diff options
author | yugui <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> | 2008-08-25 15:13:14 +0000 |
---|---|---|
committer | yugui <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> | 2008-08-25 15:13:14 +0000 |
commit | d0233291bc8a5068e52c69c210e5979e5324b5bc (patch) | |
tree | 7d9459449c33792c63eeb7baa071e76352e0baab /trunk/benchmark | |
parent | 0dc342de848a642ecce8db697b8fecd83a63e117 (diff) | |
parent | 72eaacaa15256ab95c3b52ea386f88586fb9da40 (diff) |
re-adding tag v1_9_0_4 as an alias of trunk@18848v1_9_0_4
git-svn-id: svn+ssh://ci.ruby-lang.org/ruby/tags/v1_9_0_4@18849 b2dd03c8-39d4-4d8f-98ff-823fe69b080e
Diffstat (limited to 'trunk/benchmark')
101 files changed, 0 insertions, 3190 deletions
diff --git a/trunk/benchmark/bm_app_answer.rb b/trunk/benchmark/bm_app_answer.rb deleted file mode 100644 index 3cd8a8fd37..0000000000 --- a/trunk/benchmark/bm_app_answer.rb +++ /dev/null @@ -1,15 +0,0 @@ -def ack(m, n) - if m == 0 then - n + 1 - elsif n == 0 then - ack(m - 1, 1) - else - ack(m - 1, ack(m, n - 1)) - end -end - -def the_answer_to_life_the_universe_and_everything - (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i -end - -answer = the_answer_to_life_the_universe_and_everything diff --git a/trunk/benchmark/bm_app_erb.rb b/trunk/benchmark/bm_app_erb.rb deleted file mode 100644 index e58b7a34a1..0000000000 --- a/trunk/benchmark/bm_app_erb.rb +++ /dev/null @@ -1,26 +0,0 @@ -# -# Create many HTML strings with ERB. -# - -require 'erb' - -data = DATA.read -max = 5_000 -title = "hello world!" -content = "hello world!\n" * 10 - -max.times{ - ERB.new(data).result(binding) -} - -__END__ - -<html> - <head> <%= title %> </head> - <body> - <h1> <%= title %> </h1> - <p> - <%= content %> - </p> - </body> -</html> diff --git a/trunk/benchmark/bm_app_factorial.rb b/trunk/benchmark/bm_app_factorial.rb deleted file mode 100644 index a5a5de0426..0000000000 --- a/trunk/benchmark/bm_app_factorial.rb +++ /dev/null @@ -1,11 +0,0 @@ -def fact(n) - if(n > 1) - n * fact(n-1) - else - 1 - end -end - -8.times{ - fact(5000) -}
\ No newline at end of file diff --git a/trunk/benchmark/bm_app_fib.rb b/trunk/benchmark/bm_app_fib.rb deleted file mode 100644 index 34a7b2e725..0000000000 --- a/trunk/benchmark/bm_app_fib.rb +++ /dev/null @@ -1,10 +0,0 @@ -def fib n - if n < 3 - 1 - else - fib(n-1) + fib(n-2) - end -end - -fib(34) - diff --git a/trunk/benchmark/bm_app_mandelbrot.rb b/trunk/benchmark/bm_app_mandelbrot.rb deleted file mode 100644 index a0dcf5e874..0000000000 --- a/trunk/benchmark/bm_app_mandelbrot.rb +++ /dev/null @@ -1,23 +0,0 @@ -require 'complex' - -def mandelbrot? z - i = 0 - while i<100 - i+=1 - z = z * z - return false if z.abs > 2 - end - true -end - -ary = [] - -(0..100).each{|dx| - (0..100).each{|dy| - x = dx / 50.0 - y = dy / 50.0 - c = Complex(x, y) - ary << c if mandelbrot?(c) - } -} - diff --git a/trunk/benchmark/bm_app_pentomino.rb b/trunk/benchmark/bm_app_pentomino.rb deleted file mode 100644 index 59c63f358e..0000000000 --- a/trunk/benchmark/bm_app_pentomino.rb +++ /dev/null @@ -1,259 +0,0 @@ -#!/usr/local/bin/ruby -# This program is contributed by Shin Nishiyama - - -# modified by K.Sasada - -NP = 5 -ROW = 8 + NP -COL = 8 - -$p = [] -$b = [] -$no = 0 - -def piece(n, a, nb) - nb.each{|x| - a[n] = x - if n == NP-1 - $p << [a.sort] - else - nbc=nb.dup - [-ROW, -1, 1, ROW].each{|d| - if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) - nbc << x+d - end - } - nbc.delete x - piece(n+1,a[0..n],nbc) - end - } -end - -def kikaku(a) - a.collect {|x| x - a[0]} -end -def ud(a) - kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) -end -def rl(a) - kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) -end -def xy(a) - kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) -end - -def mkpieces - piece(0,[],[0]) - $p.each do |a| - a0 = a[0] - a[1] = ud(a0) - a[2] = rl(a0) - a[3] = ud(rl(a0)) - a[4] = xy(a0) - a[5] = ud(xy(a0)) - a[6] = rl(xy(a0)) - a[7] = ud(rl(xy(a0))) - a.sort! - a.uniq! - end - $p.uniq!.sort! {|x,y| x[0] <=> y[0] } -end - -def mkboard - (0...ROW*COL).each{|i| - if i % ROW >= ROW-NP - $b[i] = -2 - else - $b[i] = -1 - end - $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 - } -end - -def pboard - return # skip print - print "No. #$no\n" - (0...COL).each{|i| - print "|" - (0...ROW-NP).each{|j| - x = $b[i*ROW+j] - if x < 0 - print "..|" - else - printf "%2d|",x+1 - end - } - print "\n" - } - print "\n" -end - -$pnum=[] -def setpiece(a,pos) - if a.length == $p.length then - $no += 1 - pboard - return - end - while $b[pos] != -1 - pos += 1 - end - ($pnum - a).each do |i| - $p[i].each do |x| - f = 0 - x.each{|s| - if $b[pos+s] != -1 - f=1 - break - end - } - if f == 0 then - x.each{|s| - $b[pos+s] = i - } - a << i - setpiece(a.dup, pos) - a.pop - x.each{|s| - $b[pos+s] = -1 - } - end - end - end -end - -mkpieces -mkboard -$p[4] = [$p[4][0]] -$pnum = (0...$p.length).to_a -setpiece([],0) - - -__END__ - -# original - -NP = 5 -ROW = 8 + NP -COL = 8 - -$p = [] -$b = [] -$no = 0 - -def piece(n,a,nb) - for x in nb - a[n] = x - if n == NP-1 - $p << [a.sort] - else - nbc=nb.dup - for d in [-ROW, -1, 1, ROW] - if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) - nbc << x+d - end - end - nbc.delete x - piece(n+1,a[0..n],nbc) - end - end -end - -def kikaku(a) - a.collect {|x| x - a[0]} -end -def ud(a) - kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) -end -def rl(a) - kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) -end -def xy(a) - kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) -end - -def mkpieces - piece(0,[],[0]) - $p.each do |a| - a0 = a[0] - a[1] = ud(a0) - a[2] = rl(a0) - a[3] = ud(rl(a0)) - a[4] = xy(a0) - a[5] = ud(xy(a0)) - a[6] = rl(xy(a0)) - a[7] = ud(rl(xy(a0))) - a.sort! - a.uniq! - end - $p.uniq!.sort! {|x,y| x[0] <=> y[0] } -end - -def mkboard - for i in 0...ROW*COL - if i % ROW >= ROW-NP - $b[i] = -2 - else - $b[i] = -1 - end - $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 - end -end - -def pboard - print "No. #$no\n" - for i in 0...COL - print "|" - for j in 0...ROW-NP - x = $b[i*ROW+j] - if x < 0 - print "..|" - else - printf "%2d|",x+1 - end - end - print "\n" - end - print "\n" -end - -$pnum=[] -def setpiece(a,pos) - if a.length == $p.length then - $no += 1 - pboard - return - end - while $b[pos] != -1 - pos += 1 - end - ($pnum - a).each do |i| - $p[i].each do |x| - f = 0 - for s in x do - if $b[pos+s] != -1 - f=1 - break - end - end - if f == 0 then - for s in x do - $b[pos+s] = i - end - a << i - setpiece(a.dup, pos) - a.pop - for s in x do - $b[pos+s] = -1 - end - end - end - end -end - -mkpieces -mkboard -$p[4] = [$p[4][0]] -$pnum = (0...$p.length).to_a -setpiece([],0) diff --git a/trunk/benchmark/bm_app_raise.rb b/trunk/benchmark/bm_app_raise.rb deleted file mode 100644 index 01d2ae3219..0000000000 --- a/trunk/benchmark/bm_app_raise.rb +++ /dev/null @@ -1,8 +0,0 @@ -i=0 -while i<300000 - i+=1 - begin - raise - rescue - end -end diff --git a/trunk/benchmark/bm_app_strconcat.rb b/trunk/benchmark/bm_app_strconcat.rb deleted file mode 100644 index c6ef817263..0000000000 --- a/trunk/benchmark/bm_app_strconcat.rb +++ /dev/null @@ -1,5 +0,0 @@ -i=0 -while i<500000 - "#{1+1} #{1+1} #{1+1}" - i+=1 -end diff --git a/trunk/benchmark/bm_app_tak.rb b/trunk/benchmark/bm_app_tak.rb deleted file mode 100644 index efe5380f4e..0000000000 --- a/trunk/benchmark/bm_app_tak.rb +++ /dev/null @@ -1,13 +0,0 @@ - -def tak x, y, z - unless y < x - z - else - tak( tak(x-1, y, z), - tak(y-1, z, x), - tak(z-1, x, y)) - end -end - -tak(18, 9, 0) - diff --git a/trunk/benchmark/bm_app_tarai.rb b/trunk/benchmark/bm_app_tarai.rb deleted file mode 100644 index 4c146f5ccf..0000000000 --- a/trunk/benchmark/bm_app_tarai.rb +++ /dev/null @@ -1,10 +0,0 @@ -def tarai( x, y, z ) - if x <= y - then y - else tarai(tarai(x-1, y, z), - tarai(y-1, z, x), - tarai(z-1, x, y)) - end -end - -tarai(12, 6, 0) diff --git a/trunk/benchmark/bm_app_uri.rb b/trunk/benchmark/bm_app_uri.rb deleted file mode 100644 index 586edfd5dc..0000000000 --- a/trunk/benchmark/bm_app_uri.rb +++ /dev/null @@ -1,8 +0,0 @@ -require 'uri' - -100_000.times{ - uri = URI.parse('http://www.ruby-lang.org') - uri.scheme - uri.host - uri.port -} diff --git a/trunk/benchmark/bm_io_file_create.rb b/trunk/benchmark/bm_io_file_create.rb deleted file mode 100644 index 7adbe9ea5e..0000000000 --- a/trunk/benchmark/bm_io_file_create.rb +++ /dev/null @@ -1,13 +0,0 @@ -# -# Create files -# - -max = 50_000 -file = './tmpfile_of_bm_io_file_create' - -max.times{ - f = open(file, 'w') - f.close#(true) -} -File.unlink(file) - diff --git a/trunk/benchmark/bm_io_file_read.rb b/trunk/benchmark/bm_io_file_read.rb deleted file mode 100644 index 2b4212db76..0000000000 --- a/trunk/benchmark/bm_io_file_read.rb +++ /dev/null @@ -1,15 +0,0 @@ -# -# Seek and Read file. -# - -require 'tempfile' - -max = 20_000 -str = "Hello world! " * 1000 -f = Tempfile.new('yarv-benchmark') -f.write str - -max.times{ - f.seek 0 - f.read -} diff --git a/trunk/benchmark/bm_io_file_write.rb b/trunk/benchmark/bm_io_file_write.rb deleted file mode 100644 index 3cec58c6ae..0000000000 --- a/trunk/benchmark/bm_io_file_write.rb +++ /dev/null @@ -1,14 +0,0 @@ -# -# Seek and Write file. -# - -require 'tempfile' - -max = 20_000 -str = "Hello world! " * 1000 -f = Tempfile.new('yarv-benchmark') - -max.times{ - f.seek 0 - f.write str -} diff --git a/trunk/benchmark/bm_loop_generator.rb b/trunk/benchmark/bm_loop_generator.rb deleted file mode 100644 index d3375c744c..0000000000 --- a/trunk/benchmark/bm_loop_generator.rb +++ /dev/null @@ -1,14 +0,0 @@ -max = 600000 - -if defined? Fiber - gen = (1..max).each - loop do - gen.next - end -else - require 'generator' - gen = Generator.new((0..max)) - while gen.next? - gen.next - end -end diff --git a/trunk/benchmark/bm_loop_times.rb b/trunk/benchmark/bm_loop_times.rb deleted file mode 100644 index c5317b8228..0000000000 --- a/trunk/benchmark/bm_loop_times.rb +++ /dev/null @@ -1 +0,0 @@ -30000000.times{|e|} diff --git a/trunk/benchmark/bm_loop_whileloop.rb b/trunk/benchmark/bm_loop_whileloop.rb deleted file mode 100644 index 43d35e1131..0000000000 --- a/trunk/benchmark/bm_loop_whileloop.rb +++ /dev/null @@ -1,4 +0,0 @@ -i=0 -while i<30_000_000 # benchmark loop 1 - i+=1 -end diff --git a/trunk/benchmark/bm_loop_whileloop2.rb b/trunk/benchmark/bm_loop_whileloop2.rb deleted file mode 100644 index e514989661..0000000000 --- a/trunk/benchmark/bm_loop_whileloop2.rb +++ /dev/null @@ -1,4 +0,0 @@ -i=0 -while i< 6_000_000 # benchmark loop 2 - i+=1 -end diff --git a/trunk/benchmark/bm_so_ackermann.rb b/trunk/benchmark/bm_so_ackermann.rb deleted file mode 100644 index 7db5be9050..0000000000 --- a/trunk/benchmark/bm_so_ackermann.rb +++ /dev/null @@ -1,19 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ - -def ack(m, n) - if m == 0 then - n + 1 - elsif n == 0 then - ack(m - 1, 1) - else - ack(m - 1, ack(m, n - 1)) - end -end - -NUM = 9 -ack(3, NUM) - - diff --git a/trunk/benchmark/bm_so_array.rb b/trunk/benchmark/bm_so_array.rb deleted file mode 100644 index 2b8fce8f99..0000000000 --- a/trunk/benchmark/bm_so_array.rb +++ /dev/null @@ -1,23 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ -# with help from Paul Brannan and Mark Hubbart - -n = 9000 # Integer(ARGV.shift || 1) - -x = Array.new(n) -y = Array.new(n, 0) - -n.times{|bi| - x[bi] = bi + 1 -} - -(0 .. 999).each do |e| - (n-1).step(0,-1) do |bi| - y[bi] += x.at(bi) - end -end -# puts "#{y.first} #{y.last}" - - diff --git a/trunk/benchmark/bm_so_binary_trees.rb b/trunk/benchmark/bm_so_binary_trees.rb deleted file mode 100644 index 6a26465578..0000000000 --- a/trunk/benchmark/bm_so_binary_trees.rb +++ /dev/null @@ -1,57 +0,0 @@ -# The Computer Language Shootout Benchmarks -# http://shootout.alioth.debian.org -# -# contributed by Jesse Millikan - -# disable output -def STDOUT.write_ *args -end - -def item_check(tree) - if tree[0] == nil - tree[1] - else - tree[1] + item_check(tree[0]) - item_check(tree[2]) - end -end - -def bottom_up_tree(item, depth) - if depth > 0 - item_item = 2 * item - depth -= 1 - [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)] - else - [nil, item, nil] - end -end - -max_depth = 12 # 16 # ARGV[0].to_i -min_depth = 4 - -max_depth = min_depth + 2 if min_depth + 2 > max_depth - -stretch_depth = max_depth + 1 -stretch_tree = bottom_up_tree(0, stretch_depth) - -puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}" -stretch_tree = nil - -long_lived_tree = bottom_up_tree(0, max_depth) - -min_depth.step(max_depth + 1, 2) do |depth| - iterations = 2**(max_depth - depth + min_depth) - - check = 0 - - for i in 1..iterations - temp_tree = bottom_up_tree(i, depth) - check += item_check(temp_tree) - - temp_tree = bottom_up_tree(-i, depth) - check += item_check(temp_tree) - end - - puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}" -end - -puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}" diff --git a/trunk/benchmark/bm_so_concatenate.rb b/trunk/benchmark/bm_so_concatenate.rb deleted file mode 100644 index 82629688b7..0000000000 --- a/trunk/benchmark/bm_so_concatenate.rb +++ /dev/null @@ -1,18 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ -# based on code from Aristarkh A Zagorodnikov and Dat Nguyen - -STUFF = "hello\n" -i=0 -while i<10 - i+=1 - hello = '' - 400000.times do |e| - hello << STUFF - end -end -# puts hello.length - - diff --git a/trunk/benchmark/bm_so_count_words.rb b/trunk/benchmark/bm_so_count_words.rb deleted file mode 100644 index 65f6337a4a..0000000000 --- a/trunk/benchmark/bm_so_count_words.rb +++ /dev/null @@ -1,19 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ -# with help from Paul Brannan - -input = open(File.join(File.dirname($0), 'wc.input'), 'rb') - -nl = nw = nc = 0 -while true - tmp = input.read(4096) or break - data = tmp << (input.gets || "") - nc += data.length - nl += data.count("\n") - ((data.strip! || data).tr!("\n", " ") || data).squeeze! - nw += data.count(" ") + 1 -end -# STDERR.puts "#{nl} #{nw} #{nc}" - diff --git a/trunk/benchmark/bm_so_exception.rb b/trunk/benchmark/bm_so_exception.rb deleted file mode 100644 index d8b461290c..0000000000 --- a/trunk/benchmark/bm_so_exception.rb +++ /dev/null @@ -1,61 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ - -$HI = 0 -$LO = 0 -NUM = 250000 # Integer(ARGV[0] || 1) - - -class Lo_Exception < Exception - def initialize(num) - @value = num - end -end - -class Hi_Exception < Exception - def initialize(num) - @value = num - end -end - -def some_function(num) - begin - hi_function(num) - rescue - print "We shouldn't get here, exception is: #{$!.type}\n" - end -end - -def hi_function(num) - begin - lo_function(num) - rescue Hi_Exception - $HI = $HI + 1 - end -end - -def lo_function(num) - begin - blowup(num) - rescue Lo_Exception - $LO = $LO + 1 - end -end - -def blowup(num) - if num % 2 == 0 - raise Lo_Exception.new(num) - else - raise Hi_Exception.new(num) - end -end - - -i = 1 -max = NUM+1 -while i < max - i+=1 - some_function(i+1) -end diff --git a/trunk/benchmark/bm_so_fannkuch.rb b/trunk/benchmark/bm_so_fannkuch.rb deleted file mode 100644 index a214f2e205..0000000000 --- a/trunk/benchmark/bm_so_fannkuch.rb +++ /dev/null @@ -1,45 +0,0 @@ -# The Computer Language Shootout -# http://shootout.alioth.debian.org/ -# Contributed by Sokolov Yura -# Modified by Ryan Williams - -def fannkuch(n) - maxFlips, m, r, check = 0, n-1, n, 0 - count = (1..n).to_a - perm = (1..n).to_a - - while true - if check < 30 - puts "#{perm}" - check += 1 - end - - while r != 1 - count[r-1] = r - r -= 1 - end - - if perm[0] != 1 and perm[m] != n - perml = perm.clone #.dup - flips = 0 - while (k = perml.first ) != 1 - perml = perml.slice!(0, k).reverse + perml - flips += 1 - end - maxFlips = flips if flips > maxFlips - end - while true - if r==n then return maxFlips end - perm.insert r,perm.shift - break if (count[r] -= 1) > 0 - r += 1 - end - end -end - -def puts *args -end - -N = 10 # (ARGV[0] || 1).to_i -puts "Pfannkuchen(#{N}) = #{fannkuch(N)}" - diff --git a/trunk/benchmark/bm_so_fasta.rb b/trunk/benchmark/bm_so_fasta.rb deleted file mode 100644 index 3f759ba7ae..0000000000 --- a/trunk/benchmark/bm_so_fasta.rb +++ /dev/null @@ -1,81 +0,0 @@ -# The Computer Language Shootout -# http://shootout.alioth.debian.org/ -# Contributed by Sokolov Yura - -$last = 42.0 -def gen_random (max,im=139968,ia=3877,ic=29573) - (max * ($last = ($last * ia + ic) % im)) / im -end - -alu = - "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ - "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ - "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ - "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ - "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ - "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ - "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" - -iub = [ - ["a", 0.27], - ["c", 0.12], - ["g", 0.12], - ["t", 0.27], - - ["B", 0.02], - ["D", 0.02], - ["H", 0.02], - ["K", 0.02], - ["M", 0.02], - ["N", 0.02], - ["R", 0.02], - ["S", 0.02], - ["V", 0.02], - ["W", 0.02], - ["Y", 0.02], -] -homosapiens = [ - ["a", 0.3029549426680], - ["c", 0.1979883004921], - ["g", 0.1975473066391], - ["t", 0.3015094502008], -] - -def make_repeat_fasta(id, desc, src, n) - puts ">#{id} #{desc}" - v = nil - width = 60 - l = src.length - s = src * ((n / l) + 1) - s.slice!(n, l) - puts(s.scan(/.{1,#{width}}/).join("\n")) -end - -def make_random_fasta(id, desc, table, n) - puts ">#{id} #{desc}" - rand, v = nil,nil - width = 60 - chunk = 1 * width - prob = 0.0 - table.each{|v| v[1]= (prob += v[1])} - for i in 1..(n/width) - puts((1..width).collect{ - rand = gen_random(1.0) - table.find{|v| v[1]>rand}[0] - }.join) - end - if n%width != 0 - puts((1..(n%width)).collect{ - rand = gen_random(1.0) - table.find{|v| v[1]>rand}[0] - }.join) - end -end - - -n = (ARGV[0] or 250_000).to_i - -make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) -make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) -make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) - diff --git a/trunk/benchmark/bm_so_k_nucleotide.rb b/trunk/benchmark/bm_so_k_nucleotide.rb deleted file mode 100644 index dadab3e79c..0000000000 --- a/trunk/benchmark/bm_so_k_nucleotide.rb +++ /dev/null @@ -1,48 +0,0 @@ -# The Computer Language Shootout -# http://shootout.alioth.debian.org -# -# contributed by jose fco. gonzalez -# modified by Sokolov Yura - -seq = String.new - -def frecuency( seq,length ) - n, table = seq.length - length + 1, Hash.new(0) - f, i = nil, nil - (0 ... length).each do |f| - (f ... n).step(length) do |i| - table[seq[i,length]] += 1 - end - end - [n,table] - -end - -def sort_by_freq( seq,length ) - n,table = frecuency( seq,length ) - a, b, v = nil, nil, nil - table.sort{|a,b| b[1] <=> a[1]}.each do |v| - puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] - end - puts -end - -def find_seq( seq,s ) - n,table = frecuency( seq,s.length ) - puts "#{table[s].to_s}\t#{s.upcase}" -end - -input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') - -line = input.gets while line !~ /^>THREE/ -line = input.gets - -while (line !~ /^>/) & line do - seq << line.chomp - line = input.gets -end - -[1,2].each {|i| sort_by_freq( seq,i ) } - -%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } - diff --git a/trunk/benchmark/bm_so_lists.rb b/trunk/benchmark/bm_so_lists.rb deleted file mode 100644 index 3652288881..0000000000 --- a/trunk/benchmark/bm_so_lists.rb +++ /dev/null @@ -1,47 +0,0 @@ -#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby - -NUM = 100 -SIZE = 10000 - -def test_lists() - # create a list of integers (Li1) from 1 to SIZE - li1 = (1..SIZE).to_a - # copy the list to li2 (not by individual items) - li2 = li1.dup - # remove each individual item from left side of li2 and - # append to right side of li3 (preserving order) - li3 = Array.new - while (not li2.empty?) - li3.push(li2.shift) - end - # li2 must now be empty - # remove each individual item from right side of li3 and - # append to right side of li2 (reversing list) - while (not li3.empty?) - li2.push(li3.pop) - end - # li3 must now be empty - # reverse li1 in place - li1.reverse! - # check that first item is now SIZE - if li1[0] != SIZE then - p "not SIZE" - 0 - else - # compare li1 and li2 for equality - if li1 != li2 then - return(0) - else - # return the length of the list - li1.length - end - end -end - -i = 0 -while i<NUM - i+=1 - result = test_lists() -end - -result diff --git a/trunk/benchmark/bm_so_mandelbrot.rb b/trunk/benchmark/bm_so_mandelbrot.rb deleted file mode 100644 index 76331c64b8..0000000000 --- a/trunk/benchmark/bm_so_mandelbrot.rb +++ /dev/null @@ -1,57 +0,0 @@ -# The Computer Language Benchmarks Game -# http://shootout.alioth.debian.org/ -# -# contributed by Karl von Laudermann -# modified by Jeremy Echols - -size = 600 # ARGV[0].to_i - -puts "P4\n#{size} #{size}" - -ITER = 49 # Iterations - 1 for easy for..in looping -LIMIT_SQUARED = 4.0 # Presquared limit - -byte_acc = 0 -bit_num = 0 - -count_size = size - 1 # Precomputed size for easy for..in looping - -# For..in loops are faster than .upto, .downto, .times, etc. -for y in 0..count_size - for x in 0..count_size - zr = 0.0 - zi = 0.0 - cr = (2.0*x/size)-1.5 - ci = (2.0*y/size)-1.0 - escape = false - - # To make use of the for..in code, we use a dummy variable, - # like one would in C - for dummy in 0..ITER - tr = zr*zr - zi*zi + cr - ti = 2*zr*zi + ci - zr, zi = tr, ti - - if (zr*zr+zi*zi) > LIMIT_SQUARED - escape = true - break - end - end - - byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1) - bit_num += 1 - - # Code is very similar for these cases, but using separate blocks - # ensures we skip the shifting when it's unnecessary, which is most cases. - if (bit_num == 8) - print byte_acc.chr - byte_acc = 0 - bit_num = 0 - elsif (x == count_size) - byte_acc <<= (8 - bit_num) - print byte_acc.chr - byte_acc = 0 - bit_num = 0 - end - end -end diff --git a/trunk/benchmark/bm_so_matrix.rb b/trunk/benchmark/bm_so_matrix.rb deleted file mode 100644 index 0f274ad06c..0000000000 --- a/trunk/benchmark/bm_so_matrix.rb +++ /dev/null @@ -1,48 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ - -n = 60 #Integer(ARGV.shift || 1) - -size = 30 - -def mkmatrix(rows, cols) - count = 1 - mx = Array.new(rows) - (0 .. (rows - 1)).each do |bi| - row = Array.new(cols, 0) - (0 .. (cols - 1)).each do |j| - row[j] = count - count += 1 - end - mx[bi] = row - end - mx -end - -def mmult(rows, cols, m1, m2) - m3 = Array.new(rows) - (0 .. (rows - 1)).each do |bi| - row = Array.new(cols, 0) - (0 .. (cols - 1)).each do |j| - val = 0 - (0 .. (cols - 1)).each do |k| - val += m1.at(bi).at(k) * m2.at(k).at(j) - end - row[j] = val - end - m3[bi] = row - end - m3 -end - -m1 = mkmatrix(size, size) -m2 = mkmatrix(size, size) -mm = Array.new -n.times do - mm = mmult(size, size, m1, m2) -end -# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}" - - diff --git a/trunk/benchmark/bm_so_meteor_contest.rb b/trunk/benchmark/bm_so_meteor_contest.rb deleted file mode 100644 index 99cf6a91cc..0000000000 --- a/trunk/benchmark/bm_so_meteor_contest.rb +++ /dev/null @@ -1,564 +0,0 @@ -#!/usr/bin/env ruby -# -# The Computer Language Shootout -# http://shootout.alioth.debian.org -# contributed by Kevin Barnes (Ruby novice) - -# PROGRAM: the main body is at the bottom. -# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ -# 2) see how I represent a board as a bitmask by reading the blank_board comments -# 3) read as your mental paths take you - -def print *args -end - -# class to represent all information about a particular rotation of a particular piece -class Rotation - # an array (by location) containing a bit mask for how the piece maps at the given location. - # if the rotation is invalid at that location the mask will contain false - attr_reader :start_masks - - # maps a direction to a relative location. these differ depending on whether it is an even or - # odd row being mapped from - @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 } - @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 } - - def initialize( directions ) - @even_offsets, @odd_offsets = normalize_offsets( get_values( directions )) - - @even_mask = mask_for_offsets( @even_offsets) - @odd_mask = mask_for_offsets( @odd_offsets) - - @start_masks = Array.new(60) - - # create the rotational masks by placing the base mask at the location and seeing if - # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these - # is true the piece cannot be placed - 0.upto(59) do | offset | - mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset) - if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then - imask = compute_required( mask, offset) - @start_masks[offset] = [ mask, imask, imask | mask ] - else - @start_masks[offset] = false - end - end - end - - def compute_required( mask, offset ) - board = blank_board - 0.upto(offset) { | i | board |= 1 << i } - board |= mask - return 0 if (!prunable(board | mask, offset)) - board = flood_fill(board,58) - count = 0 - imask = 0 - 0.upto(59) do | i | - if (board[i] == 0) then - imask |= (1 << i) - count += 1 - end - end - (count > 0 && count < 5) ? imask : 0 - end - - def flood_fill( board, location) - return board if (board[location] == 1) - board |= 1 << location - row, col = location.divmod(6) - board = flood_fill( board, location - 1) if (col > 0) - board = flood_fill( board, location + 1) if (col < 4) - if (row % 2 == 0) then - board = flood_fill( board, location - 7) if (col > 0 && row > 0) - board = flood_fill( board, location - 6) if (row > 0) - board = flood_fill( board, location + 6) if (row < 9) - board = flood_fill( board, location + 5) if (col > 0 && row < 9) - else - board = flood_fill( board, location - 5) if (col < 4 && row > 0) - board = flood_fill( board, location - 6) if (row > 0) - board = flood_fill( board, location + 6) if (row < 9) - board = flood_fill( board, location + 7) if (col < 4 && row < 9) - end - board - end - - # given a location, produces a list of relative locations covered by the piece at this rotation - def offsets( location) - if is_even( location) then - @even_offsets.collect { | value | value + location } - else - @odd_offsets.collect { | value | value + location } - end - end - - # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows) - # this is hard to explain. imagine we have this partial board: - # 0 0 0 0 0 x [positions 0-5] - # 0 0 1 1 0 x [positions 6-11] - # 0 0 1 0 0 x [positions 12-17] - # 0 1 0 0 0 x [positions 18-23] - # 0 1 0 0 0 x [positions 24-29] - # 0 0 0 0 0 x [positions 30-35] - # ... - # The top-left of the piece is at position 8, the - # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that - # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained - # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row: - # 0 0 0 1 1 x [positions 0-5] - # 0 0 1 0 0 x [positions 6-11] - # 0 0 1 0 0 x [positions 12-17] - # 0 1 0 0 0 x [positions 18-23] - # 0 0 0 0 0 x [positions 24-29] - # 0 0 0 0 0 x [positions 30-35] - # ... - # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the - # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what - # this function would return - def normalize_offsets( values) - min = values.min - even_min = is_even(min) - other_min = even_min ? min + 6 : min + 7 - other_values = values.collect do | value | - if is_even(value) then - value + 6 - other_min - else - value + 7 - other_min - end - end - values.collect! { | value | value - min } - - if even_min then - [values, other_values] - else - [other_values, values] - end - end - - # produce a bitmask representation of an array of offset locations - def mask_for_offsets( offsets ) - mask = 0 - offsets.each { | value | mask = mask + ( 1 << value ) } - mask - end - - # finds a "safe" position that a position as described by a list of directions can be placed - # without falling off any edge of the board. the values returned a location to place the first piece - # at so it will fit after making the described moves - def start_adjust( directions ) - south = east = 0; - directions.each do | direction | - east += 1 if ( direction == :sw || direction == :nw || direction == :west ) - south += 1 if ( direction == :nw || direction == :ne ) - end - south * 6 + east - end - - # given a set of directions places the piece (as defined by a set of directions) on the board at - # a location that will not take it off the edge - def get_values ( directions ) - start = start_adjust(directions) - values = [ start ] - directions.each do | direction | - if (start % 12 >= 6) then - start += @@rotation_odd_adder[direction] - else - start += @@rotation_even_adder[direction] - end - values += [ start ] - end - - # some moves take you back to an existing location, we'll strip duplicates - values.uniq - end -end - -# describes a piece and caches information about its rotations to as to be efficient for iteration -# ATTRIBUTES: -# rotations -- all the rotations of the piece -# type -- a numeic "name" of the piece -# masks -- an array by location of all legal rotational masks (a n inner array) for that location -# placed -- the mask that this piece was last placed at (not a location, but the actual mask used) -class Piece - attr_reader :rotations, :type, :masks - attr_accessor :placed - - # transform hashes that change one direction into another when you either flip or rotate a set of directions - @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne } - @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw } - - def initialize( directions, type ) - @type = type - @rotations = Array.new(); - @map = {} - - generate_rotations( directions ) - directions.collect! { | value | @@flip_converter[value] } - generate_rotations( directions ) - - # creates the masks AND a map that returns [location, rotation] for any given mask - # this is used when a board is found and we want to draw it, otherwise the map is unused - @masks = Array.new(); - 0.upto(59) do | i | - even = true - @masks[i] = @rotations.collect do | rotation | - mask = rotation.start_masks[i] - @map[mask[0]] = [ i, rotation ] if (mask) - mask || nil - end - @masks[i].compact! - end - end - - # rotates a set of directions through all six angles and adds a Rotation to the list for each one - def generate_rotations( directions ) - 6.times do - rotations.push( Rotation.new(directions)) - directions.collect! { | value | @@rotate_converter[value] } - end - end - - # given a board string, adds this piece to the board at whatever location/rotation - # important: the outbound board string is 5 wide, the normal location notation is six wide (padded) - def fill_string( board_string) - location, rotation = @map[@placed] - rotation.offsets(location).each do | offset | - row, col = offset.divmod(6) - board_string[ row*5 + col, 1 ] = @type.to_s - end - end -end - -# a blank bit board having this form: -# -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 0 0 0 0 0 1 -# 1 1 1 1 1 1 -# -# where left lest significant bit is the top left and the most significant is the lower right -# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running -# off the edges or bottom -def blank_board - 0b111111100000100000100000100000100000100000100000100000100000100000 -end - -def full_board - 0b111111111111111111111111111111111111111111111111111111111111111111 -end - -# determines if a location (bit position) is in an even row -def is_even( location) - (location % 12) < 6 -end - -# support function that create three utility maps: -# $converter -- for each row an array that maps a five bit row (via array mapping) -# to the a a five bit representation of the bits below it -# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row -# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays -# a region array has three values the first is a mask of bits in the region, -# the second is the count of those bits and the third is identical to the first -# examples: -# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001] -# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001] -# 0b10001 => [ 0b01110, 3, 0b01110 ] -def create_collector_support - odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000] - even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000] - - all_odds = Array.new(0b100000) - all_evens = Array.new(0b100000) - bit_counts = Array.new(0b100000) - new_regions = Array.new(0b100000) - 0.upto(0b11111) do | i | - bit_count = odd = even = 0 - 0.upto(4) do | bit | - if (i[bit] == 1) then - bit_count += 1 - odd |= odd_map[bit] - even |= even_map[bit] - end - end - all_odds[i] = odd - all_evens[i] = even - bit_counts[i] = bit_count - new_regions[i] = create_regions( i) - end - - $converter = [] - 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) } - $bit_counts = bit_counts - $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } } -end - -# determines if a board is punable, meaning that there is no possibility that it -# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces -# that are not a multiple of five. The following board is an example of a prunable board: -# 0 0 1 0 0 -# 0 1 0 0 0 -# 1 1 0 0 0 -# 0 1 0 0 0 -# 0 0 0 0 0 -# ... -# -# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it -# parameters: -# board -- an initial bit board (6 bit padded rows, see blank_board for format) -# location -- starting location, everything above and to the left is already full -# slotting -- set to true only when testing initial pieces, when filling normally -# additional assumptions are possible -# -# Algorithm: -# The algorithm starts at the top row (as determined by location) and iterates a row at a time -# maintainng counts of active open areas (kept in the collector array) each collector contains -# three values at the start of an iteration: -# 0: mask of bits that would be adjacent to the collector in this row -# 1: the number of bits collected so far -# 2: a scratch space starting as zero, but used during the computation to represent -# the empty bits in the new row that are adjacent (position 0) -# The exact procedure is described in-code -def prunable( board, location, slotting = false) - collectors = [] - # loop accross the rows - (location / 6).to_i.upto(9) do | row_on | - # obtain a set of regions representing the bits of the curent row. - regions = $regions[(board >> (row_on * 6)) & 0b11111] - converter = $converter[row_on] - - # track the number of collectors at the start of the cycle so that - # we don't compute against newly created collectors, only existing collectors - initial_collector_count = collectors.length - - # loop against the regions. For each region of the row - # we will see if it connects to one or more existing collectors. - # if it connects to 1 collector, the bits from the region are added to the - # bits of the collector and the mask is placed in collector[2] - # If the region overlaps more than one collector then all the collectors - # it overlaps with are merged into the first one (the others are set to nil in the array) - # if NO collectors are found then the region is copied as a new collector - regions.each do | region | - collector_found = nil - region_mask = region[2] - initial_collector_count.times do | collector_num | - collector = collectors[collector_num] - if (collector) then - collector_mask = collector[0] - if (collector_mask & region_mask != 0) then - if (collector_found) then - collector_found[0] |= collector_mask - collector_found[1] += collector[1] - collector_found[2] |= collector[2] - collectors[collector_num] = nil - else - collector_found = collector - collector[1] += region[1] - collector[2] |= region_mask - end - end - end - end - if (collector_found == nil) then - collectors.push(Array.new(region)) - end - end - - # check the existing collectors, if any collector overlapped no bits in the region its [2] value will - # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since - # the board is prunable. if it is a multiple of five it is removed. - # Collector that are still active have a new adjacent value [0] set based n the matched bits - # and have [2] cleared out for the next cycle. - collectors.length.times do | collector_num | - collector = collectors[collector_num] - if (collector) then - if (collector[2] == 0) then - return true if (collector[1] % 5 != 0) - collectors[collector_num] = nil - else - # if a collector matches all bits in the row then we can return unprunable early for the - # follwing reasons: - # 1) there can be no more unavailable bits bince we fill from the top left downward - # 2) all previous regions have been closed or joined so only this region can fail - # 3) this region must be good since there can never be only 1 region that is nuot - # a multiple of five - # this rule only applies when filling normally, so we ignore the rule if we are "slotting" - # in pieces to see what configurations work for them (the only other time this algorithm is used). - return false if (collector[2] == 0b11111 && !slotting) - collector[0] = converter[collector[2]] - collector[2] = 0 - end - end - end - - # get rid of all the empty converters for the next round - collectors.compact! - end - return false if (collectors.length <= 1) # 1 collector or less and the region is fine - collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size -end - -# creates a region given a row mask. see prunable for what a "region" is -def create_regions( value ) - regions = [] - cur_region = 0 - 5.times do | bit | - if (value[bit] == 0) then - cur_region |= 1 << bit - else - if (cur_region != 0 ) then - regions.push( cur_region) - cur_region = 0; - end - end - end - regions.push(cur_region) if (cur_region != 0) - regions -end - -# find up to the counted number of solutions (or all solutions) and prints the final result -def find_all - find_top( 1) - find_top( 0) - print_results -end - -# show the board -def print_results - print "#{@boards_found} solutions found\n\n" - print_full_board( @min_board) - print "\n" - print_full_board( @max_board) - print "\n" -end - -# finds solutions. This special version of the main function is only used for the top level -# the reason for it is basically to force a particular ordering on how the rotations are tested for -# the first piece. It is called twice, first looking for placements of the odd rotations and then -# looking for placements of the even locations. -# -# WHY? -# Since any found solution has an inverse we want to maximize finding solutions that are not already found -# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away -# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier -# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will -# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces -# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the -# maximum number -def find_top( rotation_skip) - board = blank_board - (@pieces.length-1).times do - piece = @pieces.shift - piece.masks[0].each do | mask, imask, cmask | - if ((rotation_skip += 1) % 2 == 0) then - piece.placed = mask - find( 1, 1, board | mask) - end - end - @pieces.push(piece) - end - piece = @pieces.shift - @pieces.push(piece) -end - -# the normail find routine, iterates through the available pieces, checks all rotations at the current location -# and adds any boards found. depth is acheived via recursion. the overall approach is described -# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ -# parameters: -# start_location -- where to start looking for place for the next piece at -# placed -- number of pieces placed -# board -- current state of the board -# -# see in-code comments -def find( start_location, placed, board) - # find the next location to place a piece by looking for an empty bit - while board[start_location] == 1 - start_location += 1 - end - - @pieces.length.times do - piece = @pieces.shift - piece.masks[start_location].each do | mask, imask, cmask | - if ( board & cmask == imask) then - piece.placed = mask - if (placed == 9) then - add_board - else - find( start_location + 1, placed + 1, board | mask) - end - end - end - @pieces.push(piece) - end -end - -# print the board -def print_full_board( board_string) - 10.times do | row | - print " " if (row % 2 == 1) - 5.times do | col | - print "#{board_string[row*5 + col,1]} " - end - print "\n" - end -end - -# when a board is found we "draw it" into a string and then flip that string, adding both to -# the list (hash) of solutions if they are unique. -def add_board - board_string = "99999999999999999999999999999999999999999999999999" - @all_pieces.each { | piece | piece.fill_string( board_string ) } - save( board_string) - save( board_string.reverse) -end - -# adds a board string to the list (if new) and updates the current best/worst board -def save( board_string) - if (@all_boards[board_string] == nil) then - @min_board = board_string if (board_string < @min_board) - @max_board = board_string if (board_string > @max_board) - @all_boards.store(board_string,true) - @boards_found += 1 - - # the exit motif is a time saver. Ideally the function should return, but those tests - # take noticable time (performance). - if (@boards_found == @stop_count) then - print_results - exit(0) - end - end -end - - -## -## MAIN BODY :) -## -create_collector_support -@pieces = [ - Piece.new( [ :nw, :ne, :east, :east ], 2), - Piece.new( [ :ne, :se, :east, :ne ], 7), - Piece.new( [ :ne, :east, :ne, :nw ], 1), - Piece.new( [ :east, :sw, :sw, :se ], 6), - Piece.new( [ :east, :ne, :se, :ne ], 5), - Piece.new( [ :east, :east, :east, :se ], 0), - Piece.new( [ :ne, :nw, :se, :east, :se ], 4), - Piece.new( [ :se, :se, :se, :west ], 9), - Piece.new( [ :se, :se, :east, :se ], 8), - Piece.new( [ :east, :east, :sw, :se ], 3) - ]; - -@all_pieces = Array.new( @pieces) - -@min_board = "99999999999999999999999999999999999999999999999999" -@max_board = "00000000000000000000000000000000000000000000000000" -@stop_count = ARGV[0].to_i || 2089 -@all_boards = {} -@boards_found = 0 - -find_all ######## DO IT!!! - diff --git a/trunk/benchmark/bm_so_nbody.rb b/trunk/benchmark/bm_so_nbody.rb deleted file mode 100644 index d6c5bb9e61..0000000000 --- a/trunk/benchmark/bm_so_nbody.rb +++ /dev/null @@ -1,148 +0,0 @@ -# The Computer Language Shootout -# http://shootout.alioth.debian.org -# -# Optimized for Ruby by Jesse Millikan -# From version ported by Michael Neumann from the C gcc version, -# which was written by Christoph Bauer. - -SOLAR_MASS = 4 * Math::PI**2 -DAYS_PER_YEAR = 365.24 - -def _puts *args -end - -class Planet - attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass - - def initialize(x, y, z, vx, vy, vz, mass) - @x, @y, @z = x, y, z - @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR - @mass = mass * SOLAR_MASS - end - - def move_from_i(bodies, nbodies, dt, i) - while i < nbodies - b2 = bodies[i] - dx = @x - b2.x - dy = @y - b2.y - dz = @z - b2.z - - distance = Math.sqrt(dx * dx + dy * dy + dz * dz) - mag = dt / (distance * distance * distance) - b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag - - @vx -= dx * b2_mass_mag - @vy -= dy * b2_mass_mag - @vz -= dz * b2_mass_mag - b2.vx += dx * b_mass_mag - b2.vy += dy * b_mass_mag - b2.vz += dz * b_mass_mag - i += 1 - end - - @x += dt * @vx - @y += dt * @vy - @z += dt * @vz - end -end - -def energy(bodies) - e = 0.0 - nbodies = bodies.size - - for i in 0 ... nbodies - b = bodies[i] - e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz) - for j in (i + 1) ... nbodies - b2 = bodies[j] - dx = b.x - b2.x - dy = b.y - b2.y - dz = b.z - b2.z - distance = Math.sqrt(dx * dx + dy * dy + dz * dz) - e -= (b.mass * b2.mass) / distance - end - end - e -end - -def offset_momentum(bodies) - px, py, pz = 0.0, 0.0, 0.0 - - for b in bodies - m = b.mass - px += b.vx * m - py += b.vy * m - pz += b.vz * m - end - - b = bodies[0] - b.vx = - px / SOLAR_MASS - b.vy = - py / SOLAR_MASS - b.vz = - pz / SOLAR_MASS -end - -BODIES = [ - # sun - Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0), - - # jupiter - Planet.new( - 4.84143144246472090e+00, - -1.16032004402742839e+00, - -1.03622044471123109e-01, - 1.66007664274403694e-03, - 7.69901118419740425e-03, - -6.90460016972063023e-05, - 9.54791938424326609e-04), - - # saturn - Planet.new( - 8.34336671824457987e+00, - 4.12479856412430479e+00, - -4.03523417114321381e-01, - -2.76742510726862411e-03, - 4.99852801234917238e-03, - 2.30417297573763929e-05, - 2.85885980666130812e-04), - - # uranus - Planet.new( - 1.28943695621391310e+01, - -1.51111514016986312e+01, - -2.23307578892655734e-01, - 2.96460137564761618e-03, - 2.37847173959480950e-03, - -2.96589568540237556e-05, - 4.36624404335156298e-05), - - # neptune - Planet.new( - 1.53796971148509165e+01, - -2.59193146099879641e+01, - 1.79258772950371181e-01, - 2.68067772490389322e-03, - 1.62824170038242295e-03, - -9.51592254519715870e-05, - 5.15138902046611451e-05) -] - -init = 200_000 # ARGV[0] -n = Integer(init) - -offset_momentum(BODIES) - -puts "%.9f" % energy(BODIES) - -nbodies = BODIES.size -dt = 0.01 - -n.times do - i = 0 - while i < nbodies - b = BODIES[i] - b.move_from_i(BODIES, nbodies, dt, i + 1) - i += 1 - end -end - -puts "%.9f" % energy(BODIES) diff --git a/trunk/benchmark/bm_so_nested_loop.rb b/trunk/benchmark/bm_so_nested_loop.rb deleted file mode 100644 index a0513f8c47..0000000000 --- a/trunk/benchmark/bm_so_nested_loop.rb +++ /dev/null @@ -1,24 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ -# from Avi Bryant - -n = 16 # Integer(ARGV.shift || 1) -x = 0 -n.times do - n.times do - n.times do - n.times do - n.times do - n.times do - x += 1 - end - end - end - end - end -end -# puts x - - diff --git a/trunk/benchmark/bm_so_nsieve.rb b/trunk/benchmark/bm_so_nsieve.rb deleted file mode 100644 index a65cc78233..0000000000 --- a/trunk/benchmark/bm_so_nsieve.rb +++ /dev/null @@ -1,35 +0,0 @@ -# The Computer Language Shootout -# http://shootout.alioth.debian.org/ -# -# contributed by Glenn Parker, March 2005 -# modified by Evan Phoenix, Sept 2006 - -def sieve(m) - flags = Flags.dup[0,m] - count = 0 - pmax = m - 1 - p = 2 - while p <= pmax - unless flags[p].zero? - count += 1 - mult = p - while mult <= pmax - flags[mult] = 0 - mult += p - end - end - p += 1 - end - count -end - -n = 9 # (ARGV[0] || 2).to_i -Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*") - -n.downto(n-2) do |exponent| - break if exponent < 0 - m = (1 << exponent) * 10_000 - # m = (2 ** exponent) * 10_000 - count = sieve(m) - printf "Primes up to %8d %8d\n", m, count -end diff --git a/trunk/benchmark/bm_so_nsieve_bits.rb b/trunk/benchmark/bm_so_nsieve_bits.rb deleted file mode 100644 index 019b8b6382..0000000000 --- a/trunk/benchmark/bm_so_nsieve_bits.rb +++ /dev/null @@ -1,42 +0,0 @@ -#!/usr/bin/ruby -# -# The Great Computer Language Shootout -# http://shootout.alioth.debian.org/ -# -# nsieve-bits in Ruby -# Contributed by Glenn Parker, March 2005 - -CharExponent = 3 -BitsPerChar = 1 << CharExponent -LowMask = BitsPerChar - 1 - -def sieve(m) - items = "\xFF" * ((m / BitsPerChar) + 1) - masks = "" - BitsPerChar.times do |b| - masks << (1 << b).chr - end - - count = 0 - pmax = m - 1 - 2.step(pmax, 1) do |p| - if items[p >> CharExponent][p & LowMask] == 1 - count += 1 - p.step(pmax, p) do |mult| - a = mult >> CharExponent - b = mult & LowMask - items[a] -= masks[b] if items[a][b] != 0 - end - end - end - count -end - -n = 9 # (ARGV[0] || 2).to_i -n.step(n - 2, -1) do |exponent| - break if exponent < 0 - m = 2 ** exponent * 10_000 - count = sieve(m) - printf "Primes up to %8d %8d\n", m, count -end - diff --git a/trunk/benchmark/bm_so_object.rb b/trunk/benchmark/bm_so_object.rb deleted file mode 100644 index e8607c7199..0000000000 --- a/trunk/benchmark/bm_so_object.rb +++ /dev/null @@ -1,56 +0,0 @@ -#!/usr/bin/ruby -# -*- mode: ruby -*- -# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $ -# http://www.bagley.org/~doug/shootout/ -# with help from Aristarkh Zagorodnikov - -class Toggle - def initialize(start_state) - @bool = start_state - end - - def value - @bool - end - - def activate - @bool = !@bool - self - end -end - -class NthToggle < Toggle - def initialize(start_state, max_counter) - super start_state - @count_max = max_counter - @counter = 0 - end - - def activate - @counter += 1 - if @counter >= @count_max - @bool = !@bool - @counter = 0 - end - self - end -end - -n = 1500000 # (ARGV.shift || 1).to_i - -toggle = Toggle.new 1 -5.times do - toggle.activate.value ? 'true' : 'false' -end -n.times do - toggle = Toggle.new 1 -end - -ntoggle = NthToggle.new 1, 3 -8.times do - ntoggle.activate.value ? 'true' : 'false' -end -n.times do - ntoggle = NthToggle.new 1, 3 -end - diff --git a/trunk/benchmark/bm_so_partial_sums.rb b/trunk/benchmark/bm_so_partial_sums.rb deleted file mode 100644 index 630b45cb8d..0000000000 --- a/trunk/benchmark/bm_so_partial_sums.rb +++ /dev/null @@ -1,31 +0,0 @@ -n = 2_500_000 # (ARGV.shift || 1).to_i - -alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0 - -1.upto(n) do |d| - d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d) - - s0 += (2.0 / 3.0) ** (d - 1.0) - s1 += 1.0 / Math.sqrt(d) - s2 += 1.0 / (d * (d + 1.0)) - s3 += 1.0 / (d3 * ds * ds) - s4 += 1.0 / (d3 * dc * dc) - s5 += 1.0 / d - s6 += 1.0 / d2 - s7 += alt / d - s8 += alt / (2.0 * d - 1.0) - - alt = -alt -end - -if false - printf("%.9f\t(2/3)^k\n", s0) - printf("%.9f\tk^-0.5\n", s1) - printf("%.9f\t1/k(k+1)\n", s2) - printf("%.9f\tFlint Hills\n", s3) - printf("%.9f\tCookson Hills\n", s4) - printf("%.9f\tHarmonic\n", s5) - printf("%.9f\tRiemann Zeta\n", s6) - printf("%.9f\tAlternating Harmonic\n", s7) - printf("%.9f\tGregory\n", s8) -end diff --git a/trunk/benchmark/bm_so_pidigits.rb b/trunk/benchmark/bm_so_pidigits.rb deleted file mode 100644 index c7d6fbfb4d..0000000000 --- a/trunk/benchmark/bm_so_pidigits.rb +++ /dev/null @@ -1,92 +0,0 @@ -# The Great Computer Language Shootout -# http://shootout.alioth.debian.org/ -# -# contributed by Gabriele Renzi - -class PiDigitSpigot - - def initialize() - @z = Transformation.new 1,0,0,1 - @x = Transformation.new 0,0,0,0 - @inverse = Transformation.new 0,0,0,0 - end - - def next! - @y = @z.extract(3) - if safe? @y - @z = produce(@y) - @y - else - @z = consume @x.next!() - next!() - end - end - - def safe?(digit) - digit == @z.extract(4) - end - - def produce(i) - @inverse.qrst(10,-10*i,0,1).compose(@z) - end - - def consume(a) - @z.compose(a) - end -end - - -class Transformation - attr_reader :q, :r, :s, :t - def initialize (q, r, s, t) - @q,@r,@s,@t,@k = q,r,s,t,0 - end - - def next!() - @q = @k = @k + 1 - @r = 4 * @k + 2 - @s = 0 - @t = 2 * @k + 1 - self - end - - def extract(j) - (@q * j + @r) / (@s * j + @t) - end - - def compose(a) - self.class.new( @q * a.q, - @q * a.r + r * a.t, - @s * a.q + t * a.s, - @s * a.r + t * a.t - ) - end - - def qrst *args - initialize *args - self - end - - -end - - -WIDTH = 10 -n = 2_500 # Integer(ARGV[0]) -j = 0 - -digits = PiDigitSpigot.new - -while n > 0 - if n >= WIDTH - WIDTH.times {print digits.next!} - j += WIDTH - else - n.times {print digits.next!} - (WIDTH-n).times {print " "} - j += n - end - puts "\t:"+j.to_s - n -= WIDTH -end - diff --git a/trunk/benchmark/bm_so_random.rb b/trunk/benchmark/bm_so_random.rb deleted file mode 100644 index 83c0d6d380..0000000000 --- a/trunk/benchmark/bm_so_random.rb +++ /dev/null @@ -1,20 +0,0 @@ -# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby - -IM = 139968.0 -IA = 3877.0 -IC = 29573.0 - -$last = 42.0 - -def gen_random(max) - (max * ($last = ($last * IA + IC) % IM)) / IM -end - -N = 1000000 - -i=0 -while i<N - i+=1 - gen_random(100.0) -end -# "%.9f" % gen_random(100.0) diff --git a/trunk/benchmark/bm_so_reverse_complement.rb b/trunk/benchmark/bm_so_reverse_complement.rb deleted file mode 100644 index 82ea666994..0000000000 --- a/trunk/benchmark/bm_so_reverse_complement.rb +++ /dev/null @@ -1,30 +0,0 @@ -#!/usr/bin/ruby -# The Great Computer Language Shootout -# http://shootout.alioth.debian.org/ -# -# Contributed by Peter Bjarke Olsen -# Modified by Doug King - -seq=Array.new - -def revcomp(seq) - seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN') - stringlen=seq.length - 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"} -end - -input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb') - -while input.gets - if $_ =~ />/ - if seq.length != 0 - revcomp(seq.join) - seq=Array.new - end - puts $_ - else - $_.sub(/\n/,'') - seq.push $_ - end -end -revcomp(seq.join) diff --git a/trunk/benchmark/bm_so_sieve.rb b/trunk/benchmark/bm_so_sieve.rb deleted file mode 100644 index dbe2bfa63d..0000000000 --- a/trunk/benchmark/bm_so_sieve.rb +++ /dev/null @@ -1,24 +0,0 @@ -# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby -num = 40 -count = i = j = 0 -flags0 = Array.new(8192,1) -k = 0 -while k < num - k+=1 - count = 0 - flags = flags0.dup - i = 2 - while i<8192 - i+=1 - if flags[i] - # remove all multiples of prime: i - j = i*i - while j < 8192 - j += i - flags[j] = nil - end - count += 1 - end - end -end -count diff --git a/trunk/benchmark/bm_so_spectralnorm.rb b/trunk/benchmark/bm_so_spectralnorm.rb deleted file mode 100644 index 6b97206689..0000000000 --- a/trunk/benchmark/bm_so_spectralnorm.rb +++ /dev/null @@ -1,50 +0,0 @@ -# The Computer Language Shootout -# http://shootout.alioth.debian.org/ -# Contributed by Sokolov Yura - -def eval_A(i,j) - return 1.0/((i+j)*(i+j+1)/2+i+1) -end - -def eval_A_times_u(u) - v, i = nil, nil - (0..u.length-1).collect { |i| - v = 0 - for j in 0..u.length-1 - v += eval_A(i,j)*u[j] - end - v - } -end - -def eval_At_times_u(u) - v, i = nil, nil - (0..u.length-1).collect{|i| - v = 0 - for j in 0..u.length-1 - v += eval_A(j,i)*u[j] - end - v - } -end - -def eval_AtA_times_u(u) - return eval_At_times_u(eval_A_times_u(u)) -end - -n = 500 # ARGV[0].to_i - -u=[1]*n -for i in 1..10 - v=eval_AtA_times_u(u) - u=eval_AtA_times_u(v) -end -vBv=0 -vv=0 -for i in 0..n-1 - vBv += u[i]*v[i] - vv += v[i]*v[i] -end - -str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n" -# print str diff --git a/trunk/benchmark/bm_vm1_block.rb b/trunk/benchmark/bm_vm1_block.rb deleted file mode 100644 index 2dc4e72be5..0000000000 --- a/trunk/benchmark/bm_vm1_block.rb +++ /dev/null @@ -1,10 +0,0 @@ -def m - yield -end - -i=0 -while i<30000000 # while loop 1 - i+=1 - m{ - } -end
\ No newline at end of file diff --git a/trunk/benchmark/bm_vm1_const.rb b/trunk/benchmark/bm_vm1_const.rb deleted file mode 100644 index 3e395d9478..0000000000 --- a/trunk/benchmark/bm_vm1_const.rb +++ /dev/null @@ -1,8 +0,0 @@ -Const = 1 - -i = 0 -while i<30000000 # while loop 1 - i+= 1 - j = Const - k = Const -end diff --git a/trunk/benchmark/bm_vm1_ensure.rb b/trunk/benchmark/bm_vm1_ensure.rb deleted file mode 100644 index c3b71ead5a..0000000000 --- a/trunk/benchmark/bm_vm1_ensure.rb +++ /dev/null @@ -1,11 +0,0 @@ -i=0 -while i<30000000 # benchmark loop 1 - i+=1 - begin - begin - ensure - end - ensure - end -end - diff --git a/trunk/benchmark/bm_vm1_ivar.rb b/trunk/benchmark/bm_vm1_ivar.rb deleted file mode 100644 index 4de833a316..0000000000 --- a/trunk/benchmark/bm_vm1_ivar.rb +++ /dev/null @@ -1,8 +0,0 @@ -@a = 1 - -i = 0 -while i<30000000 # while loop 1 - i+= 1 - j = @a - k = @a -end diff --git a/trunk/benchmark/bm_vm1_ivar_set.rb b/trunk/benchmark/bm_vm1_ivar_set.rb deleted file mode 100644 index c8076c6ab6..0000000000 --- a/trunk/benchmark/bm_vm1_ivar_set.rb +++ /dev/null @@ -1,6 +0,0 @@ -i = 0 -while i<30_000_000 # while loop 1 - i+= 1 - @a = 1 - @b = 2 -end diff --git a/trunk/benchmark/bm_vm1_length.rb b/trunk/benchmark/bm_vm1_length.rb deleted file mode 100644 index 2d7d7f0b52..0000000000 --- a/trunk/benchmark/bm_vm1_length.rb +++ /dev/null @@ -1,9 +0,0 @@ -a = 'abc' -b = [1, 2, 3] -i=0 -while i<30000000 # while loop 1 - i+=1 - a.length - b.length -end - diff --git a/trunk/benchmark/bm_vm1_neq.rb b/trunk/benchmark/bm_vm1_neq.rb deleted file mode 100644 index 212f056c6e..0000000000 --- a/trunk/benchmark/bm_vm1_neq.rb +++ /dev/null @@ -1,8 +0,0 @@ -i = 0 -obj1 = Object.new -obj2 = Object.new - -while i<30000000 # while loop 1 - i+= 1 - obj1 != obj2 -end diff --git a/trunk/benchmark/bm_vm1_not.rb b/trunk/benchmark/bm_vm1_not.rb deleted file mode 100644 index f139fed8be..0000000000 --- a/trunk/benchmark/bm_vm1_not.rb +++ /dev/null @@ -1,7 +0,0 @@ -i = 0 -obj = Object.new - -while i<30000000 # while loop 1 - i+= 1 - !obj -end diff --git a/trunk/benchmark/bm_vm1_rescue.rb b/trunk/benchmark/bm_vm1_rescue.rb deleted file mode 100644 index 0c98d00e0d..0000000000 --- a/trunk/benchmark/bm_vm1_rescue.rb +++ /dev/null @@ -1,7 +0,0 @@ -i=0 -while i<30000000 # while loop 1 - i+=1 - begin - rescue - end -end diff --git a/trunk/benchmark/bm_vm1_simplereturn.rb b/trunk/benchmark/bm_vm1_simplereturn.rb deleted file mode 100644 index c843ee3d97..0000000000 --- a/trunk/benchmark/bm_vm1_simplereturn.rb +++ /dev/null @@ -1,9 +0,0 @@ -def m - return 1 -end -i=0 -while i<30000000 # while loop 1 - i+=1 - m -end - diff --git a/trunk/benchmark/bm_vm1_swap.rb b/trunk/benchmark/bm_vm1_swap.rb deleted file mode 100644 index a565b6f6dc..0000000000 --- a/trunk/benchmark/bm_vm1_swap.rb +++ /dev/null @@ -1,8 +0,0 @@ -a = 1 -b = 2 -i=0 -while i<30000000 # while loop 1 - i+=1 - a, b = b, a -end - diff --git a/trunk/benchmark/bm_vm2_array.rb b/trunk/benchmark/bm_vm2_array.rb deleted file mode 100644 index e29c11200f..0000000000 --- a/trunk/benchmark/bm_vm2_array.rb +++ /dev/null @@ -1,5 +0,0 @@ -i=0 -while i<6000000 # benchmark loop 2 - i+=1 - a = [1,2,3,4,5,6,7,8,9,10] -end diff --git a/trunk/benchmark/bm_vm2_case.rb b/trunk/benchmark/bm_vm2_case.rb deleted file mode 100644 index 1ec34ad692..0000000000 --- a/trunk/benchmark/bm_vm2_case.rb +++ /dev/null @@ -1,14 +0,0 @@ -i=0 -while i<6000000 # while loop 2 - case :foo - when :bar - raise - when :baz - raise - when :boo - raise - when :foo - i+=1 - end -end - diff --git a/trunk/benchmark/bm_vm2_eval.rb b/trunk/benchmark/bm_vm2_eval.rb deleted file mode 100644 index 375dccc00e..0000000000 --- a/trunk/benchmark/bm_vm2_eval.rb +++ /dev/null @@ -1,6 +0,0 @@ -i=0 -while i<6000000 # benchmark loop 2 - i+=1 - eval("1") -end - diff --git a/trunk/benchmark/bm_vm2_method.rb b/trunk/benchmark/bm_vm2_method.rb deleted file mode 100644 index cc94b8ab3d..0000000000 --- a/trunk/benchmark/bm_vm2_method.rb +++ /dev/null @@ -1,9 +0,0 @@ -def m - nil -end - -i=0 -while i<6000000 # benchmark loop 2 - i+=1 - m; m; m; m; m; m; m; m; -end diff --git a/trunk/benchmark/bm_vm2_mutex.rb b/trunk/benchmark/bm_vm2_mutex.rb deleted file mode 100644 index 9ec1a0f136..0000000000 --- a/trunk/benchmark/bm_vm2_mutex.rb +++ /dev/null @@ -1,9 +0,0 @@ -require 'thread' - -m = Mutex.new - -i=0 -while i<6000000 # benchmark loop 2 - i+=1 - m.synchronize{} -end diff --git a/trunk/benchmark/bm_vm2_poly_method.rb b/trunk/benchmark/bm_vm2_poly_method.rb deleted file mode 100644 index ac9953ce5f..0000000000 --- a/trunk/benchmark/bm_vm2_poly_method.rb +++ /dev/null @@ -1,20 +0,0 @@ -class C1 - def m - 1 - end -end -class C2 - def m - 2 - end -end - -o1 = C1.new -o2 = C2.new - -i=0 -while i<6000000 # benchmark loop 2 - o = (i % 2 == 0) ? o1 : o2 - o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m - i+=1 -end diff --git a/trunk/benchmark/bm_vm2_poly_method_ov.rb b/trunk/benchmark/bm_vm2_poly_method_ov.rb deleted file mode 100644 index 856ba9b161..0000000000 --- a/trunk/benchmark/bm_vm2_poly_method_ov.rb +++ /dev/null @@ -1,20 +0,0 @@ -class C1 - def m - 1 - end -end -class C2 - def m - 2 - end -end - -o1 = C1.new -o2 = C2.new - -i=0 -while i<6000000 # benchmark loop 2 - o = (i % 2 == 0) ? o1 : o2 -# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m - i+=1 -end diff --git a/trunk/benchmark/bm_vm2_proc.rb b/trunk/benchmark/bm_vm2_proc.rb deleted file mode 100644 index 0bd05b9544..0000000000 --- a/trunk/benchmark/bm_vm2_proc.rb +++ /dev/null @@ -1,14 +0,0 @@ -def m &b - b -end - -pr = m{ - a = 1 -} - -i=0 -while i<6000000 # benchmark loop 2 - i+=1 - pr.call -end - diff --git a/trunk/benchmark/bm_vm2_regexp.rb b/trunk/benchmark/bm_vm2_regexp.rb deleted file mode 100644 index 44f6ed402e..0000000000 --- a/trunk/benchmark/bm_vm2_regexp.rb +++ /dev/null @@ -1,6 +0,0 @@ -i=0 -str = 'xxxhogexxx' -while i<6000000 # benchmark loop 2 - /hoge/ =~ str - i+=1 -end diff --git a/trunk/benchmark/bm_vm2_send.rb b/trunk/benchmark/bm_vm2_send.rb deleted file mode 100644 index c20dbdd26c..0000000000 --- a/trunk/benchmark/bm_vm2_send.rb +++ /dev/null @@ -1,12 +0,0 @@ -class C - def m - end -end - -o = C.new - -i=0 -while i<6000000 # benchmark loop 2 - i+=1 - o.__send__ :m -end diff --git a/trunk/benchmark/bm_vm2_super.rb b/trunk/benchmark/bm_vm2_super.rb deleted file mode 100644 index 70c86b376f..0000000000 --- a/trunk/benchmark/bm_vm2_super.rb +++ /dev/null @@ -1,20 +0,0 @@ - -class C - def m - 1 - end -end - -class CC < C - def m - super() - end -end - -obj = CC.new - -i = 0 -while i<6000000 # benchmark loop 2 - obj.m - i+=1 -end diff --git a/trunk/benchmark/bm_vm2_unif1.rb b/trunk/benchmark/bm_vm2_unif1.rb deleted file mode 100644 index e12bd2ade0..0000000000 --- a/trunk/benchmark/bm_vm2_unif1.rb +++ /dev/null @@ -1,8 +0,0 @@ -i = 0 -def m a, b -end - -while i<6000000 # benchmark loop 2 - i+=1 - m 100, 200 -end diff --git a/trunk/benchmark/bm_vm2_zsuper.rb b/trunk/benchmark/bm_vm2_zsuper.rb deleted file mode 100644 index 3a75960403..0000000000 --- a/trunk/benchmark/bm_vm2_zsuper.rb +++ /dev/null @@ -1,20 +0,0 @@ -i = 0 - -class C - def m a - 1 - end -end - -class CC < C - def m a - super - end -end - -obj = CC.new - -while i<6000000 # benchmark loop 2 - obj.m 10 - i+=1 -end diff --git a/trunk/benchmark/bm_vm3_gc.rb b/trunk/benchmark/bm_vm3_gc.rb deleted file mode 100755 index 7db9829d44..0000000000 --- a/trunk/benchmark/bm_vm3_gc.rb +++ /dev/null @@ -1,7 +0,0 @@ -#! /usr/bin/ruby -5000.times do - 100.times do - {"xxxx"=>"yyyy"} - end - GC.start -end diff --git a/trunk/benchmark/bm_vm3_thread_create_join.rb b/trunk/benchmark/bm_vm3_thread_create_join.rb deleted file mode 100644 index 325a66d587..0000000000 --- a/trunk/benchmark/bm_vm3_thread_create_join.rb +++ /dev/null @@ -1,6 +0,0 @@ -i=0 -while i<100_000 # benchmark loop 3 - i+=1 - Thread.new{ - }.join -end diff --git a/trunk/benchmark/bm_vm3_thread_mutex.rb b/trunk/benchmark/bm_vm3_thread_mutex.rb deleted file mode 100644 index 649f1fddac..0000000000 --- a/trunk/benchmark/bm_vm3_thread_mutex.rb +++ /dev/null @@ -1,18 +0,0 @@ -require 'thread' -m = Mutex.new -r = 0 -max = 1000 -(1..max).map{ - Thread.new{ - i=0 - while i<max - i+=1 - m.synchronize{ - r += 1 - } - end - } -}.each{|e| - e.join -} -raise r.to_s if r != max * max diff --git a/trunk/benchmark/bmx_temp.rb b/trunk/benchmark/bmx_temp.rb deleted file mode 100644 index 0b4b219ca2..0000000000 --- a/trunk/benchmark/bmx_temp.rb +++ /dev/null @@ -1,9 +0,0 @@ -def m - nil -end - -i=0 -while i<800000 # benchmark loop 2 - i+=1 - m; m; m; m; m; m; m; m; -end diff --git a/trunk/benchmark/driver.rb b/trunk/benchmark/driver.rb deleted file mode 100644 index 4a1afe360b..0000000000 --- a/trunk/benchmark/driver.rb +++ /dev/null @@ -1,253 +0,0 @@ -# -# Ruby Benchmark driver -# - -first = true - -p RUBY_VERSION - -begin - require 'optparse' -rescue LoadError - if first - first = false - $:.unshift File.join(File.dirname(__FILE__), '../lib') - retry - else - raise - end -end - -require 'benchmark' -require 'pp' - -class BenchmarkDriver - def self.benchmark(opt) - driver = self.new(opt[:execs], opt[:dir], opt) - begin - driver.run - ensure - driver.show_results - end - end - - def output *args - puts(*args) - @output and @output.puts(*args) - end - - def message *args - output(*args) if @verbose - end - - def message_print *args - if @verbose - print(*args) - STDOUT.flush - @output and @output.print(*args) - end - end - - def progress_message *args - unless STDOUT.tty? - STDERR.print(*args) - STDERR.flush - end - end - - def initialize execs, dir, opt = {} - @execs = execs.map{|e| - e.strip! - next if e.empty? - - if /(.+)::(.+)/ =~ e - # ex) ruby-a::/path/to/ruby-a - v = $1.strip - e = $2 - else - v = `#{e} -v`.chomp - v.sub!(/ patchlevel \d+/, '') - end - [e, v] - }.compact - - @dir = dir - @repeat = opt[:repeat] || 1 - @repeat = 1 if @repeat < 1 - @pattern = opt[:pattern] || nil - @verbose = opt[:quiet] ? false : (opt[:verbose] || false) - @output = opt[:output] ? open(opt[:output], 'w') : nil - @loop_wl1 = @loop_wl2 = nil - @opt = opt - - # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...] - @results = [] - - if @verbose - @start_time = Time.now - message @start_time - @execs.each_with_index{|(e, v), i| - message "target #{i}: #{v}" - } - end - end - - def show_results - output - - if @verbose - message '-----------------------------------------------------------' - message 'raw data:' - message - message PP.pp(@results, "", 79) - message - message "Elapesed time: #{Time.now - @start_time} (sec)" - end - - output '-----------------------------------------------------------' - output 'benchmark results:' - - if @verbose and @repeat > 1 - output "minimum results in each #{@repeat} measurements." - end - - output "name\t#{@execs.map{|(e, v)| v}.join("\t")}" - @results.each{|v, result| - rets = [] - s = nil - result.each_with_index{|e, i| - r = e.min - case v - when /^vm1_/ - if @loop_wl1 - r -= @loop_wl1[i] - s = '*' - end - when /^vm2_/ - if @loop_wl2 - r -= @loop_wl2[i] - s = '*' - end - end - rets << sprintf("%.3f", r) - } - output "#{v}#{s}\t#{rets.join("\t")}" - } - end - - def files - flag = {} - vm1 = vm2 = wl1 = wl2 = false - @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file| - next if @pattern && /#{@pattern}/ !~ File.basename(file) - case file - when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/ - flag[$1] = true - end - file - }.compact - - if flag['vm1'] && !flag['whileloop'] - @files << File.join(@dir, 'bm_loop_whileloop.rb') - elsif flag['vm2'] && !flag['whileloop2'] - @files << File.join(@dir, 'bm_loop_whileloop2.rb') - end - - @files.sort! - progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n" - @files - end - - def run - files.each_with_index{|file, i| - @i = i - r = measure_file(file) - - if /bm_loop_whileloop.rb/ =~ file - @loop_wl1 = r[1].map{|e| e.min} - elsif /bm_loop_whileloop2.rb/ =~ file - @loop_wl2 = r[1].map{|e| e.min} - end - } - end - - def measure_file file - name = File.basename(file, '.rb').sub(/^bm_/, '') - prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb") - load prepare_file if FileTest.exist?(prepare_file) - - if @verbose - output - output '-----------------------------------------------------------' - output name - output - output File.read(file) - output - end - - result = [name] - result << @execs.map{|(e, v)| - (0...@repeat).map{ - message_print "#{v}\t" - progress_message '.' - - m = measure(e, file) - message "#{m}" - m - } - } - @results << result - result - end - - def measure executable, file - cmd = "#{executable} #{file}" - m = Benchmark.measure{ - `#{cmd}` - } - - if $? != 0 - raise "Benchmark process exited with abnormal status (#{$?})" - end - - m.real - end -end - -if __FILE__ == $0 - opt = { - :execs => ['ruby'], - :dir => './', - :repeat => 1, - :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}", - } - - parser = OptionParser.new{|o| - o.on('-e', '--executables [EXECS]', - "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e| - opt[:execs] = e.split(/;/) - } - o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d| - opt[:dir] = d - } - o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p| - opt[:pattern] = p - } - o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n| - opt[:repeat] = n.to_i - } - o.on('-o', '--output-file [FILE]', "Output file"){|o| - opt[:output] = o - } - o.on('-q', '--quiet', "Run without notify information except result table."){|q| - opt[:quiet] = q - } - o.on('-v', '--verbose'){|v| - opt[:verbose] = v - } - } - - parser.parse!(ARGV) - BenchmarkDriver.benchmark(opt) -end - diff --git a/trunk/benchmark/make_fasta_output.rb b/trunk/benchmark/make_fasta_output.rb deleted file mode 100644 index b6d787ae27..0000000000 --- a/trunk/benchmark/make_fasta_output.rb +++ /dev/null @@ -1,19 +0,0 @@ -# prepare 'fasta.output' - -def prepare_fasta_output n - filebase = File.join(File.dirname($0), 'fasta.output') - script = File.join(File.dirname($0), 'bm_so_fasta.rb') - file = "#{filebase}.#{n}" - - unless FileTest.exist?(file) - STDERR.puts "preparing #{file}" - - open(file, 'w'){|f| - ARGV[0] = n - $stdout = f - load script - $stdout = STDOUT - } - end -end - diff --git a/trunk/benchmark/other-lang/ack.pl b/trunk/benchmark/other-lang/ack.pl deleted file mode 100644 index 201e22ddfa..0000000000 --- a/trunk/benchmark/other-lang/ack.pl +++ /dev/null @@ -1,11 +0,0 @@ -use integer; - -sub Ack { - return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1)) - : Ack($_[0]-1, 1)) - : $_[1]+1; -} - -my $NUM = 9; -$NUM = 1 if ($NUM < 1); -my $ack = Ack(3, $NUM); diff --git a/trunk/benchmark/other-lang/ack.py b/trunk/benchmark/other-lang/ack.py deleted file mode 100644 index 9968e7cfcf..0000000000 --- a/trunk/benchmark/other-lang/ack.py +++ /dev/null @@ -1,16 +0,0 @@ -import sys -sys.setrecursionlimit(5000000) - -def Ack(M, N): - if (not M): - return( N + 1 ) - if (not N): - return( Ack(M-1, 1) ) - return( Ack(M-1, Ack(M, N-1)) ) - -def main(): - NUM = 9 - sys.setrecursionlimit(10000) - Ack(3, NUM) - -main() diff --git a/trunk/benchmark/other-lang/ack.rb b/trunk/benchmark/other-lang/ack.rb deleted file mode 100644 index 7451bed6c4..0000000000 --- a/trunk/benchmark/other-lang/ack.rb +++ /dev/null @@ -1,12 +0,0 @@ -def ack(m, n) - if m == 0 then - n + 1 - elsif n == 0 then - ack(m - 1, 1) - else - ack(m - 1, ack(m, n - 1)) - end -end - -NUM = 9 -ack(3, NUM) diff --git a/trunk/benchmark/other-lang/ack.scm b/trunk/benchmark/other-lang/ack.scm deleted file mode 100644 index a80b73ba55..0000000000 --- a/trunk/benchmark/other-lang/ack.scm +++ /dev/null @@ -1,7 +0,0 @@ -(define (ack m n) - (cond ((zero? m) (+ n 1)) - ((zero? n) (ack (- m 1) 1)) - (else (ack (- m 1) (ack m (- n 1)))))) - -(ack 3 9) - diff --git a/trunk/benchmark/other-lang/eval.rb b/trunk/benchmark/other-lang/eval.rb deleted file mode 100644 index 3875927389..0000000000 --- a/trunk/benchmark/other-lang/eval.rb +++ /dev/null @@ -1,66 +0,0 @@ - -Bench = %w( - loop - ack - fib - tak - fact -) - -Lang = <<EOP.map{|l| l.strip} - ruby-cyg - ../../../test6/miniruby - perl - python - gosh -EOP - -Bench.replace ['loop2'] -Lang.replace ['ruby-cyg'] - -Ext = %w( - .rb - .rb - .pl - .py - .scm -) - -p Bench -p Lang - -require 'benchmark' - -def bench cmd - m = Benchmark.measure{ - #p cmd - system(cmd) - } - [m.utime, m.real] -end - -Result = [] -Bench.each{|b| - r = [] - Lang.each_with_index{|l, idx| - cmd = "#{l} #{b}#{Ext[idx]}" - r << bench(cmd) - } - Result << r -} - -require 'pp' -# utime -puts Lang.join("\t") -Bench.each_with_index{|b, bi| - print b, "\t" - puts Result[bi].map{|e| e[0]}.join("\t") -} - -# rtime -puts Lang.join("\t") -Bench.each_with_index{|b, bi| - print b, "\t" - puts Result[bi].map{|e| e[1]}.join("\t") -} - diff --git a/trunk/benchmark/other-lang/fact.pl b/trunk/benchmark/other-lang/fact.pl deleted file mode 100644 index a9b0b69cdf..0000000000 --- a/trunk/benchmark/other-lang/fact.pl +++ /dev/null @@ -1,13 +0,0 @@ -sub fact{ - my $n = @_[0]; - if($n < 2){ - return 1; - } - else{ - return $n * fact($n-1); - } -} - -for($i=0; $i<10000; $i++){ - &fact(100); -} diff --git a/trunk/benchmark/other-lang/fact.py b/trunk/benchmark/other-lang/fact.py deleted file mode 100644 index 01593965d9..0000000000 --- a/trunk/benchmark/other-lang/fact.py +++ /dev/null @@ -1,18 +0,0 @@ -#import sys -#sys.setrecursionlimit(1000) - -def factL(n): - r = 1 - for x in range(2, n): - r *= x - return r - -def factR(n): - if n < 2: - return 1 - else: - return n * factR(n-1) - -for i in range(10000): - factR(100) - diff --git a/trunk/benchmark/other-lang/fact.rb b/trunk/benchmark/other-lang/fact.rb deleted file mode 100644 index 7e97b22b39..0000000000 --- a/trunk/benchmark/other-lang/fact.rb +++ /dev/null @@ -1,13 +0,0 @@ -def fact(n) - if n < 2 - 1 - else - n * fact(n-1) - end -end - -i=0 -while i<10000 - i+=1 - fact(100) -end diff --git a/trunk/benchmark/other-lang/fact.scm b/trunk/benchmark/other-lang/fact.scm deleted file mode 100644 index c98a7fedd3..0000000000 --- a/trunk/benchmark/other-lang/fact.scm +++ /dev/null @@ -1,8 +0,0 @@ -(define (fact n) - (if (< n 2) - 1 - (* n (fact (- n 1))))) - -(dotimes (i 10000) - (fact 100)) - diff --git a/trunk/benchmark/other-lang/fib.pl b/trunk/benchmark/other-lang/fib.pl deleted file mode 100644 index a46f666d1e..0000000000 --- a/trunk/benchmark/other-lang/fib.pl +++ /dev/null @@ -1,11 +0,0 @@ -sub fib{ - my $n = $_[0]; - if($n < 3){ - return 1; - } - else{ - return fib($n-1) + fib($n-2); - } -}; - -&fib(34); diff --git a/trunk/benchmark/other-lang/fib.py b/trunk/benchmark/other-lang/fib.py deleted file mode 100644 index 45f2bceb8d..0000000000 --- a/trunk/benchmark/other-lang/fib.py +++ /dev/null @@ -1,7 +0,0 @@ -def fib(n): - if n < 3: - return 1 - else: - return fib(n-1) + fib(n-2) - -fib(34) diff --git a/trunk/benchmark/other-lang/fib.rb b/trunk/benchmark/other-lang/fib.rb deleted file mode 100644 index ec587eabe0..0000000000 --- a/trunk/benchmark/other-lang/fib.rb +++ /dev/null @@ -1,9 +0,0 @@ -def fib n - if n < 3 - 1 - else - fib(n-1) + fib(n-2) - end -end - -fib(34) diff --git a/trunk/benchmark/other-lang/fib.scm b/trunk/benchmark/other-lang/fib.scm deleted file mode 100644 index 2fc4e225bd..0000000000 --- a/trunk/benchmark/other-lang/fib.scm +++ /dev/null @@ -1,7 +0,0 @@ -(define (fib n) - (if (< n 3) - 1 - (+ (fib (- n 1)) (fib (- n 2))))) - -(fib 34) - diff --git a/trunk/benchmark/other-lang/loop.pl b/trunk/benchmark/other-lang/loop.pl deleted file mode 100644 index 2777490aaa..0000000000 --- a/trunk/benchmark/other-lang/loop.pl +++ /dev/null @@ -1,3 +0,0 @@ -for($i=0; $i<30000000; $i++){ -} - diff --git a/trunk/benchmark/other-lang/loop.py b/trunk/benchmark/other-lang/loop.py deleted file mode 100644 index 003749bf3a..0000000000 --- a/trunk/benchmark/other-lang/loop.py +++ /dev/null @@ -1,2 +0,0 @@ -for i in xrange(30000000): - pass diff --git a/trunk/benchmark/other-lang/loop.rb b/trunk/benchmark/other-lang/loop.rb deleted file mode 100644 index d43cef61f3..0000000000 --- a/trunk/benchmark/other-lang/loop.rb +++ /dev/null @@ -1,4 +0,0 @@ -i=0 -while i<30000000 - i+=1 -end diff --git a/trunk/benchmark/other-lang/loop.scm b/trunk/benchmark/other-lang/loop.scm deleted file mode 100644 index 3364f7e679..0000000000 --- a/trunk/benchmark/other-lang/loop.scm +++ /dev/null @@ -1 +0,0 @@ -(dotimes (x 30000000)) diff --git a/trunk/benchmark/other-lang/loop2.rb b/trunk/benchmark/other-lang/loop2.rb deleted file mode 100644 index df8fffc1ff..0000000000 --- a/trunk/benchmark/other-lang/loop2.rb +++ /dev/null @@ -1 +0,0 @@ -30000000.times{} diff --git a/trunk/benchmark/other-lang/tak.pl b/trunk/benchmark/other-lang/tak.pl deleted file mode 100644 index 7e748a67c6..0000000000 --- a/trunk/benchmark/other-lang/tak.pl +++ /dev/null @@ -1,11 +0,0 @@ -sub tak { - local($x, $y, $z) = @_; - if (!($y < $x)) { - return $z; - } else { - return &tak(&tak($x - 1, $y, $z), - &tak($y - 1, $z, $x), - &tak($z - 1, $x, $y)); - } -} -&tak(18, 9, 0); diff --git a/trunk/benchmark/other-lang/tak.py b/trunk/benchmark/other-lang/tak.py deleted file mode 100644 index 04f3f6829c..0000000000 --- a/trunk/benchmark/other-lang/tak.py +++ /dev/null @@ -1,8 +0,0 @@ -def tak(x, y, z): - if not(y<x): - return z - else: - return tak(tak(x-1, y, z), - tak(y-1, z, x), - tak(z-1, x, y)) -tak(18, 9, 0) diff --git a/trunk/benchmark/other-lang/tak.rb b/trunk/benchmark/other-lang/tak.rb deleted file mode 100644 index efe5380f4e..0000000000 --- a/trunk/benchmark/other-lang/tak.rb +++ /dev/null @@ -1,13 +0,0 @@ - -def tak x, y, z - unless y < x - z - else - tak( tak(x-1, y, z), - tak(y-1, z, x), - tak(z-1, x, y)) - end -end - -tak(18, 9, 0) - diff --git a/trunk/benchmark/other-lang/tak.scm b/trunk/benchmark/other-lang/tak.scm deleted file mode 100644 index 52a7629ee5..0000000000 --- a/trunk/benchmark/other-lang/tak.scm +++ /dev/null @@ -1,10 +0,0 @@ -(define (tak x y z) - (if (not (< y x)) - z - (tak (tak (- x 1) y z) - (tak (- y 1) z x) - (tak (- z 1) x y)))) - -(tak 18 9 0) - - diff --git a/trunk/benchmark/prepare_so_count_words.rb b/trunk/benchmark/prepare_so_count_words.rb deleted file mode 100644 index ee2138cdb2..0000000000 --- a/trunk/benchmark/prepare_so_count_words.rb +++ /dev/null @@ -1,15 +0,0 @@ -# prepare 'wc.input' - -def prepare_wc_input - wcinput = File.join(File.dirname($0), 'wc.input') - wcbase = File.join(File.dirname($0), 'wc.input.base') - unless FileTest.exist?(wcinput) - data = File.read(wcbase) - 13.times{ - data << data - } - open(wcinput, 'w'){|f| f.write data} - end -end - -prepare_wc_input diff --git a/trunk/benchmark/prepare_so_k_nucleotide.rb b/trunk/benchmark/prepare_so_k_nucleotide.rb deleted file mode 100644 index f28f4460a1..0000000000 --- a/trunk/benchmark/prepare_so_k_nucleotide.rb +++ /dev/null @@ -1,2 +0,0 @@ -require File.join(File.dirname(__FILE__), 'make_fasta_output') -prepare_fasta_output(100_000) diff --git a/trunk/benchmark/prepare_so_reverse_complement.rb b/trunk/benchmark/prepare_so_reverse_complement.rb deleted file mode 100644 index 7f089109de..0000000000 --- a/trunk/benchmark/prepare_so_reverse_complement.rb +++ /dev/null @@ -1,2 +0,0 @@ -require File.join(File.dirname(__FILE__), 'make_fasta_output') -prepare_fasta_output(2_500_000) diff --git a/trunk/benchmark/report.rb b/trunk/benchmark/report.rb deleted file mode 100644 index 8305330b45..0000000000 --- a/trunk/benchmark/report.rb +++ /dev/null @@ -1,81 +0,0 @@ -# -# YARV benchmark driver -# - -require 'yarvutil' -require 'benchmark' -require 'rbconfig' - -def exec_command type, file, w - <<-EOP - $DRIVER_PATH = '#{File.dirname($0)}' - $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect} - require 'benchmark' - require 'yarvutil' -# print '#{type}' - begin - puts Benchmark.measure{ - #{w}('#{file}') - }.utime - rescue Exception => exec_command_error_variable - puts "\t" + exec_command_error_variable.message - end - EOP -end - -def benchmark cmd - rubybin = ENV['RUBY'] || File.join( - Config::CONFIG["bindir"], - Config::CONFIG["ruby_install_name"] + Config::CONFIG["EXEEXT"]) - - IO.popen(rubybin, 'r+'){|io| - io.write cmd - io.close_write - return io.gets - } -end - -def ruby_exec file - prog = exec_command 'ruby', file, 'load' - benchmark prog -end - -def yarv_exec file - prog = exec_command 'yarv', file, 'YARVUtil.load_bm' - benchmark prog -end - -$wr = $wy = nil - -def measure bench - file = File.dirname($0) + "/bm_#{bench}.rb" - r = ruby_exec(file).to_f - y = yarv_exec(file).to_f - puts "#{bench}\t#{r}\t#{y}" -end - -def measure2 - r = ruby_exec.to_f - y = yarv_exec.to_f - puts r/y -end - -if $0 == __FILE__ - %w{ - whileloop - whileloop2 - times - const - method - poly_method - block - rescue - rescue2 - }.each{|bench| - measure bench - } -end - - - - diff --git a/trunk/benchmark/run.rb b/trunk/benchmark/run.rb deleted file mode 100644 index 6ef2943642..0000000000 --- a/trunk/benchmark/run.rb +++ /dev/null @@ -1,127 +0,0 @@ -# -# Ruby benchmark driver -# - -require 'benchmark' -require 'rbconfig' - -$matzrubyonly = false -$rubyonly = false - -$results = [] - -# prepare 'wc.input' -def prepare_wc_input - wcinput = File.join(File.dirname($0), 'wc.input') - wcbase = File.join(File.dirname($0), 'wc.input.base') - unless FileTest.exist?(wcinput) - data = File.read(wcbase) - 13.times{ - data << data - } - open(wcinput, 'w'){|f| f.write data} - end -end - -prepare_wc_input - -def bm file - prog = File.readlines(file).map{|e| e.rstrip}.join("\n") - return if prog.empty? - - /[a-z]+_(.+)\.rb/ =~ file - bm_name = $1 - puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly - puts "#{bm_name}: " - - -puts <<EOS unless $matzrubyonly || $rubyonly -#{prog} --- -EOS - begin - result = [bm_name] - result << matzruby_exec(file) unless $rubyonly - result << ruby_exec(file) unless $matzrubyonly - $results << result - - rescue Exception => e - puts - puts "** benchmark failure: #{e}" - puts e.backtrace - end -end - -def benchmark file, bin - m = Benchmark.measure{ - `#{bin} #{$opts} #{file}` - } - sec = '%.3f' % m.real - puts " #{sec}" - sec -end - -def ruby_exec file - print 'ruby' - benchmark file, $ruby_program -end - -def matzruby_exec file - print 'matz' - rubylib = ENV['RUBYLIB'] - ENV['RUBYLIB'] = '' - r = benchmark file, $matzruby_program - ENV['RUBYLIB'] = rubylib - r -end - -if $0 == __FILE__ - ARGV.each{|arg| - case arg - when /\A--ruby=(.+)/ - $ruby_program = $1 - when /\A--matzruby=(.+)/ - $matzruby_program = $1 - when /\A--opts=(.+)/ - $opts = $1 - when /\A(-r|--only-ruby)\z/ - $rubyonly = true - when /\A(-m|--only-matzruby)\z/ - $matzrubyonly = true - end - } - ARGV.delete_if{|arg| - /\A-/ =~ arg - } - - puts "MatzRuby:" - system("#{$matzruby_program} -v") - puts "Ruby:" - system("#{$ruby_program} -v") - puts - - if ARGV.empty? - Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file| - bm file - } - else - ARGV.each{|file| - Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef| - # file = "#{File.dirname(__FILE__)}/#{file}.rb" - bm ef - } - } - end - - puts - puts "-- benchmark summary ---------------------------" - $results.each{|res| - print res.shift, "\t" - (res||[]).each{|result| - /([\d\.]+)/ =~ result - print $1 + "\t" if $1 - } - puts - } -end - diff --git a/trunk/benchmark/runc.rb b/trunk/benchmark/runc.rb deleted file mode 100644 index 14ab171c12..0000000000 --- a/trunk/benchmark/runc.rb +++ /dev/null @@ -1,29 +0,0 @@ -# -# -# - -require 'benchmark' -require 'rbconfig' - -$rubybin = ENV['RUBY'] || File.join( - Config::CONFIG["bindir"], - Config::CONFIG["ruby_install_name"] + Config::CONFIG["EXEEXT"]) - -def runfile file - puts file - file = File.join(File.dirname($0), 'contrib', file) - Benchmark.bm{|x| - x.report('ruby'){ - system("#{$rubybin} #{file}") - } - x.report('yarv'){ - system("#{$rubybin} -rite -I.. #{file}") - } - } -end - -ARGV.each{|file| - runfile file -} - - diff --git a/trunk/benchmark/wc.input.base b/trunk/benchmark/wc.input.base deleted file mode 100644 index 41143fbac0..0000000000 --- a/trunk/benchmark/wc.input.base +++ /dev/null @@ -1,25 +0,0 @@ -Subject: Re: Who was Izchak Miller? -From: "Jane D. Anonymous" <nobody@yale.edu> -Date: 1996/04/28 -Message-Id: <4lv7bc$oh@news.ycc.yale.edu> -References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net> -To: 75176.2330@compuserve.com -Content-Type: text/plain; charset=us-ascii -Organization: Yale University -X-Url: news:4lk6vl$gde@ns.oar.net -Mime-Version: 1.0 -Newsgroups: rec.games.roguelike.nethack -X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) - -Hello there, Izchak Miller was my father. When I was younger I spent -many a night, hunched over the keyboard with a cup of tea, playing -nethack with him and my brother. my dad was a philosopher with a strong -weakness for fantasy/sci fi. I remember when he started to get involved -with the Nethack team- my brother's Dungeons and Dragons monster book -found a regular place beside my dad's desk. it's nice to see him living -on in the game he loved so much :-). - Tamar Miller - -The following is a really long word of 5000 characters: - -wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww |