cols - 1)).each do |j| + val = 0 + (0 .. (cols - 1)).each do |k| + val += m1.at(bi).at(k) * m2.at(k).at(j) + end + row[j] = val + end + m3[bi] = row + end + m3 +end + +m1 = mkmatrix(size, size) +m2 = mkmatrix(size, size) +mm = Array.new +n.times do + mm = mmult(size, size, m1, m2) +end +# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}" + + diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb new file mode 100755 index 0000000000..8c136baa6c --- /dev/null +++ b/benchmark/bm_so_meteor_contest.rb @@ -0,0 +1,563 @@ +#!/usr/bin/env ruby +# +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# contributed by Kevin Barnes (Ruby novice) + +# PROGRAM: the main body is at the bottom. +# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# 2) see how I represent a board as a bitmask by reading the blank_board comments +# 3) read as your mental paths take you + +def print *args +end + +# class to represent all information about a particular rotation of a particular piece +class Rotation + # an array (by location) containing a bit mask for how the piece maps at the given location. + # if the rotation is invalid at that location the mask will contain false + attr_reader :start_masks + + # maps a direction to a relative location. these differ depending on whether it is an even or + # odd row being mapped from + @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 } + @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 } + + def initialize( directions ) + @even_offsets, @odd_offsets = normalize_offsets( get_values( directions )) + + @even_mask = mask_for_offsets( @even_offsets) + @odd_mask = mask_for_offsets( @odd_offsets) + + @start_masks = Array.new(60) + + # create the rotational masks by placing the base mask at the location and seeing if + # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these + # is true the piece cannot be placed + 0.upto(59) do | offset | + mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset) + if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then + imask = compute_required( mask, offset) + @start_masks[offset] = [ mask, imask, imask | mask ] + else + @start_masks[offset] = false + end + end + end + + def compute_required( mask, offset ) + board = blank_board + 0.upto(offset) { | i | board |= 1 << i } + board |= mask + return 0 if (!prunable(board | mask, offset)) + board = flood_fill(board,58) + count = 0 + imask = 0 + 0.upto(59) do | i | + if (board[i] == 0) then + imask |= (1 << i) + count += 1 + end + end + (count > 0 && count < 5) ? imask : 0 + end + + def flood_fill( board, location) + return board if (board[location] == 1) + board |= 1 << location + row, col = location.divmod(6) + board = flood_fill( board, location - 1) if (col > 0) + board = flood_fill( board, location + 1) if (col < 4) + if (row % 2 == 0) then + board = flood_fill( board, location - 7) if (col > 0 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 5) if (col > 0 && row < 9) + else + board = flood_fill( board, location - 5) if (col < 4 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 7) if (col < 4 && row < 9) + end + board + end + + # given a location, produces a list of relative locations covered by the piece at this rotation + def offsets( location) + if is_even( location) then + @even_offsets.collect { | value | value + location } + else + @odd_offsets.collect { | value | value + location } + end + end + + # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows) + # this is hard to explain. imagine we have this partial board: + # 0 0 0 0 0 x [positions 0-5] + # 0 0 1 1 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 1 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # The top-left of the piece is at position 8, the + # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that + # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained + # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row: + # 0 0 0 1 1 x [positions 0-5] + # 0 0 1 0 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 0 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the + # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what + # this function would return + def normalize_offsets( values) + min = values.min + even_min = is_even(min) + other_min = even_min ? min + 6 : min + 7 + other_values = values.collect do | value | + if is_even(value) then + value + 6 - other_min + else + value + 7 - other_min + end + end + values.collect! { | value | value - min } + + if even_min then + [values, other_values] + else + [other_values, values] + end + end + + # produce a bitmask representation of an array of offset locations + def mask_for_offsets( offsets ) + mask = 0 + offsets.each { | value | mask = mask + ( 1 << value ) } + mask + end + + # finds a "safe" position that a position as described by a list of directions can be placed + # without falling off any edge of the board. the values returned a location to place the first piece + # at so it will fit after making the described moves + def start_adjust( directions ) + south = east = 0; + directions.each do | direction | + east += 1 if ( direction == :sw || direction == :nw || direction == :west ) + south += 1 if ( direction == :nw || direction == :ne ) + end + south * 6 + east + end + + # given a set of directions places the piece (as defined by a set of directions) on the board at + # a location that will not take it off the edge + def get_values( directions ) + start = start_adjust(directions) + values = [ start ] + directions.each do | direction | + if (start % 12 >= 6) then + start += @@rotation_odd_adder[direction] + else + start += @@rotation_even_adder[direction] + end + values += [ start ] + end + + # some moves take you back to an existing location, we'll strip duplicates + values.uniq + end +end + +# describes a piece and caches information about its rotations to as to be efficient for iteration +# ATTRIBUTES: +# rotations -- all the rotations of the piece +# type -- a numeic "name" of the piece +# masks -- an array by location of all legal rotational masks (a n inner array) for that location +# placed -- the mask that this piece was last placed at (not a location, but the actual mask used) +class Piece + attr_reader :rotations, :type, :masks + attr_accessor :placed + + # transform hashes that change one direction into another when you either flip or rotate a set of directions + @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne } + @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw } + + def initialize( directions, type ) + @type = type + @rotations = Array.new(); + @map = {} + + generate_rotations( directions ) + directions.collect! { | value | @@flip_converter[value] } + generate_rotations( directions ) + + # creates the masks AND a map that returns [location, rotation] for any given mask + # this is used when a board is found and we want to draw it, otherwise the map is unused + @masks = Array.new(); + 0.upto(59) do | i | + even = true + @masks[i] = @rotations.collect do | rotation | + mask = rotation.start_masks[i] + @map[mask[0]] = [ i, rotation ] if (mask) + mask || nil + end + @masks[i].compact! + end + end + + # rotates a set of directions through all six angles and adds a Rotation to the list for each one + def generate_rotations( directions ) + 6.times do + rotations.push( Rotation.new(directions)) + directions.collect! { | value | @@rotate_converter[value] } + end + end + + # given a board string, adds this piece to the board at whatever location/rotation + # important: the outbound board string is 5 wide, the normal location notation is six wide (padded) + def fill_string( board_string) + location, rotation = @map[@placed] + rotation.offsets(location).each do | offset | + row, col = offset.divmod(6) + board_string[ row*5 + col, 1 ] = @type.to_s + end + end +end + +# a blank bit board having this form: +# +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 1 1 1 1 1 1 +# +# where left lest significant bit is the top left and the most significant is the lower right +# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running +# off the edges or bottom +def blank_board + 0b111111100000100000100000100000100000100000100000100000100000100000 +end + +def full_board + 0b111111111111111111111111111111111111111111111111111111111111111111 +end + +# determines if a location (bit position) is in an even row +def is_even( location) + (location % 12) < 6 +end + +# support function that create three utility maps: +# $converter -- for each row an array that maps a five bit row (via array mapping) +# to the a five bit representation of the bits below it +# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row +# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays +# a region array has three values the first is a mask of bits in the region, +# the second is the count of those bits and the third is identical to the first +# examples: +# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001] +# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001] +# 0b10001 => [ 0b01110, 3, 0b01110 ] +def create_collector_support + odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000] + even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000] + + all_odds = Array.new(0b100000) + all_evens = Array.new(0b100000) + bit_counts = Array.new(0b100000) + new_regions = Array.new(0b100000) + 0.upto(0b11111) do | i | + bit_count = odd = even = 0 + 0.upto(4) do | bit | + if (i[bit] == 1) then + bit_count += 1 + odd |= odd_map[bit] + even |= even_map[bit] + end + end + all_odds[i] = odd + all_evens[i] = even + bit_counts[i] = bit_count + new_regions[i] = create_regions( i) + end + + $converter = [] + 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) } + $bit_counts = bit_counts + $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } } +end + +# determines if a board is punable, meaning that there is no possibility that it +# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces +# that are not a multiple of five. The following board is an example of a prunable board: +# 0 0 1 0 0 +# 0 1 0 0 0 +# 1 1 0 0 0 +# 0 1 0 0 0 +# 0 0 0 0 0 +# ... +# +# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it +# parameters: +# board -- an initial bit board (6 bit padded rows, see blank_board for format) +# location -- starting location, everything above and to the left is already full +# slotting -- set to true only when testing initial pieces, when filling normally +# additional assumptions are possible +# +# Algorithm: +# The algorithm starts at the top row (as determined by location) and iterates a row at a time +# maintainng counts of active open areas (kept in the collector array) each collector contains +# three values at the start of an iteration: +# 0: mask of bits that would be adjacent to the collector in this row +# 1: the number of bits collected so far +# 2: a scratch space starting as zero, but used during the computation to represent +# the empty bits in the new row that are adjacent (position 0) +# The exact procedure is described in-code +def prunable( board, location, slotting = false) + collectors = [] + # loop across the rows + (location / 6).to_i.upto(9) do | row_on | + # obtain a set of regions representing the bits of the current row. + regions = $regions[(board >> (row_on * 6)) & 0b11111] + converter = $converter[row_on] + + # track the number of collectors at the start of the cycle so that + # we don't compute against newly created collectors, only existing collectors + initial_collector_count = collectors.length + + # loop against the regions. For each region of the row + # we will see if it connects to one or more existing collectors. + # if it connects to 1 collector, the bits from the region are added to the + # bits of the collector and the mask is placed in collector[2] + # If the region overlaps more than one collector then all the collectors + # it overlaps with are merged into the first one (the others are set to nil in the array) + # if NO collectors are found then the region is copied as a new collector + regions.each do | region | + collector_found = nil + region_mask = region[2] + initial_collector_count.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + collector_mask = collector[0] + if (collector_mask & region_mask != 0) then + if (collector_found) then + collector_found[0] |= collector_mask + collector_found[1] += collector[1] + collector_found[2] |= collector[2] + collectors[collector_num] = nil + else + collector_found = collector + collector[1] += region[1] + collector[2] |= region_mask + end + end + end + end + if (collector_found == nil) then + collectors.push(Array.new(region)) + end + end + + # check the existing collectors, if any collector overlapped no bits in the region its [2] value will + # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since + # the board is prunable. if it is a multiple of five it is removed. + # Collector that are still active have a new adjacent value [0] set based n the matched bits + # and have [2] cleared out for the next cycle. + collectors.length.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + if (collector[2] == 0) then + return true if (collector[1] % 5 != 0) + collectors[collector_num] = nil + else + # if a collector matches all bits in the row then we can return unprunable early for the + # following reasons: + # 1) there can be no more unavailable bits bince we fill from the top left downward + # 2) all previous regions have been closed or joined so only this region can fail + # 3) this region must be good since there can never be only 1 region that is nuot + # a multiple of five + # this rule only applies when filling normally, so we ignore the rule if we are "slotting" + # in pieces to see what configurations work for them (the only other time this algorithm is used). + return false if (collector[2] == 0b11111 && !slotting) + collector[0] = converter[collector[2]] + collector[2] = 0 + end + end + end + + # get rid of all the empty converters for the next round + collectors.compact! + end + return false if (collectors.length <= 1) # 1 collector or less and the region is fine + collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size +end + +# creates a region given a row mask. see prunable for what a "region" is +def create_regions( value ) + regions = [] + cur_region = 0 + 5.times do | bit | + if (value[bit] == 0) then + cur_region |= 1 << bit + else + if (cur_region != 0 ) then + regions.push( cur_region) + cur_region = 0; + end + end + end + regions.push(cur_region) if (cur_region != 0) + regions +end + +# find up to the counted number of solutions (or all solutions) and prints the final result +def find_all + find_top( 1) + find_top( 0) + print_results +end + +# show the board +def print_results + print "#{@boards_found} solutions found\n\n" + print_full_board( @min_board) + print "\n" + print_full_board( @max_board) + print "\n" +end + +# finds solutions. This special version of the main function is only used for the top level +# the reason for it is basically to force a particular ordering on how the rotations are tested for +# the first piece. It is called twice, first looking for placements of the odd rotations and then +# looking for placements of the even locations. +# +# WHY? +# Since any found solution has an inverse we want to maximize finding solutions that are not already found +# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away +# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier +# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will +# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces +# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the +# maximum number +def find_top( rotation_skip) + board = blank_board + (@pieces.length-1).times do + piece = @pieces.shift + piece.masks[0].each do | mask, imask, cmask | + if ((rotation_skip += 1) % 2 == 0) then + piece.placed = mask + find( 1, 1, board | mask) + end + end + @pieces.push(piece) + end + piece = @pieces.shift + @pieces.push(piece) +end + +# the normail find routine, iterates through the available pieces, checks all rotations at the current location +# and adds any boards found. depth is achieved via recursion. the overall approach is described +# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# parameters: +# start_location -- where to start looking for place for the next piece at +# placed -- number of pieces placed +# board -- current state of the board +# +# see in-code comments +def find( start_location, placed, board) + # find the next location to place a piece by looking for an empty bit + while board[start_location] == 1 + start_location += 1 + end + + @pieces.length.times do + piece = @pieces.shift + piece.masks[start_location].each do | mask, imask, cmask | + if ( board & cmask == imask) then + piece.placed = mask + if (placed == 9) then + add_board + else + find( start_location + 1, placed + 1, board | mask) + end + end + end + @pieces.push(piece) + end +end + +# print the board +def print_full_board( board_string) + 10.times do | row | + print " " if (row % 2 == 1) + 5.times do | col | + print "#{board_string[row*5 + col,1]} " + end + print "\n" + end +end + +# when a board is found we "draw it" into a string and then flip that string, adding both to +# the list (hash) of solutions if they are unique. +def add_board + board_string = "99999999999999999999999999999999999999999999999999" + @all_pieces.each { | piece | piece.fill_string( board_string ) } + save( board_string) + save( board_string.reverse) +end + +# adds a board string to the list (if new) and updates the current best/worst board +def save( board_string) + if (@all_boards[board_string] == nil) then + @min_board = board_string if (board_string < @min_board) + @max_board = board_string if (board_string > @max_board) + @all_boards.store(board_string,true) + @boards_found += 1 + + # the exit motif is a time saver. Ideally the function should return, but those tests + # take noticeable time (performance). + if (@boards_found == @stop_count) then + print_results + exit(0) + end + end +end + + +## +## MAIN BODY :) +## +create_collector_support +@pieces = [ + Piece.new( [ :nw, :ne, :east, :east ], 2), + Piece.new( [ :ne, :se, :east, :ne ], 7), + Piece.new( [ :ne, :east, :ne, :nw ], 1), + Piece.new( [ :east, :sw, :sw, :se ], 6), + Piece.new( [ :east, :ne, :se, :ne ], 5), + Piece.new( [ :east, :east, :east, :se ], 0), + Piece.new( [ :ne, :nw, :se, :east, :se ], 4), + Piece.new( [ :se, :se, :se, :west ], 9), + Piece.new( [ :se, :se, :east, :se ], 8), + Piece.new( [ :east, :east, :sw, :se ], 3) + ]; + +@all_pieces = Array.new( @pieces) + +@min_board = "99999999999999999999999999999999999999999999999999" +@max_board = "00000000000000000000000000000000000000000000000000" +@stop_count = ARGV[0].to_i || 2089 +@all_boards = {} +@boards_found = 0 + +find_all ######## DO IT!!! diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb new file mode 100644 index 0000000000..d6c5bb9e61 --- /dev/null +++ b/benchmark/bm_so_nbody.rb @@ -0,0 +1,148 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# Optimized for Ruby by Jesse Millikan +# From version ported by Michael Neumann from the C gcc version, +# which was written by Christoph Bauer. + +SOLAR_MASS = 4 * Math::PI**2 +DAYS_PER_YEAR = 365.24 + +def _puts *args +end + +class Planet + attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass + + def initialize(x, y, z, vx, vy, vz, mass) + @x, @y, @z = x, y, z + @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR + @mass = mass * SOLAR_MASS + end + + def move_from_i(bodies, nbodies, dt, i) + while i < nbodies + b2 = bodies[i] + dx = @x - b2.x + dy = @y - b2.y + dz = @z - b2.z + + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + mag = dt / (distance * distance * distance) + b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag + + @vx -= dx * b2_mass_mag + @vy -= dy * b2_mass_mag + @vz -= dz * b2_mass_mag + b2.vx += dx * b_mass_mag + b2.vy += dy * b_mass_mag + b2.vz += dz * b_mass_mag + i += 1 + end + + @x += dt * @vx + @y += dt * @vy + @z += dt * @vz + end +end + +def energy(bodies) + e = 0.0 + nbodies = bodies.size + + for i in 0 ... nbodies + b = bodies[i] + e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz) + for j in (i + 1) ... nbodies + b2 = bodies[j] + dx = b.x - b2.x + dy = b.y - b2.y + dz = b.z - b2.z + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + e -= (b.mass * b2.mass) / distance + end + end + e +end + +def offset_momentum(bodies) + px, py, pz = 0.0, 0.0, 0.0 + + for b in bodies + m = b.mass + px += b.vx * m + py += b.vy * m + pz += b.vz * m + end + + b = bodies[0] + b.vx = - px / SOLAR_MASS + b.vy = - py / SOLAR_MASS + b.vz = - pz / SOLAR_MASS +end + +BODIES = [ + # sun + Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0), + + # jupiter + Planet.new( + 4.84143144246472090e+00, + -1.16032004402742839e+00, + -1.03622044471123109e-01, + 1.66007664274403694e-03, + 7.69901118419740425e-03, + -6.90460016972063023e-05, + 9.54791938424326609e-04), + + # saturn + Planet.new( + 8.34336671824457987e+00, + 4.12479856412430479e+00, + -4.03523417114321381e-01, + -2.76742510726862411e-03, + 4.99852801234917238e-03, + 2.30417297573763929e-05, + 2.85885980666130812e-04), + + # uranus + Planet.new( + 1.28943695621391310e+01, + -1.51111514016986312e+01, + -2.23307578892655734e-01, + 2.96460137564761618e-03, + 2.37847173959480950e-03, + -2.96589568540237556e-05, + 4.36624404335156298e-05), + + # neptune + Planet.new( + 1.53796971148509165e+01, + -2.59193146099879641e+01, + 1.79258772950371181e-01, + 2.68067772490389322e-03, + 1.62824170038242295e-03, + -9.51592254519715870e-05, + 5.15138902046611451e-05) +] + +init = 200_000 # ARGV[0] +n = Integer(init) + +offset_momentum(BODIES) + +puts "%.9f" % energy(BODIES) + +nbodies = BODIES.size +dt = 0.01 + +n.times do + i = 0 + while i < nbodies + b = BODIES[i] + b.move_from_i(BODIES, nbodies, dt, i + 1) + i += 1 + end +end + +puts "%.9f" % energy(BODIES) diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb new file mode 100644 index 0000000000..a0513f8c47 --- /dev/null +++ b/benchmark/bm_so_nested_loop.rb @@ -0,0 +1,24 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# from Avi Bryant + +n = 16 # Integer(ARGV.shift || 1) +x = 0 +n.times do + n.times do + n.times do + n.times do + n.times do + n.times do + x += 1 + end + end + end + end + end +end +# puts x + + diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb new file mode 100644 index 0000000000..a65cc78233 --- /dev/null +++ b/benchmark/bm_so_nsieve.rb @@ -0,0 +1,35 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Glenn Parker, March 2005 +# modified by Evan Phoenix, Sept 2006 + +def sieve(m) + flags = Flags.dup[0,m] + count = 0 + pmax = m - 1 + p = 2 + while p <= pmax + unless flags[p].zero? + count += 1 + mult = p + while mult <= pmax + flags[mult] = 0 + mult += p + end + end + p += 1 + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*") + +n.downto(n-2) do |exponent| + break if exponent < 0 + m = (1 << exponent) * 10_000 + # m = (2 ** exponent) * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb new file mode 100644 index 0000000000..6f958ee44e --- /dev/null +++ b/benchmark/bm_so_nsieve_bits.rb @@ -0,0 +1,43 @@ +#!/usr/bin/ruby +#coding: us-ascii +# +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# nsieve-bits in Ruby +# Contributed by Glenn Parker, March 2005 + +CharExponent = 3 +BitsPerChar = 1 << CharExponent +LowMask = BitsPerChar - 1 + +def sieve(m) + items = "\xFF" * ((m / BitsPerChar) + 1) + masks = "" + BitsPerChar.times do |b| + masks << (1 << b).chr + end + + count = 0 + pmax = m - 1 + 2.step(pmax, 1) do |p| + if items[p >> CharExponent][p & LowMask] == 1 + count += 1 + p.step(pmax, p) do |mult| + a = mult >> CharExponent + b = mult & LowMask + items[a] -= masks[b] if items[a][b] != 0 + end + end + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +n.step(n - 2, -1) do |exponent| + break if exponent < 0 + m = 2 ** exponent * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end + diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb new file mode 100644 index 0000000000..e8607c7199 --- /dev/null +++ b/benchmark/bm_so_object.rb @@ -0,0 +1,56 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Aristarkh Zagorodnikov + +class Toggle + def initialize(start_state) + @bool = start_state + end + + def value + @bool + end + + def activate + @bool = !@bool + self + end +end + +class NthToggle < Toggle + def initialize(start_state, max_counter) + super start_state + @count_max = max_counter + @counter = 0 + end + + def activate + @counter += 1 + if @counter >= @count_max + @bool = !@bool + @counter = 0 + end + self + end +end + +n = 1500000 # (ARGV.shift || 1).to_i + +toggle = Toggle.new 1 +5.times do + toggle.activate.value ? 'true' : 'false' +end +n.times do + toggle = Toggle.new 1 +end + +ntoggle = NthToggle.new 1, 3 +8.times do + ntoggle.activate.value ? 'true' : 'false' +end +n.times do + ntoggle = NthToggle.new 1, 3 +end + diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb new file mode 100644 index 0000000000..630b45cb8d --- /dev/null +++ b/benchmark/bm_so_partial_sums.rb @@ -0,0 +1,31 @@ +n = 2_500_000 # (ARGV.shift || 1).to_i + +alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0 + +1.upto(n) do |d| + d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d) + + s0 += (2.0 / 3.0) ** (d - 1.0) + s1 += 1.0 / Math.sqrt(d) + s2 += 1.0 / (d * (d + 1.0)) + s3 += 1.0 / (d3 * ds * ds) + s4 += 1.0 / (d3 * dc * dc) + s5 += 1.0 / d + s6 += 1.0 / d2 + s7 += alt / d + s8 += alt / (2.0 * d - 1.0) + + alt = -alt +end + +if false + printf("%.9f\t(2/3)^k\n", s0) + printf("%.9f\tk^-0.5\n", s1) + printf("%.9f\t1/k(k+1)\n", s2) + printf("%.9f\tFlint Hills\n", s3) + printf("%.9f\tCookson Hills\n", s4) + printf("%.9f\tHarmonic\n", s5) + printf("%.9f\tRiemann Zeta\n", s6) + printf("%.9f\tAlternating Harmonic\n", s7) + printf("%.9f\tGregory\n", s8) +end diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb new file mode 100644 index 0000000000..9a537b2d1c --- /dev/null +++ b/benchmark/bm_so_pidigits.rb @@ -0,0 +1,92 @@ +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Gabriele Renzi + +class PiDigitSpigot + + def initialize() + @z = Transformation.new 1,0,0,1 + @x = Transformation.new 0,0,0,0 + @inverse = Transformation.new 0,0,0,0 + end + + def next! + @y = @z.extract(3) + if safe? @y + @z = produce(@y) + @y + else + @z = consume @x.next!() + next!() + end + end + + def safe?(digit) + digit == @z.extract(4) + end + + def produce(i) + @inverse.qrst(10,-10*i,0,1).compose(@z) + end + + def consume(a) + @z.compose(a) + end +end + + +class Transformation + attr_reader :q, :r, :s, :t + def initialize(q, r, s, t) + @q,@r,@s,@t,@k = q,r,s,t,0 + end + + def next!() + @q = @k = @k + 1 + @r = 4 * @k + 2 + @s = 0 + @t = 2 * @k + 1 + self + end + + def extract(j) + (@q * j + @r) / (@s * j + @t) + end + + def compose(a) + self.class.new( @q * a.q, + @q * a.r + r * a.t, + @s * a.q + t * a.s, + @s * a.r + t * a.t + ) + end + + def qrst *args + initialize *args + self + end + + +end + + +WIDTH = 10 +n = 2_500 # Integer(ARGV[0]) +j = 0 + +digits = PiDigitSpigot.new + +while n > 0 + if n >= WIDTH + WIDTH.times {print digits.next!} + j += WIDTH + else + n.times {print digits.next!} + (WIDTH-n).times {print " "} + j += n + end + puts "\t:"+j.to_s + n -= WIDTH +end + diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb new file mode 100644 index 0000000000..a66b9e8e63 --- /dev/null +++ b/benchmark/bm_so_random.rb @@ -0,0 +1,20 @@ +# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby + +IM = 139968.0 +IA = 3877.0 +IC = 29573.0 + +$last = 42.0 + +def gen_random(max) + (max * ($last = ($last * IA + IC) % IM)) / IM +end + +N = 3_000_000 + +i = 0 +while i<N + i +=1 + gen_random(100.0) +end +# "%.9f" % gen_random(100.0) diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb new file mode 100644 index 0000000000..82ea666994 --- /dev/null +++ b/benchmark/bm_so_reverse_complement.rb @@ -0,0 +1,30 @@ +#!/usr/bin/ruby +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# Contributed by Peter Bjarke Olsen +# Modified by Doug King + +seq=Array.new + +def revcomp(seq) + seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN') + stringlen=seq.length + 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"} +end + +input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb') + +while input.gets + if $_ =~ />/ + if seq.length != 0 + revcomp(seq.join) + seq=Array.new + end + puts $_ + else + $_.sub(/\n/,'') + seq.push $_ + end +end +revcomp(seq.join) diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb new file mode 100644 index 0000000000..43dc302648 --- /dev/null +++ b/benchmark/bm_so_sieve.rb @@ -0,0 +1,24 @@ +# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby +num = 500 +count = i = j = 0 +flags0 = Array.new(8192,1) +k = 0 +while k < num + k += 1 + count = 0 + flags = flags0.dup + i = 2 + while i<8192 + i += 1 + if flags[i] + # remove all multiples of prime: i + j = i*i + while j < 8192 + j += i + flags[j] = nil + end + count += 1 + end + end +end +count diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb new file mode 100644 index 0000000000..6b97206689 --- /dev/null +++ b/benchmark/bm_so_spectralnorm.rb @@ -0,0 +1,50 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +def eval_A(i,j) + return 1.0/((i+j)*(i+j+1)/2+i+1) +end + +def eval_A_times_u(u) + v, i = nil, nil + (0..u.length-1).collect { |i| + v = 0 + for j in 0..u.length-1 + v += eval_A(i,j)*u[j] + end + v + } +end + +def eval_At_times_u(u) + v, i = nil, nil + (0..u.length-1).collect{|i| + v = 0 + for j in 0..u.length-1 + v += eval_A(j,i)*u[j] + end + v + } +end + +def eval_AtA_times_u(u) + return eval_At_times_u(eval_A_times_u(u)) +end + +n = 500 # ARGV[0].to_i + +u=[1]*n +for i in 1..10 + v=eval_AtA_times_u(u) + u=eval_AtA_times_u(v) +end +vBv=0 +vv=0 +for i in 0..n-1 + vBv += u[i]*v[i] + vv += v[i]*v[i] +end + +str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n" +# print str diff --git a/benchmark/bm_string_index.rb b/benchmark/bm_string_index.rb new file mode 100644 index 0000000000..7783111082 --- /dev/null +++ b/benchmark/bm_string_index.rb @@ -0,0 +1,3 @@ +str1 = "あ" * 1024 + "い" # not single byte optimizable +str2 = "い" +100_000.times { str1.index(str2) } diff --git a/benchmark/bm_string_scan_re.rb b/benchmark/bm_string_scan_re.rb new file mode 100644 index 0000000000..b0d60201a9 --- /dev/null +++ b/benchmark/bm_string_scan_re.rb @@ -0,0 +1,2 @@ +str = Array.new(1_000, 'abc').join(',') +1_000.times { str.scan(/abc/) } diff --git a/benchmark/bm_string_scan_str.rb b/benchmark/bm_string_scan_str.rb new file mode 100644 index 0000000000..42440bd948 --- /dev/null +++ b/benchmark/bm_string_scan_str.rb @@ -0,0 +1,2 @@ +str = Array.new(1_000, 'abc').join(',') +1_000.times { str.scan('abc') } diff --git a/benchmark/bm_time_subsec.rb b/benchmark/bm_time_subsec.rb new file mode 100644 index 0000000000..505021c701 --- /dev/null +++ b/benchmark/bm_time_subsec.rb @@ -0,0 +1,2 @@ +t = Time.now +4000000.times { t.subsec } diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb new file mode 100644 index 0000000000..16906f3605 --- /dev/null +++ b/benchmark/bm_vm1_attr_ivar.rb @@ -0,0 +1,14 @@ +class C + attr_reader :a, :b + def initialize + @a = nil + @b = nil + end +end +obj = C.new +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + j = obj.a + k = obj.b +end diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb new file mode 100644 index 0000000000..7e7a6b48c0 --- /dev/null +++ b/benchmark/bm_vm1_attr_ivar_set.rb @@ -0,0 +1,14 @@ +class C + attr_accessor :a, :b + def initialize + @a = nil + @b = nil + end +end +obj = C.new +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + obj.a = 1 + obj.b = 2 +end diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb new file mode 100644 index 0000000000..a9f56b15ea --- /dev/null +++ b/benchmark/bm_vm1_block.rb @@ -0,0 +1,10 @@ +def m + yield +end + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + m{ + } +end diff --git a/benchmark/bm_vm1_blockparam.rb b/benchmark/bm_vm1_blockparam.rb new file mode 100755 index 0000000000..11680a2e61 --- /dev/null +++ b/benchmark/bm_vm1_blockparam.rb @@ -0,0 +1,9 @@ +def m &b +end + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + m{} +end + diff --git a/benchmark/bm_vm1_blockparam_call.rb b/benchmark/bm_vm1_blockparam_call.rb new file mode 100755 index 0000000000..f6102a2b5a --- /dev/null +++ b/benchmark/bm_vm1_blockparam_call.rb @@ -0,0 +1,9 @@ +def m &b + b.call +end + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + m{} +end diff --git a/benchmark/bm_vm1_blockparam_pass.rb b/benchmark/bm_vm1_blockparam_pass.rb new file mode 100755 index 0000000000..10029a257a --- /dev/null +++ b/benchmark/bm_vm1_blockparam_pass.rb @@ -0,0 +1,13 @@ +def bp_yield + yield +end + +def bp_pass &b + bp_yield &b +end + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + bp_pass{} +end diff --git a/benchmark/bm_vm1_blockparam_yield.rb b/benchmark/bm_vm1_blockparam_yield.rb new file mode 100755 index 0000000000..6dc01ced7c --- /dev/null +++ b/benchmark/bm_vm1_blockparam_yield.rb @@ -0,0 +1,9 @@ +def bp_yield &b + yield +end + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + bp_yield{} +end diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb new file mode 100644 index 0000000000..ac59ebccf1 --- /dev/null +++ b/benchmark/bm_vm1_const.rb @@ -0,0 +1,8 @@ +Const = 1 + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + j = Const + k = Const +end diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb new file mode 100644 index 0000000000..a1596145f2 --- /dev/null +++ b/benchmark/bm_vm1_ensure.rb @@ -0,0 +1,11 @@ +i = 0 +while i<30_000_000 # benchmark loop 1 + i += 1 + begin + begin + ensure + end + ensure + end +end + diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb new file mode 100644 index 0000000000..d4581439ff --- /dev/null +++ b/benchmark/bm_vm1_float_simple.rb @@ -0,0 +1,7 @@ +i = 0.0; f = 0.0 +while i<30_000_000 + i += 1 + f += 0.1; f -= 0.1 + f += 0.1; f -= 0.1 + f += 0.1; f -= 0.1 +end diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb new file mode 100644 index 0000000000..e78bca5668 --- /dev/null +++ b/benchmark/bm_vm1_gc_short_lived.rb @@ -0,0 +1,10 @@ +i = 0 +while i<30_000_000 # while loop 1 + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' + i+=1 +end diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb new file mode 100644 index 0000000000..b66052dee0 --- /dev/null +++ b/benchmark/bm_vm1_gc_short_with_complex_long.rb @@ -0,0 +1,27 @@ +def nested_hash h, n + if n == 0 + '' + else + 10.times{ + h[Object.new] = nested_hash(h, n-1) + } + end +end + +long_lived = Hash.new +nested_hash long_lived, 6 + +GC.start +GC.start + +i = 0 +while i<30_000_000 # while loop 1 + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' + i+=1 +end + diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb new file mode 100644 index 0000000000..298dbc845b --- /dev/null +++ b/benchmark/bm_vm1_gc_short_with_long.rb @@ -0,0 +1,13 @@ +long_lived = Array.new(1_000_000){|i| "#{i}"} +GC.start +GC.start +i = 0 +while i<30_000_000 # while loop 1 + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' + i+=1 +end diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb new file mode 100644 index 0000000000..6b15c1b7bf --- /dev/null +++ b/benchmark/bm_vm1_gc_short_with_symbol.rb @@ -0,0 +1,15 @@ +# make many symbols +50_000.times{|i| sym = "sym#{i}".to_sym} +GC.start +GC.start + +i = 0 +while i<30_000_000 # while loop 1 + a = '' # short-lived String + b = '' + c = '' + d = '' + e = '' + f = '' + i+=1 +end diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb new file mode 100644 index 0000000000..1b030386cf --- /dev/null +++ b/benchmark/bm_vm1_gc_wb_ary.rb @@ -0,0 +1,12 @@ +short_lived_ary = [] + +if RUBY_VERSION >= "2.2.0" + GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) +end + +i = 0 +short_lived = '' +while i<30_000_000 # while loop 1 + short_lived_ary[0] = short_lived # write barrier + i+=1 +end diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb new file mode 100644 index 0000000000..ebc369a60f --- /dev/null +++ b/benchmark/bm_vm1_gc_wb_ary_promoted.rb @@ -0,0 +1,14 @@ +long_lived = [] + +if RUBY_VERSION > "2.2.0" + 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) } +elsif + GC.start +end + +i = 0 +short_lived = '' +while i<30_000_000 # while loop 1 + long_lived[0] = short_lived # write barrier + i+=1 +end diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb new file mode 100644 index 0000000000..96f4261915 --- /dev/null +++ b/benchmark/bm_vm1_gc_wb_obj.rb @@ -0,0 +1,15 @@ +class C + attr_accessor :foo +end +short_lived_obj = C.new + +if RUBY_VERSION >= "2.2.0" + GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) +end + +i = 0 +short_lived = '' +while i<30_000_000 # while loop 1 + short_lived_obj.foo = short_lived # write barrier + i+=1 +end diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb new file mode 100644 index 0000000000..674c413992 --- /dev/null +++ b/benchmark/bm_vm1_gc_wb_obj_promoted.rb @@ -0,0 +1,17 @@ +class C + attr_accessor :foo +end +long_lived = C.new + +if RUBY_VERSION >= "2.2.0" + 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) } +elsif + GC.start +end + +i = 0 +short_lived = '' +while i<30_000_000 # while loop 1 + long_lived.foo = short_lived # write barrier + i+=1 +end diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb new file mode 100644 index 0000000000..68a73cf92f --- /dev/null +++ b/benchmark/bm_vm1_ivar.rb @@ -0,0 +1,8 @@ +@a = 1 + +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + j = @a + k = @a +end diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb new file mode 100644 index 0000000000..bd81b06c34 --- /dev/null +++ b/benchmark/bm_vm1_ivar_set.rb @@ -0,0 +1,6 @@ +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + @a = 1 + @b = 2 +end diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb new file mode 100644 index 0000000000..353de3ab0e --- /dev/null +++ b/benchmark/bm_vm1_length.rb @@ -0,0 +1,9 @@ +a = 'abc' +b = [1, 2, 3] +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + a.length + b.length +end + diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb new file mode 100644 index 0000000000..36f2068811 --- /dev/null +++ b/benchmark/bm_vm1_lvar_init.rb @@ -0,0 +1,18 @@ +def m v + unless v + # unreachable code + v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 = + v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 = + v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 = + v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 = + v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1 + end +end + +i = 0 + +while i<30_000_000 # while loop 1 + i += 1 + m i +end + diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb new file mode 100644 index 0000000000..222e864134 --- /dev/null +++ b/benchmark/bm_vm1_lvar_set.rb @@ -0,0 +1,5 @@ +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1 +end diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb new file mode 100644 index 0000000000..bbb4ae07a4 --- /dev/null +++ b/benchmark/bm_vm1_neq.rb @@ -0,0 +1,8 @@ +i = 0 +obj1 = Object.new +obj2 = Object.new + +while i<30_000_000 # while loop 1 + i += 1 + obj1 != obj2 +end diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb new file mode 100644 index 0000000000..b09ecdcc21 --- /dev/null +++ b/benchmark/bm_vm1_not.rb @@ -0,0 +1,7 @@ +i = 0 +obj = Object.new + +while i<30_000_000 # while loop 1 + i += 1 + !obj +end diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb new file mode 100644 index 0000000000..b0d3e2bdfa --- /dev/null +++ b/benchmark/bm_vm1_rescue.rb @@ -0,0 +1,7 @@ +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + begin + rescue + end +end diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb new file mode 100644 index 0000000000..63f9f21675 --- /dev/null +++ b/benchmark/bm_vm1_simplereturn.rb @@ -0,0 +1,9 @@ +def m + return 1 +end +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + m +end + diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb new file mode 100644 index 0000000000..918f8b2112 --- /dev/null +++ b/benchmark/bm_vm1_swap.rb @@ -0,0 +1,8 @@ +a = 1 +b = 2 +i = 0 +while i<30_000_000 # while loop 1 + i += 1 + a, b = b, a +end + diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb new file mode 100644 index 0000000000..775597cea6 --- /dev/null +++ b/benchmark/bm_vm1_yield.rb @@ -0,0 +1,10 @@ +def m + i = 0 + while i<30_000_000 # while loop 1 + i += 1 + yield + end +end + +m{} + diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb new file mode 100644 index 0000000000..df9037c83c --- /dev/null +++ b/benchmark/bm_vm2_array.rb @@ -0,0 +1,5 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + a = [1,2,3,4,5,6,7,8,9,10] +end diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb new file mode 100644 index 0000000000..b02509d6a2 --- /dev/null +++ b/benchmark/bm_vm2_bigarray.rb @@ -0,0 +1,106 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + a = [ + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + 1,2,3,4,5,6,7,8,9,10, + ] +end diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb new file mode 100644 index 0000000000..5e3f437bb8 --- /dev/null +++ b/benchmark/bm_vm2_bighash.rb @@ -0,0 +1,5 @@ +i = 0 +while i<60_000 # benchmark loop 2 + i += 1 + a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,} +end diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb new file mode 100644 index 0000000000..adc6e4df0a --- /dev/null +++ b/benchmark/bm_vm2_case.rb @@ -0,0 +1,14 @@ +i = 0 +while i<6_000_000 # while loop 2 + case :foo + when :bar + raise + when :baz + raise + when :boo + raise + when :foo + i += 1 + end +end + diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb new file mode 100644 index 0000000000..c62b294e0e --- /dev/null +++ b/benchmark/bm_vm2_case_lit.rb @@ -0,0 +1,19 @@ +i = 0 +@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ] +def foo(i) + @ret[i % @ret.size] +end + +while i<6_000_000 # while loop 2 + case foo(i) + when "foo" then :foo + when true then true + when false then false + when :sym then :sym + when 6 then :fix + when nil then nil + when 0.1 then :float + when 0xffffffffffffffff then :big + end + i += 1 +end diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb new file mode 100644 index 0000000000..053ed6c912 --- /dev/null +++ b/benchmark/bm_vm2_defined_method.rb @@ -0,0 +1,9 @@ +class Object + define_method(:m){} +end + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + m; m; m; m; m; m; m; m; +end diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb new file mode 100644 index 0000000000..58c0f7bbc3 --- /dev/null +++ b/benchmark/bm_vm2_dstr.rb @@ -0,0 +1,6 @@ +i = 0 +x = y = 'z' +while i<6_000_000 # benchmark loop 2 + i += 1 + str = "foo#{x}bar#{y}baz" +end diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb new file mode 100644 index 0000000000..307cfc28ef --- /dev/null +++ b/benchmark/bm_vm2_eval.rb @@ -0,0 +1,6 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + eval("1") +end + diff --git a/benchmark/bm_vm2_fiber_switch.rb b/benchmark/bm_vm2_fiber_switch.rb new file mode 100644 index 0000000000..c6f615d71d --- /dev/null +++ b/benchmark/bm_vm2_fiber_switch.rb @@ -0,0 +1,9 @@ +# based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke +fib = Fiber.new do + loop { Fiber.yield } +end +i = 0 +while i< 6_000_000 # benchmark loop 2 + i += 1 + fib.resume +end diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb new file mode 100644 index 0000000000..a8ccff7138 --- /dev/null +++ b/benchmark/bm_vm2_method.rb @@ -0,0 +1,9 @@ +def m + nil +end + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + m; m; m; m; m; m; m; m; +end diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb new file mode 100644 index 0000000000..2badc73101 --- /dev/null +++ b/benchmark/bm_vm2_method_missing.rb @@ -0,0 +1,12 @@ +class C + def method_missing mid + end +end + +obj = C.new + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; +end diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb new file mode 100644 index 0000000000..b4efb4f520 --- /dev/null +++ b/benchmark/bm_vm2_method_with_block.rb @@ -0,0 +1,9 @@ +def m + nil +end + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{}; +end diff --git a/benchmark/bm_vm2_module_ann_const_set.rb b/benchmark/bm_vm2_module_ann_const_set.rb new file mode 100644 index 0000000000..12ccfd2ff3 --- /dev/null +++ b/benchmark/bm_vm2_module_ann_const_set.rb @@ -0,0 +1,5 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + Module.new.const_set(:X, Module.new) +end diff --git a/benchmark/bm_vm2_module_const_set.rb b/benchmark/bm_vm2_module_const_set.rb new file mode 100644 index 0000000000..f4d4c1b2e7 --- /dev/null +++ b/benchmark/bm_vm2_module_const_set.rb @@ -0,0 +1,8 @@ +i = 0 +module M +end +$VERBOSE = nil +while i<6_000_000 # benchmark loop 2 + i += 1 + M.const_set(:X, Module.new) +end diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb new file mode 100644 index 0000000000..5d16480c6b --- /dev/null +++ b/benchmark/bm_vm2_mutex.rb @@ -0,0 +1,9 @@ +require 'thread' + +m = Thread::Mutex.new + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + m.synchronize{} +end diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb new file mode 100644 index 0000000000..6422c9b0d0 --- /dev/null +++ b/benchmark/bm_vm2_newlambda.rb @@ -0,0 +1,5 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + lambda {} +end diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb new file mode 100644 index 0000000000..c82c0e4bce --- /dev/null +++ b/benchmark/bm_vm2_poly_method.rb @@ -0,0 +1,20 @@ +class C1 + def m + 1 + end +end +class C2 + def m + 2 + end +end + +o1 = C1.new +o2 = C2.new + +i = 0 +while i<6_000_000 # benchmark loop 2 + o = (i % 2 == 0) ? o1 : o2 + o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i += 1 +end diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb new file mode 100644 index 0000000000..aa5fd1dd38 --- /dev/null +++ b/benchmark/bm_vm2_poly_method_ov.rb @@ -0,0 +1,20 @@ +class C1 + def m + 1 + end +end +class C2 + def m + 2 + end +end + +o1 = C1.new +o2 = C2.new + +i = 0 +while i<6_000_000 # benchmark loop 2 + o = (i % 2 == 0) ? o1 : o2 +# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i += 1 +end diff --git a/benchmark/bm_vm2_poly_singleton.rb b/benchmark/bm_vm2_poly_singleton.rb new file mode 100644 index 0000000000..0dba4320c4 --- /dev/null +++ b/benchmark/bm_vm2_poly_singleton.rb @@ -0,0 +1,14 @@ +class C1 + def m; 1; end +end + +o1 = C1.new +o2 = C1.new +o2.singleton_class + +i = 0 +while i<6_000_000 # benchmark loop 2 + o = (i % 2 == 0) ? o1 : o2 + o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i += 1 +end diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb new file mode 100644 index 0000000000..65e5217371 --- /dev/null +++ b/benchmark/bm_vm2_proc.rb @@ -0,0 +1,14 @@ +def m &b + b +end + +pr = m{ + a = 1 +} + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + pr.call +end + diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb new file mode 100644 index 0000000000..aa5387987f --- /dev/null +++ b/benchmark/bm_vm2_raise1.rb @@ -0,0 +1,18 @@ +def rec n + if n > 0 + rec n-1 + else + raise + end +end + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + + begin + rec 1 + rescue + # ignore + end +end diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb new file mode 100644 index 0000000000..1f61c63157 --- /dev/null +++ b/benchmark/bm_vm2_raise2.rb @@ -0,0 +1,18 @@ +def rec n + if n > 0 + rec n-1 + else + raise + end +end + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + + begin + rec 10 + rescue + # ignore + end +end diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb new file mode 100644 index 0000000000..55f9e957a3 --- /dev/null +++ b/benchmark/bm_vm2_regexp.rb @@ -0,0 +1,6 @@ +i = 0 +str = 'xxxhogexxx' +while i<6_000_000 # benchmark loop 2 + /hoge/ =~ str + i += 1 +end diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb new file mode 100644 index 0000000000..6a3ab6fdab --- /dev/null +++ b/benchmark/bm_vm2_send.rb @@ -0,0 +1,12 @@ +class C + def m + end +end + +o = C.new + +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + o.__send__ :m +end diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb new file mode 100644 index 0000000000..1d73036849 --- /dev/null +++ b/benchmark/bm_vm2_string_literal.rb @@ -0,0 +1,5 @@ +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx" +end diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb new file mode 100644 index 0000000000..22cb26b0a5 --- /dev/null +++ b/benchmark/bm_vm2_struct_big_aref_hi.rb @@ -0,0 +1,7 @@ +s = Struct.new(*('a'..'z').map { |x| x.to_sym }) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x.z # x[25] +end diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb new file mode 100644 index 0000000000..5e61a7087e --- /dev/null +++ b/benchmark/bm_vm2_struct_big_aref_lo.rb @@ -0,0 +1,7 @@ +s = Struct.new(*('a'..'z').map { |x| x.to_sym }) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x.k # x[10] +end diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb new file mode 100644 index 0000000000..5a1c3d16f3 --- /dev/null +++ b/benchmark/bm_vm2_struct_big_aset.rb @@ -0,0 +1,7 @@ +s = Struct.new(*('a'..'z').map { |x| x.to_sym }) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x.k = i # x[10] = i +end diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb new file mode 100644 index 0000000000..fff940a80a --- /dev/null +++ b/benchmark/bm_vm2_struct_big_href_hi.rb @@ -0,0 +1,7 @@ +s = Struct.new(*('a'..'z').map { |x| x.to_sym }) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x[:z] +end diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb new file mode 100644 index 0000000000..5e4085d59d --- /dev/null +++ b/benchmark/bm_vm2_struct_big_href_lo.rb @@ -0,0 +1,7 @@ +s = Struct.new(*('a'..'z').map { |x| x.to_sym }) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x[:k] +end diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb new file mode 100644 index 0000000000..9c0cee4141 --- /dev/null +++ b/benchmark/bm_vm2_struct_big_hset.rb @@ -0,0 +1,7 @@ +s = Struct.new(*('a'..'z').map { |x| x.to_sym }) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x[:k] = i +end diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb new file mode 100644 index 0000000000..8eaa555b41 --- /dev/null +++ b/benchmark/bm_vm2_struct_small_aref.rb @@ -0,0 +1,7 @@ +s = Struct.new(:a, :b, :c) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x.a +end diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb new file mode 100644 index 0000000000..ecd0f95669 --- /dev/null +++ b/benchmark/bm_vm2_struct_small_aset.rb @@ -0,0 +1,7 @@ +s = Struct.new(:a, :b, :c) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x.a = i +end diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb new file mode 100644 index 0000000000..2c88fee6bf --- /dev/null +++ b/benchmark/bm_vm2_struct_small_href.rb @@ -0,0 +1,7 @@ +s = Struct.new(:a, :b, :c) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x[:a] +end diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb new file mode 100644 index 0000000000..33c36d20f1 --- /dev/null +++ b/benchmark/bm_vm2_struct_small_hset.rb @@ -0,0 +1,7 @@ +s = Struct.new(:a, :b, :c) +x = s.new +i = 0 +while i<6_000_000 # benchmark loop 2 + i += 1 + x[:a] = 1 +end diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb new file mode 100644 index 0000000000..afd8579e7b --- /dev/null +++ b/benchmark/bm_vm2_super.rb @@ -0,0 +1,20 @@ + +class C + def m + 1 + end +end + +class CC < C + def m + super() + end +end + +obj = CC.new + +i = 0 +while i<6_000_000 # benchmark loop 2 + obj.m + i += 1 +end diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb new file mode 100644 index 0000000000..1774625942 --- /dev/null +++ b/benchmark/bm_vm2_unif1.rb @@ -0,0 +1,8 @@ +i = 0 +def m a, b +end + +while i<6_000_000 # benchmark loop 2 + i += 1 + m 100, 200 +end diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb new file mode 100644 index 0000000000..2a43e62217 --- /dev/null +++ b/benchmark/bm_vm2_zsuper.rb @@ -0,0 +1,20 @@ +i = 0 + +class C + def m a + 1 + end +end + +class CC < C + def m a + super + end +end + +obj = CC.new + +while i<6_000_000 # benchmark loop 2 + obj.m 10 + i += 1 +end diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb new file mode 100644 index 0000000000..0fbf73e1ca --- /dev/null +++ b/benchmark/bm_vm3_backtrace.rb @@ -0,0 +1,22 @@ +# get last backtrace + +begin + caller(0, 0) +rescue ArgumentError + alias caller_orig caller + def caller lev, n + caller_orig(lev)[0..n] + end +end + +def rec n + if n < 0 + 100_000.times{ + caller(0, 1) + } + else + rec(n-1) + end +end + +rec 50 diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb new file mode 100644 index 0000000000..9661323cd2 --- /dev/null +++ b/benchmark/bm_vm3_clearmethodcache.rb @@ -0,0 +1,8 @@ +i = 0 +while i<200_000 + i += 1 + + Class.new{ + def m; end + } +end diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb new file mode 100644 index 0000000000..e668026915 --- /dev/null +++ b/benchmark/bm_vm3_gc.rb @@ -0,0 +1,6 @@ +5000.times do + 100.times do + {"xxxx"=>"yyyy"} + end + GC.start +end diff --git a/benchmark/bm_vm3_gc_old_full.rb b/benchmark/bm_vm3_gc_old_full.rb new file mode 100644 index 0000000000..cfdfc8c5a5 --- /dev/null +++ b/benchmark/bm_vm3_gc_old_full.rb @@ -0,0 +1,4 @@ +old_object = Array.new(1_000_000){''} +100.times do + GC.start +end diff --git a/benchmark/bm_vm3_gc_old_immediate.rb b/benchmark/bm_vm3_gc_old_immediate.rb new file mode 100644 index 0000000000..ad22feb655 --- /dev/null +++ b/benchmark/bm_vm3_gc_old_immediate.rb @@ -0,0 +1,4 @@ +old_object = Array.new(1_000_000){''} +30_000.times do + GC.start(full_mark: false, immediate_sweep: true) +end diff --git a/benchmark/bm_vm3_gc_old_lazy.rb b/benchmark/bm_vm3_gc_old_lazy.rb new file mode 100644 index 0000000000..b74d44baf1 --- /dev/null +++ b/benchmark/bm_vm3_gc_old_lazy.rb @@ -0,0 +1,4 @@ +old_object = Array.new(1_000_000){''} +30_000.times do + GC.start(full_mark: false, immediate_sweep: false) +end diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb new file mode 100644 index 0000000000..1d433353e1 --- /dev/null +++ b/benchmark/bm_vm_symbol_block_pass.rb @@ -0,0 +1,13 @@ +class C + 1000.times {|i| + eval("def i#{i};end") + } +end + +c = C.new +m = C.instance_methods(false) +5_000.times do + m.each do |n| + c.tap(&n) + end +end diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb new file mode 100644 index 0000000000..c993accdda --- /dev/null +++ b/benchmark/bm_vm_thread_alive_check1.rb @@ -0,0 +1,6 @@ +5_000.times{ + t = Thread.new{} + while t.alive? + Thread.pass + end +} diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb new file mode 100644 index 0000000000..3e9a265ce8 --- /dev/null +++ b/benchmark/bm_vm_thread_close.rb @@ -0,0 +1,6 @@ +1000.times { Thread.new { sleep } } +i = 0 +while i<100_000 # benchmark loop 3 + i += 1 + IO.pipe.each(&:close) +end diff --git a/benchmark/bm_vm_thread_condvar1.rb b/benchmark/bm_vm_thread_condvar1.rb new file mode 100644 index 0000000000..cf5706b23e --- /dev/null +++ b/benchmark/bm_vm_thread_condvar1.rb @@ -0,0 +1,28 @@ +# two threads, two mutex, two condvar ping-pong +require 'thread' +m1 = Mutex.new +m2 = Mutex.new +cv1 = ConditionVariable.new +cv2 = ConditionVariable.new +max = 100000 +i = 0 +wait = nil +m2.synchronize do + wait = Thread.new do + m1.synchronize do + m2.synchronize { cv2.signal } + while (i += 1) < max + cv1.wait(m1) + cv2.signal + end + end + end + cv2.wait(m2) +end +m1.synchronize do + while i < max + cv1.signal + cv2.wait(m1) + end +end +wait.join diff --git a/benchmark/bm_vm_thread_condvar2.rb b/benchmark/bm_vm_thread_condvar2.rb new file mode 100644 index 0000000000..7c8dc19481 --- /dev/null +++ b/benchmark/bm_vm_thread_condvar2.rb @@ -0,0 +1,35 @@ +# many threads, one mutex, many condvars +require 'thread' +m = Mutex.new +cv1 = ConditionVariable.new +cv2 = ConditionVariable.new +max = 1000 +n = 100 +waiting = 0 +scvs = [] +waiters = n.times.map do |i| + start_cv = ConditionVariable.new + scvs << start_cv + start_mtx = Mutex.new + start_mtx.synchronize do + th = Thread.new(start_mtx, start_cv) do |sm, scv| + m.synchronize do + sm.synchronize { scv.signal } + max.times do + cv2.signal if (waiting += 1) == n + cv1.wait(m) + end + end + end + start_cv.wait(start_mtx) + th + end +end +m.synchronize do + max.times do + cv2.wait(m) until waiting == n + waiting = 0 + cv1.broadcast + end +end +waiters.each(&:join) diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb new file mode 100644 index 0000000000..393cd45df9 --- /dev/null +++ b/benchmark/bm_vm_thread_create_join.rb @@ -0,0 +1,6 @@ +i = 0 +while i<100_000 # benchmark loop 3 + i += 1 + Thread.new{ + }.join +end diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb new file mode 100644 index 0000000000..66e42c85e1 --- /dev/null +++ b/benchmark/bm_vm_thread_mutex1.rb @@ -0,0 +1,21 @@ +# one thread, one mutex (no contention) + +require 'thread' +m = Thread::Mutex.new +r = 0 +max = 2000 +lmax = max * max +(1..1).map{ + Thread.new{ + i = 0 + while i<lmax + i += 1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb new file mode 100644 index 0000000000..6e6c804c31 --- /dev/null +++ b/benchmark/bm_vm_thread_mutex2.rb @@ -0,0 +1,21 @@ +# two threads, one mutex + +require 'thread' +m = Thread::Mutex.new +r = 0 +max = 2000 +lmax = (max * max)/2 +(1..2).map{ + Thread.new{ + i = 0 + while i<lmax + i += 1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb new file mode 100644 index 0000000000..c750dc542a --- /dev/null +++ b/benchmark/bm_vm_thread_mutex3.rb @@ -0,0 +1,20 @@ +# 1000 threads, one mutex + +require 'thread' +m = Thread::Mutex.new +r = 0 +max = 2000 +(1..max).map{ + Thread.new{ + i = 0 + while i<max + i += 1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb new file mode 100644 index 0000000000..b5b3c0bc85 --- /dev/null +++ b/benchmark/bm_vm_thread_pass.rb @@ -0,0 +1,15 @@ +# Plenty Thtread.pass +# A performance may depend on GVL implementation. + +tmax = (ARGV.shift || 2).to_i +lmax = 200_000 / tmax + +(1..tmax).map{ + Thread.new{ + lmax.times{ + Thread.pass + } + } +}.each{|t| t.join} + + diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb new file mode 100644 index 0000000000..a660aafc18 --- /dev/null +++ b/benchmark/bm_vm_thread_pass_flood.rb @@ -0,0 +1,10 @@ +# n.b. this is a good test for GVL when pinned to a single CPU + +1000.times{ + Thread.new{loop{Thread.pass}} +} + +i = 0 +while i<10000 + i += 1 +end diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb new file mode 100644 index 0000000000..112a621905 --- /dev/null +++ b/benchmark/bm_vm_thread_pipe.rb @@ -0,0 +1,17 @@ +# Measure small and plenty pipe read/write. +# A performance may depend on GVL implementation. + +lmax = 100_000 +r, w = IO.pipe +[Thread.new{ + lmax.times{ + w.write('a') + } + p "w:exit" +}, Thread.new{ + lmax.times{ + r.read(1) + } + p "r:exit" +}].each{|t| t.join} + diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb new file mode 100644 index 0000000000..274ceda366 --- /dev/null +++ b/benchmark/bm_vm_thread_queue.rb @@ -0,0 +1,18 @@ +require 'thread' + +n = 1_000_000 +q = Thread::Queue.new +consumer = Thread.new{ + while q.pop + # consuming + end +} + +producer = Thread.new{ + n.times{ + q.push true + } + q.push nil +} + +consumer.join diff --git a/benchmark/bm_vm_thread_sized_queue.rb b/benchmark/bm_vm_thread_sized_queue.rb new file mode 100644 index 0000000000..7b9af5482b --- /dev/null +++ b/benchmark/bm_vm_thread_sized_queue.rb @@ -0,0 +1,20 @@ +require 'thread' +# on producer, one consumer + +n = 1_000_000 +q = Thread::SizedQueue.new(100) +consumer = Thread.new{ + while q.pop + # consuming + end +} + +producer = Thread.new{ + while n > 0 + q.push true + n -= 1 + end + q.push nil +} + +consumer.join diff --git a/benchmark/bm_vm_thread_sized_queue2.rb b/benchmark/bm_vm_thread_sized_queue2.rb new file mode 100644 index 0000000000..de9f55e978 --- /dev/null +++ b/benchmark/bm_vm_thread_sized_queue2.rb @@ -0,0 +1,23 @@ +require 'thread' +# one producer, many consumers +n = 1_000_000 +m = 10 +q = Thread::SizedQueue.new(100) +consumers = m.times.map do + Thread.new do + while q.pop + # consuming + end + end +end + +producer = Thread.new do + while n > 0 + q.push true + n -= 1 + end + m.times { q.push nil } +end + +producer.join +consumers.each(&:join) diff --git a/benchmark/bm_vm_thread_sized_queue3.rb b/benchmark/bm_vm_thread_sized_queue3.rb new file mode 100644 index 0000000000..ce5f1796d8 --- /dev/null +++ b/benchmark/bm_vm_thread_sized_queue3.rb @@ -0,0 +1,22 @@ +require 'thread' +# many producers, one consumer +n = 1_000_000 +m = 10 +q = Thread::SizedQueue.new(100) +consumer = Thread.new do + while q.pop + # consuming + end +end + +producers = m.times.map do + Thread.new do + while n > 0 + q.push true + n -= 1 + end + end +end +producers.each(&:join) +q.push nil +consumer.join diff --git a/benchmark/bm_vm_thread_sized_queue4.rb b/benchmark/bm_vm_thread_sized_queue4.rb new file mode 100644 index 0000000000..a9b7d80ec0 --- /dev/null +++ b/benchmark/bm_vm_thread_sized_queue4.rb @@ -0,0 +1,26 @@ +require 'thread' +# many producers, many consumers +nr = 1_000_000 +n = 10 +m = 10 +q = Thread::SizedQueue.new(100) +consumers = n.times.map do + Thread.new do + while q.pop + # consuming + end + end +end + +producers = m.times.map do + Thread.new do + while nr > 0 + q.push true + nr -= 1 + end + end +end + +producers.each(&:join) +n.times { q.push nil } +consumers.each(&:join) diff --git a/benchmark/driver.rb b/benchmark/driver.rb new file mode 100755 index 0000000000..469fc99f40 --- /dev/null +++ b/benchmark/driver.rb @@ -0,0 +1,441 @@ +#!/usr/bin/env ruby +# +# Ruby Benchmark driver +# + +first = true + +begin + require 'optparse' +rescue LoadError + if first + first = false + $:.unshift File.join(File.dirname(__FILE__), '../lib') + retry + else + raise + end +end + +require 'benchmark' +require 'pp' +require 'tempfile' + +class BenchmarkDriver + def self.benchmark(opt) + driver = self.new(opt[:execs], opt[:dir], opt) + begin + driver.run + ensure + driver.show_results + end + end + + def self.load(input, type, opt) + case type + when 'yaml' + require 'yaml' + h = YAML.load(input) + when 'json' + require 'json' + h = JSON.load(input) + else + h = eval(input.read) + end + results = h[:results] || h["results"] + obj = allocate + obj.instance_variable_set("@execs", h[:executables] || h["executables"]) + obj.instance_variable_set("@results", results) + obj.instance_variable_set("@opt", opt) + [1, 2].each do |i| + loop = results.assoc((n = "loop_whileloop#{i}").intern) || results.assoc(n) + obj.instance_variable_set("@loop_wl#{i}", loop ? loop[1].map {|t,*|t} : nil) + end + obj.instance_variable_set("@measure_target", opt[:measure_target] || opt["measure_target"]) + obj + end + + def output *args + puts(*args) + @output and @output.puts(*args) + end + + def message *args + output(*args) if @verbose + end + + def message_print *args + if @verbose + print(*args) + STDOUT.flush + @output and @output.print(*args) + end + end + + def progress_message *args + unless STDOUT.tty? + STDERR.print(*args) + STDERR.flush + end + end + + def initialize execs, dir, opt = {} + @execs = execs.map{|e| + e.strip! + next if e.empty? + + if /(.+)::(.+)/ =~ e + # ex) ruby-a::/path/to/ruby-a + label = $1.strip + path = $2 + version = `#{path} -v`.chomp + else + path = e + version = label = `#{path} -v`.chomp + end + [path, label, version] + }.compact + + @dir = dir + @repeat = opt[:repeat] || 1 + @repeat = 1 if @repeat < 1 + @pattern = opt[:pattern] || nil + @exclude = opt[:exclude] || nil + @verbose = opt[:quiet] ? false : (opt[:verbose] || false) + @output = opt[:output] ? open(opt[:output], 'w') : nil + @loop_wl1 = @loop_wl2 = nil + @ruby_arg = opt[:ruby_arg] || nil + @measure_target = opt[:measure_target] + @opt = opt + + # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...] + @results = [] + + if @verbose + @start_time = Time.now + message @start_time + @execs.each_with_index{|(path, label, version), i| + message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\"" + } + message "measure target: #{@measure_target}" + end + end + + def adjusted_results name, results + s = nil + results.each_with_index{|e, i| + r = e.min + case name + when /^vm1_/ + if @loop_wl1 + r -= @loop_wl1[i] + r = 0 if r < 0 + s = '*' + end + when /^vm2_/ + if @loop_wl2 + r -= @loop_wl2[i] + r = 0 if r < 0 + s = '*' + end + end + yield r + } + s + end + + def show_results + case @opt[:format] + when :tsv + strformat = "\t%1$s" + numformat = "\t%1$*2$.3f" + minwidth = 0 + name_width = 0 + when :markdown + markdown = true + strformat = "|%1$-*2$s" + numformat = "|%1$*2$.3f" + when :plain + strformat = " %1$-*2$s" + numformat = " %1$*2$.3f" + end + + name_width ||= @results.map {|v, result| + v.size + (case v; when /^vm1_/; @loop_wl1; when /^vm2_/; @loop_wl2; end ? 1 : 0) + }.max + minwidth ||= 7 + width = @execs.map{|(_, v)| [v.size, minwidth].max} + + output + + if @verbose + message '-----------------------------------------------------------' + message 'raw data:' + message + message PP.pp(@results, "", 79) + message + message "Elapsed time: #{Time.now - @start_time} (sec)" + end + + if rawdata_output = @opt[:rawdata_output] + h = {} + h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo') + h[:executables] = @execs + h[:results] = @results + if (type = File.extname(rawdata_output)).empty? + type = rawdata_output + rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output + end + case type + when 'yaml' + require 'yaml' + h = YAML.dump(h) + when 'json' + require 'json' + h = JSON.pretty_generate(h) + else + require 'pp' + h = h.pretty_inspect + end + open(rawdata_output, 'w') {|f| f.puts h} + end + + output '-----------------------------------------------------------' + output 'benchmark results:' + + if @verbose and @repeat > 1 + output "minimum results in each #{@repeat} measurements." + end + + output({ + real: "Execution time (sec)", + peak: "Memory usage (peak) (B)", + size: "Memory usage (last size) (B)", + }[@measure_target]) + output if markdown + output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip + output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown + @results.each{|v, result| + rets = [] + s = adjusted_results(v, result){|r| + rets << sprintf(numformat, r, width[rets.size]) + } + v += s if s + output [v.ljust(name_width), rets].join("") + } + + if @execs.size > 1 + output + output({ + real: "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)", + peak: "Memory consuming ratio (peak) with the result of `#{@execs[0][1]}' (greater is better)", + size: "Memory consuming ratio (size) with the result of `#{@execs[0][1]}' (greater is better)", + }[@measure_target]) + output if markdown + output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip + output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown + @results.each{|v, result| + rets = [] + first_value = nil + s = adjusted_results(v, result){|r| + if first_value + if r == 0 + rets << "Error" + else + rets << sprintf(numformat, first_value/Float(r), width[rets.size+1]) + end + else + first_value = r + end + } + v += s if s + output [v.ljust(name_width), rets].join("") + } + end + + if @opt[:output] + output + output "Log file: #{@opt[:output]}" + end + end + + def files + flag = {} + @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file| + next if @pattern && /#{@pattern}/ !~ File.basename(file) + next if @exclude && /#{@exclude}/ =~ File.basename(file) + case file + when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/ + flag[$1] = true + end + file + }.compact + + if flag['vm1'] && !flag['whileloop'] + @files << File.join(@dir, 'bm_loop_whileloop.rb') + elsif flag['vm2'] && !flag['whileloop2'] + @files << File.join(@dir, 'bm_loop_whileloop2.rb') + end + + @files.sort! + progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n" + @files + end + + def run + files.each_with_index{|file, i| + @i = i + r = measure_file(file) + + if /bm_loop_whileloop.rb/ =~ file + @loop_wl1 = r[1].map{|e| e.min} + elsif /bm_loop_whileloop2.rb/ =~ file + @loop_wl2 = r[1].map{|e| e.min} + end + } + end + + def measure_file file + name = File.basename(file, '.rb').sub(/^bm_/, '') + prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb") + load prepare_file if FileTest.exist?(prepare_file) + + if @verbose + output + output '-----------------------------------------------------------' + output name + output + output File.read(file) + output + end + + result = [name] + result << @execs.map{|(e, v)| + (0...@repeat).map{ + message_print "#{v}\t" + progress_message '.' + + m = measure(e, file) + message "#{m}" + m + } + } + @results << result + result + end + + unless defined?(File::NULL) + if File.exist?('/dev/null') + File::NULL = '/dev/null' + end + end + + def measure executable, file + case @measure_target + when :real + cmd = "#{executable} #{@ruby_arg} #{file}" + m = Benchmark.measure{ + system(cmd, out: File::NULL) + } + result = m.real + when :peak, :size + tmp = Tempfile.new("benchmark-memory-wrapper-data") + wrapper = "#{File.join(__dir__, 'memory_wrapper.rb')} #{tmp.path} #{@measure_target}" + cmd = "#{executable} #{@ruby_arg} #{wrapper} #{file}" + system(cmd, out: File::NULL) + result = tmp.read.to_i + tmp.close + else + raise "unknown measure target" + end + + if $? != 0 + raise $?.inspect if $? && $?.signaled? + output "\`#{cmd}\' exited with abnormal status (#{$?})" + 0 + else + result + end + end +end + +if __FILE__ == $0 + opt = { + :execs => [], + :dir => File.dirname(__FILE__), + :repeat => 1, + :measure_target => :real, + :output => nil, + :raw_output => nil, + :format => :tsv, + } + formats = { + :tsv => ".tsv", + :markdown => ".md", + :plain => ".txt", + } + + parser = OptionParser.new{|o| + o.on('-e', '--executables [EXECS]', + "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e| + e.split(/;/).each{|path| + opt[:execs] << path + } + } + o.on('--rbenv [VERSIONS]', 'Specify benchmark targets with rbenv version (vX.X.X;vX.X.X;...)'){|v| + v.split(/;/).each{|version| + opt[:execs] << "#{version}::#{`RBENV_VERSION='#{version}' rbenv which ruby`.rstrip}" + } + } + o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d| + opt[:dir] = d + } + o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p| + opt[:pattern] = p + } + o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e| + opt[:exclude] = e + } + o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n| + opt[:repeat] = n.to_i + } + o.on('-o', '--output-file [FILE]', "Output file"){|f| + opt[:output] = f + } + o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a| + opt[:ruby_arg] = a + } + o.on('--measure-target [TARGET]', 'real (execution time), peak, size (memory)'){|mt| + opt[:measure_target] = mt.to_sym + } + o.on('--rawdata-output [FILE]', 'output rawdata'){|r| + opt[:rawdata_output] = r + } + o.on('--load-rawdata=FILE', 'input rawdata'){|r| + opt[:rawdata_input] = r + } + o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r| + opt[:format] = r + } + o.on('-v', '--verbose'){|v| + opt[:verbose] = v + } + o.on('-q', '--quiet', "Run without notify information except result table."){|q| + opt[:quiet] = q + opt[:verbose] = false + } + } + + parser.parse!(ARGV) + + if input = opt[:rawdata_input] + b = open(input) {|f| + BenchmarkDriver.load(f, File.extname(input)[1..-1], opt) + } + b.show_results + else + opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}" + BenchmarkDriver.benchmark(opt) + end +end + diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb new file mode 100644 index 0000000000..2eed7abc83 --- /dev/null +++ b/benchmark/gc/aobench.rb @@ -0,0 +1 @@ +require_relative '../bm_app_aobench.rb' diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb new file mode 100644 index 0000000000..af8ea722aa --- /dev/null +++ b/benchmark/gc/binary_trees.rb @@ -0,0 +1 @@ +require_relative '../bm_so_binary_trees.rb' diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb new file mode 100644 index 0000000000..09a404466a --- /dev/null +++ b/benchmark/gc/gcbench.rb @@ -0,0 +1,56 @@ +require 'benchmark' +require 'pp' +require 'optparse' + +$list = true +$gcprof = true + +opt = OptionParser.new +opt.on('-q'){$list = false} +opt.on('-d'){$gcprof = false} +opt.parse!(ARGV) + +script = File.join(File.dirname(__FILE__), ARGV.shift) +script += '.rb' unless FileTest.exist?(script) +raise "#{script} not found" unless FileTest.exist?(script) + +puts "Script: #{script}" + +if $gcprof + GC::Profiler.enable +end + +tms = Benchmark.measure{|x| + load script +} + +gc_time = 0 + +if $gcprof + gc_time = GC::Profiler.total_time + GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop + GC::Profiler.disable +end + +pp GC.stat + +puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS) + +desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}" +name = File.basename(script, '.rb') + +puts +puts script +puts Benchmark::CAPTION +puts tms +puts "GC total time (sec): #{gc_time}" + +# show High-Water Mark on Linux +if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status') + puts + puts "VmHWM: #{$1.chomp}" +end + +puts +puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}" +puts " (real time in sec, GC time in sec, GC count)" diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb new file mode 100644 index 0000000000..cb030d458d --- /dev/null +++ b/benchmark/gc/hash1.rb @@ -0,0 +1,11 @@ +value = 0.01 +h = {} +n = 50_000 + +1.upto(n){|i| + h["%020d" % i] = "v-#{i}" +} + +(n * 1_000).times{ + '' +} diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb new file mode 100644 index 0000000000..e8c943fb21 --- /dev/null +++ b/benchmark/gc/hash2.rb @@ -0,0 +1,7 @@ +value = 0.01 +h = {} +n = 4*(10**6) + +1.upto(n){|i| + h["%020d" % i] = value * i +} diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb new file mode 100644 index 0000000000..c05a79f561 --- /dev/null +++ b/benchmark/gc/null.rb @@ -0,0 +1 @@ +# null diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb new file mode 100644 index 0000000000..94ba74be89 --- /dev/null +++ b/benchmark/gc/pentomino.rb @@ -0,0 +1 @@ +require_relative '../bm_app_pentomino.rb' diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb new file mode 100644 index 0000000000..14c89f5611 --- /dev/null +++ b/benchmark/gc/rdoc.rb @@ -0,0 +1,13 @@ +require 'rdoc/rdoc' +require 'tmpdir' + +srcdir = File.expand_path('../..', __dir__) + +Dir.mktmpdir('rdocbench-'){|d| + dir = File.join(d, 'rdocbench') + args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir}) + args << '--op' << dir + + r = RDoc::RDoc.new + r.document args +} diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb new file mode 100644 index 0000000000..c66290140a --- /dev/null +++ b/benchmark/gc/redblack.rb @@ -0,0 +1,366 @@ +# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb +# License is License is Apache-2 + +require 'benchmark' + +# Algorithm based on "Introduction to Algorithms" by Cormen and others +class RedBlackTree + class Node + attr_accessor :color + attr_accessor :key + attr_accessor :left + attr_accessor :right + attr_accessor :parent + + RED = :red + BLACK = :black + COLORS = [RED, BLACK].freeze + + def initialize(key, color = RED) + raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color) + @color = color + @key = key + @left = @right = @parent = NilNode.instance + end + + def black? + return color == BLACK + end + + def red? + return color == RED + end + end + + class NilNode < Node + class << self + private :new + + # it's not thread safe + def instance + @instance ||= begin + def instance + return @instance + end + + new + end + end + end + + def initialize + self.color = BLACK + self.key = 0 + self.left = nil + self.right = nil + self.parent = nil + end + + def nil? + return true + end + end + + include Enumerable + + attr_accessor :root + attr_accessor :size + + def initialize + self.root = NilNode.instance + self.size = 0 + end + + def add(key) + insert(Node.new(key)) + end + + def insert(x) + insert_helper(x) + + x.color = Node::RED + while x != root && x.parent.color == Node::RED + if x.parent == x.parent.parent.left + y = x.parent.parent.right + if !y.nil? && y.color == Node::RED + x.parent.color = Node::BLACK + y.color = Node::BLACK + x.parent.parent.color = Node::RED + x = x.parent.parent + else + if x == x.parent.right + x = x.parent + left_rotate(x) + end + x.parent.color = Node::BLACK + x.parent.parent.color = Node::RED + right_rotate(x.parent.parent) + end + else + y = x.parent.parent.left + if !y.nil? && y.color == Node::RED + x.parent.color = Node::BLACK + y.color = Node::BLACK + x.parent.parent.color = Node::RED + x = x.parent.parent + else + if x == x.parent.left + x = x.parent + right_rotate(x) + end + x.parent.color = Node::BLACK + x.parent.parent.color = Node::RED + left_rotate(x.parent.parent) + end + end + end + root.color = Node::BLACK + end + + alias << insert + + def delete(z) + y = (z.left.nil? || z.right.nil?) ? z : successor(z) + x = y.left.nil? ? y.right : y.left + x.parent = y.parent + + if y.parent.nil? + self.root = x + else + if y == y.parent.left + y.parent.left = x + else + y.parent.right = x + end + end + + z.key = y.key if y != z + + if y.color == Node::BLACK + delete_fixup(x) + end + + self.size -= 1 + return y + end + + def minimum(x = root) + while !x.left.nil? + x = x.left + end + return x + end + + def maximum(x = root) + while !x.right.nil? + x = x.right + end + return x + end + + def successor(x) + if !x.right.nil? + return minimum(x.right) + end + y = x.parent + while !y.nil? && x == y.right + x = y + y = y.parent + end + return y + end + + def predecessor(x) + if !x.left.nil? + return maximum(x.left) + end + y = x.parent + while !y.nil? && x == y.left + x = y + y = y.parent + end + return y + end + + def inorder_walk(x = root) + x = self.minimum + while !x.nil? + yield x.key + x = successor(x) + end + end + + alias each inorder_walk + + def reverse_inorder_walk(x = root) + x = self.maximum + while !x.nil? + yield x.key + x = predecessor(x) + end + end + + alias reverse_each reverse_inorder_walk + + def search(key, x = root) + while !x.nil? && x.key != key + key < x.key ? x = x.left : x = x.right + end + return x + end + + def empty? + return self.root.nil? + end + + def black_height(x = root) + height = 0 + while !x.nil? + x = x.left + height +=1 if x.nil? || x.black? + end + return height + end + +private + + def left_rotate(x) + raise "x.right is nil!" if x.right.nil? + y = x.right + x.right = y.left + y.left.parent = x if !y.left.nil? + y.parent = x.parent + if x.parent.nil? + self.root = y + else + if x == x.parent.left + x.parent.left = y + else + x.parent.right = y + end + end + y.left = x + x.parent = y + end + + def right_rotate(x) + raise "x.left is nil!" if x.left.nil? + y = x.left + x.left = y.right + y.right.parent = x if !y.right.nil? + y.parent = x.parent + if x.parent.nil? + self.root = y + else + if x == x.parent.left + x.parent.left = y + else + x.parent.right = y + end + end + y.right = x + x.parent = y + end + + def insert_helper(z) + y = NilNode.instance + x = root + while !x.nil? + y = x + z.key < x.key ? x = x.left : x = x.right + end + z.parent = y + if y.nil? + self.root = z + else + z.key < y.key ? y.left = z : y.right = z + end + self.size += 1 + end + + def delete_fixup(x) + while x != root && x.color == Node::BLACK + if x == x.parent.left + w = x.parent.right + if w.color == Node::RED + w.color = Node::BLACK + x.parent.color = Node::RED + left_rotate(x.parent) + w = x.parent.right + end + if w.left.color == Node::BLACK && w.right.color == Node::BLACK + w.color = Node::RED + x = x.parent + else + if w.right.color == Node::BLACK + w.left.color = Node::BLACK + w.color = Node::RED + right_rotate(w) + w = x.parent.right + end + w.color = x.parent.color + x.parent.color = Node::BLACK + w.right.color = Node::BLACK + left_rotate(x.parent) + x = root + end + else + w = x.parent.left + if w.color == Node::RED + w.color = Node::BLACK + x.parent.color = Node::RED + right_rotate(x.parent) + w = x.parent.left + end + if w.right.color == Node::BLACK && w.left.color == Node::BLACK + w.color = Node::RED + x = x.parent + else + if w.left.color == Node::BLACK + w.right.color = Node::BLACK + w.color = Node::RED + left_rotate(w) + w = x.parent.left + end + w.color = x.parent.color + x.parent.color = Node::BLACK + w.left.color = Node::BLACK + right_rotate(x.parent) + x = root + end + end + end + x.color = Node::BLACK + end +end + +def rbt_bm + n = 100_000 + a1 = []; n.times { a1 << rand(999_999) } + a2 = []; n.times { a2 << rand(999_999) } + + start = Time.now + + tree = RedBlackTree.new + + n.times {|i| tree.add(i) } + n.times { tree.delete(tree.root) } + + tree = RedBlackTree.new + a1.each {|e| tree.add(e) } + a2.each {|e| tree.search(e) } + tree.inorder_walk {|key| key + 1 } + tree.reverse_inorder_walk {|key| key + 1 } + n.times { tree.minimum } + n.times { tree.maximum } + + return Time.now - start +end + +N = (ARGV[0] || 10).to_i + +N.times do + # puts rbt_bm.to_f + rbt_bm.to_f + # puts "GC.count = #{GC.count}" if GC.respond_to?(:count) +end diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb new file mode 100644 index 0000000000..be2c7b7250 --- /dev/null +++ b/benchmark/gc/ring.rb @@ -0,0 +1,29 @@ +# create many old objects + +max = 30_000_000 + +class Ring + attr_reader :next_ring + def initialize n = nil + @next_ring = n + end + + + def size + s = 1 + ring = self + while ring.next_ring + s += 1 + ring = ring.next_ring + end + s + end +end + +ring = Ring.new + +max.times{ + ring = Ring.new(ring) +} + +# p ring.size diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb new file mode 100644 index 0000000000..b6d787ae27 --- /dev/null +++ b/benchmark/make_fasta_output.rb @@ -0,0 +1,19 @@ +# prepare 'fasta.output' + +def prepare_fasta_output n + filebase = File.join(File.dirname($0), 'fasta.output') + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + file = "#{filebase}.#{n}" + + unless FileTest.exist?(file) + STDERR.puts "preparing #{file}" + + open(file, 'w'){|f| + ARGV[0] = n + $stdout = f + load script + $stdout = STDOUT + } + end +end + diff --git a/benchmark/memory_wrapper.rb b/benchmark/memory_wrapper.rb new file mode 100644 index 0000000000..3f4451a037 --- /dev/null +++ b/benchmark/memory_wrapper.rb @@ -0,0 +1,16 @@ + +write_file, target, script_file = ARGV + +load(script_file) +require_relative '../test/lib/memory_status' +open(write_file, 'wb'){|f| + ms = Memory::Status.new + case target.to_sym + when :peak + key = ms.respond_to?(:hwm) ? :hwm : :peak + when :size + key = ms.respond_to?(:rss) ? :rss : :size + end + + f.puts ms[key] +} diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl new file mode 100644 index 0000000000..201e22ddfa --- /dev/null +++ b/benchmark/other-lang/ack.pl @@ -0,0 +1,11 @@ +use integer; + +sub Ack { + return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1)) + : Ack($_[0]-1, 1)) + : $_[1]+1; +} + +my $NUM = 9; +$NUM = 1 if ($NUM < 1); +my $ack = Ack(3, $NUM); diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py new file mode 100644 index 0000000000..9968e7cfcf --- /dev/null +++ b/benchmark/other-lang/ack.py @@ -0,0 +1,16 @@ +import sys +sys.setrecursionlimit(5000000) + +def Ack(M, N): + if (not M): + return( N + 1 ) + if (not N): + return( Ack(M-1, 1) ) + return( Ack(M-1, Ack(M, N-1)) ) + +def main(): + NUM = 9 + sys.setrecursionlimit(10000) + Ack(3, NUM) + +main() diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb new file mode 100644 index 0000000000..7451bed6c4 --- /dev/null +++ b/benchmark/other-lang/ack.rb @@ -0,0 +1,12 @@ +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +NUM = 9 +ack(3, NUM) diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm new file mode 100644 index 0000000000..a80b73ba55 --- /dev/null +++ b/benchmark/other-lang/ack.scm @@ -0,0 +1,7 @@ +(define (ack m n) + (cond ((zero? m) (+ n 1)) + ((zero? n) (ack (- m 1) 1)) + (else (ack (- m 1) (ack m (- n 1)))))) + +(ack 3 9) + diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb new file mode 100644 index 0000000000..48a2cea019 --- /dev/null +++ b/benchmark/other-lang/eval.rb @@ -0,0 +1,66 @@ + +Bench = %w( + loop + ack + fib + tak + fact +) + +Lang = <<EOP.map{|l| l.strip} + ruby-cyg + ../../../test6/miniruby + perl + python + gosh +EOP + +Bench.replace ['loop2'] +Lang.replace ['ruby-cyg'] + +Ext = %w( + .rb + .rb + .pl + .py + .scm +) + +p Bench +p Lang + +require 'benchmark' + +def bench cmd + m = Benchmark.measure{ + #p cmd + system(cmd) + } + [m.utime, m.real] +end + +Result = [] +Bench.each{|b| + r = [] + Lang.each_with_index{|l, idx| + cmd = "#{l} #{b}#{Ext[idx]}" + r << bench(cmd) + } + Result << r +} + +require 'pp' +# utime +puts Lang.join("\t") +Bench.each_with_index{|b, bi| + print b, "\t" + puts Result[bi].map{|e| e[0]}.join("\t") +} + +# rtime +puts Lang.join("\t") +Bench.each_with_index{|b, bi| + print b, "\t" + puts Result[bi].map{|e| e[1]}.join("\t") +} + diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl new file mode 100644 index 0000000000..a9b0b69cdf --- /dev/null +++ b/benchmark/other-lang/fact.pl @@ -0,0 +1,13 @@ +sub fact{ + my $n = @_[0]; + if($n < 2){ + return 1; + } + else{ + return $n * fact($n-1); + } +} + +for($i=0; $i<10000; $i++){ + &fact(100); +} diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py new file mode 100644 index 0000000000..01593965d9 --- /dev/null +++ b/benchmark/other-lang/fact.py @@ -0,0 +1,18 @@ +#import sys +#sys.setrecursionlimit(1000) + +def factL(n): + r = 1 + for x in range(2, n): + r *= x + return r + +def factR(n): + if n < 2: + return 1 + else: + return n * factR(n-1) + +for i in range(10000): + factR(100) + diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb new file mode 100644 index 0000000000..6cedc752cd --- /dev/null +++ b/benchmark/other-lang/fact.rb @@ -0,0 +1,13 @@ +def fact(n) + if n < 2 + 1 + else + n * fact(n-1) + end +end + +i = 0 +while i<10000 + i += 1 + fact(100) +end diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm new file mode 100644 index 0000000000..c98a7fedd3 --- /dev/null +++ b/benchmark/other-lang/fact.scm @@ -0,0 +1,8 @@ +(define (fact n) + (if (< n 2) + 1 + (* n (fact (- n 1))))) + +(dotimes (i 10000) + (fact 100)) + diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl new file mode 100644 index 0000000000..a46f666d1e --- /dev/null +++ b/benchmark/other-lang/fib.pl @@ -0,0 +1,11 @@ +sub fib{ + my $n = $_[0]; + if($n < 3){ + return 1; + } + else{ + return fib($n-1) + fib($n-2); + } +}; + +&fib(34); diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py new file mode 100644 index 0000000000..45f2bceb8d --- /dev/null +++ b/benchmark/other-lang/fib.py @@ -0,0 +1,7 @@ +def fib(n): + if n < 3: + return 1 + else: + return fib(n-1) + fib(n-2) + +fib(34) diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb new file mode 100644 index 0000000000..ec587eabe0 --- /dev/null +++ b/benchmark/other-lang/fib.rb @@ -0,0 +1,9 @@ +def fib n + if n < 3 + 1 + else + fib(n-1) + fib(n-2) + end +end + +fib(34) diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm new file mode 100644 index 0000000000..2fc4e225bd --- /dev/null +++ b/benchmark/other-lang/fib.scm @@ -0,0 +1,7 @@ +(define (fib n) + (if (< n 3) + 1 + (+ (fib (- n 1)) (fib (- n 2))))) + +(fib 34) + diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl new file mode 100644 index 0000000000..2777490aaa --- /dev/null +++ b/benchmark/other-lang/loop.pl @@ -0,0 +1,3 @@ +for($i=0; $i<30000000; $i++){ +} + diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py new file mode 100644 index 0000000000..003749bf3a --- /dev/null +++ b/benchmark/other-lang/loop.py @@ -0,0 +1,2 @@ +for i in xrange(30000000): + pass diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb new file mode 100644 index 0000000000..b367b9dbf3 --- /dev/null +++ b/benchmark/other-lang/loop.rb @@ -0,0 +1,4 @@ +i = 0 +while i<30000000 + i += 1 +end diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm new file mode 100644 index 0000000000..3364f7e679 --- /dev/null +++ b/benchmark/other-lang/loop.scm @@ -0,0 +1 @@ +(dotimes (x 30000000)) diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb new file mode 100644 index 0000000000..df8fffc1ff --- /dev/null +++ b/benchmark/other-lang/loop2.rb @@ -0,0 +1 @@ +30000000.times{} diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl new file mode 100644 index 0000000000..7e748a67c6 --- /dev/null +++ b/benchmark/other-lang/tak.pl @@ -0,0 +1,11 @@ +sub tak { + local($x, $y, $z) = @_; + if (!($y < $x)) { + return $z; + } else { + return &tak(&tak($x - 1, $y, $z), + &tak($y - 1, $z, $x), + &tak($z - 1, $x, $y)); + } +} +&tak(18, 9, 0); diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py new file mode 100644 index 0000000000..04f3f6829c --- /dev/null +++ b/benchmark/other-lang/tak.py @@ -0,0 +1,8 @@ +def tak(x, y, z): + if not(y<x): + return z + else: + return tak(tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) +tak(18, 9, 0) diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb new file mode 100644 index 0000000000..efe5380f4e --- /dev/null +++ b/benchmark/other-lang/tak.rb @@ -0,0 +1,13 @@ + +def tak x, y, z + unless y < x + z + else + tak( tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) + end +end + +tak(18, 9, 0) + diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm new file mode 100644 index 0000000000..52a7629ee5 --- /dev/null +++ b/benchmark/other-lang/tak.scm @@ -0,0 +1,10 @@ +(define (tak x y z) + (if (not (< y x)) + z + (tak (tak (- x 1) y z) + (tak (- y 1) z x) + (tak (- z 1) x y)))) + +(tak 18 9 0) + + diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb new file mode 100644 index 0000000000..c4786f04ad --- /dev/null +++ b/benchmark/prepare_require.rb @@ -0,0 +1,25 @@ +require "fileutils" + +def prepare + num_files = 10000 + + basename = File.dirname($0) + data_dir = File.join(basename, "bm_require.data") + + # skip if all of files exists + if File.exist?(File.join(data_dir, "c#{num_files}.rb")) + return + end + + FileUtils.mkdir_p(data_dir) + + 1.upto(num_files) do |i| + f = File.open("#{data_dir}/c#{i}.rb", "w") + f.puts <<-END + class C#{i} + end + END + end +end + +prepare diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb new file mode 100644 index 0000000000..339ecb8b39 --- /dev/null +++ b/benchmark/prepare_require_thread.rb @@ -0,0 +1,2 @@ +load File.join(File.dirname(__FILE__), "prepare_require.rb") + diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb new file mode 100644 index 0000000000..ee2138cdb2 --- /dev/null +++ b/benchmark/prepare_so_count_words.rb @@ -0,0 +1,15 @@ +# prepare 'wc.input' + +def prepare_wc_input + wcinput = File.join(File.dirname($0), 'wc.input') + wcbase = File.join(File.dirname($0), 'wc.input.base') + unless FileTest.exist?(wcinput) + data = File.read(wcbase) + 13.times{ + data << data + } + open(wcinput, 'w'){|f| f.write data} + end +end + +prepare_wc_input diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb new file mode 100644 index 0000000000..d83aeb7a7e --- /dev/null +++ b/benchmark/prepare_so_k_nucleotide.rb @@ -0,0 +1,2 @@ +require_relative 'make_fasta_output' +prepare_fasta_output(100_000) diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb new file mode 100644 index 0000000000..da3ec2df14 --- /dev/null +++ b/benchmark/prepare_so_reverse_complement.rb @@ -0,0 +1,2 @@ +require_relative 'make_fasta_output' +prepare_fasta_output(2_500_000) diff --git a/benchmark/report.rb b/benchmark/report.rb new file mode 100644 index 0000000000..d2dc56b1e1 --- /dev/null +++ b/benchmark/report.rb @@ -0,0 +1,79 @@ +# +# YARV benchmark driver +# + +require 'yarvutil' +require 'benchmark' +require 'rbconfig' + +def exec_command type, file, w + <<-EOP + $DRIVER_PATH = '#{File.dirname($0)}' + $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect} + require 'benchmark' + require 'yarvutil' +# print '#{type}' + begin + puts Benchmark.measure{ + #{w}('#{file}') + }.utime + rescue Exception => exec_command_error_variable + puts "\t" + exec_command_error_variable.message + end + EOP +end + +def benchmark cmd + rubybin = ENV['RUBY'] || RbConfig.ruby + + IO.popen(rubybin, 'r+'){|io| + io.write cmd + io.close_write + return io.gets + } +end + +def ruby_exec file + prog = exec_command 'ruby', file, 'load' + benchmark prog +end + +def yarv_exec file + prog = exec_command 'yarv', file, 'YARVUtil.load_bm' + benchmark prog +end + +$wr = $wy = nil + +def measure bench + file = File.dirname($0) + "/bm_#{bench}.rb" + r = ruby_exec(file).to_f + y = yarv_exec(file).to_f + puts "#{bench}\t#{r}\t#{y}" +end + +def measure2 + r = ruby_exec.to_f + y = yarv_exec.to_f + puts r/y +end + +if $0 == __FILE__ + %w{ + whileloop + whileloop2 + times + const + method + poly_method + block + rescue + rescue2 + }.each{|bench| + measure bench + } +end + + + + diff --git a/benchmark/run.rb b/benchmark/run.rb new file mode 100644 index 0000000000..0cd2363849 --- /dev/null +++ b/benchmark/run.rb @@ -0,0 +1,127 @@ +# +# Ruby benchmark driver +# + +require 'benchmark' +require 'rbconfig' + +$matzrubyonly = false +$rubyonly = false + +$results = [] + +# prepare 'wc.input' +def prepare_wc_input + wcinput = File.join(File.dirname($0), 'wc.input') + wcbase = File.join(File.dirname($0), 'wc.input.base') + unless FileTest.exist?(wcinput) + data = File.read(wcbase) + 13.times{ + data << data + } + open(wcinput, 'w'){|f| f.write data} + end +end + +prepare_wc_input + +def bm file + prog = File.readlines(file).map{|e| e.rstrip}.join("\n") + return if prog.empty? + + /[a-z]+_(.+)\.rb/ =~ file + bm_name = $1 + puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly + puts "#{bm_name}: " + + +puts <<EOS unless $matzrubyonly || $rubyonly +#{prog} +-- +EOS + begin + result = [bm_name] + result << matzruby_exec(file) unless $rubyonly + result << ruby_exec(file) unless $matzrubyonly + $results << result + + rescue Exception => e + puts + puts "** benchmark failure: #{e}" + puts e.backtrace + end +end + +def benchmark file, bin + m = Benchmark.measure{ + `#{bin} #{$opts} #{file}` + } + sec = '%.3f' % m.real + puts " #{sec}" + sec +end + +def ruby_exec file + print 'ruby' + benchmark file, $ruby_program +end + +def matzruby_exec file + print 'matz' + rubylib = ENV['RUBYLIB'] + ENV['RUBYLIB'] = '' + r = benchmark file, $matzruby_program + ENV['RUBYLIB'] = rubylib + r +end + +if $0 == __FILE__ + ARGV.each{|arg| + case arg + when /\A--ruby=(.+)/ + $ruby_program = $1 + when /\A--matzruby=(.+)/ + $matzruby_program = $1 + when /\A--opts=(.+)/ + $opts = $1 + when /\A(-r|--only-ruby)\z/ + $rubyonly = true + when /\A(-m|--only-matzruby)\z/ + $matzrubyonly = true + end + } + ARGV.delete_if{|arg| + /\A-/ =~ arg + } + + puts "MatzRuby:" + system("#{$matzruby_program} -v") + puts "Ruby:" + system("#{$ruby_program} -v") + puts + + if ARGV.empty? + Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file| + bm file + } + else + ARGV.each{|file| + Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef| + # file = "#{File.dirname(__FILE__)}/#{file}.rb" + bm ef + } + } + end + + puts + puts "-- benchmark summary ---------------------------" + $results.each{|res| + print res.shift, "\t" + (res||[]).each{|result| + /([\d\.]+)/ =~ result + print $1 + "\t" if $1 + } + puts + } +end + diff --git a/benchmark/runc.rb b/benchmark/runc.rb new file mode 100644 index 0000000000..97c5cef045 --- /dev/null +++ b/benchmark/runc.rb @@ -0,0 +1,27 @@ +# +# +# + +require 'benchmark' +require 'rbconfig' + +$rubybin = ENV['RUBY'] || RbConfig.ruby + +def runfile file + puts file + file = File.join(File.dirname($0), 'contrib', file) + Benchmark.bm{|x| + x.report('ruby'){ + system("#{$rubybin} #{file}") + } + x.report('yarv'){ + system("#{$rubybin} -rite -I.. #{file}") + } + } +end + +ARGV.each{|file| + runfile file +} + + diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base new file mode 100644 index 0000000000..41143fbac0 --- /dev/null +++ b/benchmark/wc.input.base @@ -0,0 +1,25 @@ +Subject: Re: Who was Izchak Miller? +From: "Jane D. Anonymous" <nobody@yale.edu> +Date: 1996/04/28 +Message-Id: <4lv7bc$oh@news.ycc.yale.edu> +References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net> +To: 75176.2330@compuserve.com +Content-Type: text/plain; charset=us-ascii +Organization: Yale University +X-Url: news:4lk6vl$gde@ns.oar.net +Mime-Version: 1.0 +Newsgroups: rec.games.roguelike.nethack +X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) + +Hello there, Izchak Miller was my father. When I was younger I spent +many a night, hunched over the keyboard with a cup of tea, playing +nethack with him and my brother. my dad was a philosopher with a strong +weakness for fantasy/sci fi. I remember when he started to get involved +with the Nethack team- my brother's Dungeons and Dragons monster book +found a regular place beside my dad's desk. it's nice to see him living +on in the game he loved so much :-). + Tamar Miller + +The following is a really long word of 5000 characters: + +wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww |
