diff options
author | yugui <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> | 2008-08-25 15:02:05 +0000 |
---|---|---|
committer | yugui <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> | 2008-08-25 15:02:05 +0000 |
commit | 0dc342de848a642ecce8db697b8fecd83a63e117 (patch) | |
tree | 2b7ed4724aff1f86073e4740134bda9c4aac1a39 /trunk/benchmark | |
parent | ef70cf7138ab8034b5b806f466e4b484b24f0f88 (diff) |
added tag v1_9_0_4
git-svn-id: svn+ssh://ci.ruby-lang.org/ruby/tags/v1_9_0_4@18845 b2dd03c8-39d4-4d8f-98ff-823fe69b080e
Diffstat (limited to 'trunk/benchmark')
101 files changed, 3190 insertions, 0 deletions
diff --git a/trunk/benchmark/bm_app_answer.rb b/trunk/benchmark/bm_app_answer.rb new file mode 100644 index 0000000000..3cd8a8fd37 --- /dev/null +++ b/trunk/benchmark/bm_app_answer.rb @@ -0,0 +1,15 @@ +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +def the_answer_to_life_the_universe_and_everything + (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i +end + +answer = the_answer_to_life_the_universe_and_everything diff --git a/trunk/benchmark/bm_app_erb.rb b/trunk/benchmark/bm_app_erb.rb new file mode 100644 index 0000000000..e58b7a34a1 --- /dev/null +++ b/trunk/benchmark/bm_app_erb.rb @@ -0,0 +1,26 @@ +# +# Create many HTML strings with ERB. +# + +require 'erb' + +data = DATA.read +max = 5_000 +title = "hello world!" +content = "hello world!\n" * 10 + +max.times{ + ERB.new(data).result(binding) +} + +__END__ + +<html> + <head> <%= title %> </head> + <body> + <h1> <%= title %> </h1> + <p> + <%= content %> + </p> + </body> +</html> diff --git a/trunk/benchmark/bm_app_factorial.rb b/trunk/benchmark/bm_app_factorial.rb new file mode 100644 index 0000000000..a5a5de0426 --- /dev/null +++ b/trunk/benchmark/bm_app_factorial.rb @@ -0,0 +1,11 @@ +def fact(n) + if(n > 1) + n * fact(n-1) + else + 1 + end +end + +8.times{ + fact(5000) +}
\ No newline at end of file diff --git a/trunk/benchmark/bm_app_fib.rb b/trunk/benchmark/bm_app_fib.rb new file mode 100644 index 0000000000..34a7b2e725 --- /dev/null +++ b/trunk/benchmark/bm_app_fib.rb @@ -0,0 +1,10 @@ +def fib n + if n < 3 + 1 + else + fib(n-1) + fib(n-2) + end +end + +fib(34) + diff --git a/trunk/benchmark/bm_app_mandelbrot.rb b/trunk/benchmark/bm_app_mandelbrot.rb new file mode 100644 index 0000000000..a0dcf5e874 --- /dev/null +++ b/trunk/benchmark/bm_app_mandelbrot.rb @@ -0,0 +1,23 @@ +require 'complex' + +def mandelbrot? z + i = 0 + while i<100 + i+=1 + z = z * z + return false if z.abs > 2 + end + true +end + +ary = [] + +(0..100).each{|dx| + (0..100).each{|dy| + x = dx / 50.0 + y = dy / 50.0 + c = Complex(x, y) + ary << c if mandelbrot?(c) + } +} + diff --git a/trunk/benchmark/bm_app_pentomino.rb b/trunk/benchmark/bm_app_pentomino.rb new file mode 100644 index 0000000000..59c63f358e --- /dev/null +++ b/trunk/benchmark/bm_app_pentomino.rb @@ -0,0 +1,259 @@ +#!/usr/local/bin/ruby +# This program is contributed by Shin Nishiyama + + +# modified by K.Sasada + +NP = 5 +ROW = 8 + NP +COL = 8 + +$p = [] +$b = [] +$no = 0 + +def piece(n, a, nb) + nb.each{|x| + a[n] = x + if n == NP-1 + $p << [a.sort] + else + nbc=nb.dup + [-ROW, -1, 1, ROW].each{|d| + if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) + nbc << x+d + end + } + nbc.delete x + piece(n+1,a[0..n],nbc) + end + } +end + +def kikaku(a) + a.collect {|x| x - a[0]} +end +def ud(a) + kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) +end +def rl(a) + kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) +end +def xy(a) + kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) +end + +def mkpieces + piece(0,[],[0]) + $p.each do |a| + a0 = a[0] + a[1] = ud(a0) + a[2] = rl(a0) + a[3] = ud(rl(a0)) + a[4] = xy(a0) + a[5] = ud(xy(a0)) + a[6] = rl(xy(a0)) + a[7] = ud(rl(xy(a0))) + a.sort! + a.uniq! + end + $p.uniq!.sort! {|x,y| x[0] <=> y[0] } +end + +def mkboard + (0...ROW*COL).each{|i| + if i % ROW >= ROW-NP + $b[i] = -2 + else + $b[i] = -1 + end + $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 + } +end + +def pboard + return # skip print + print "No. #$no\n" + (0...COL).each{|i| + print "|" + (0...ROW-NP).each{|j| + x = $b[i*ROW+j] + if x < 0 + print "..|" + else + printf "%2d|",x+1 + end + } + print "\n" + } + print "\n" +end + +$pnum=[] +def setpiece(a,pos) + if a.length == $p.length then + $no += 1 + pboard + return + end + while $b[pos] != -1 + pos += 1 + end + ($pnum - a).each do |i| + $p[i].each do |x| + f = 0 + x.each{|s| + if $b[pos+s] != -1 + f=1 + break + end + } + if f == 0 then + x.each{|s| + $b[pos+s] = i + } + a << i + setpiece(a.dup, pos) + a.pop + x.each{|s| + $b[pos+s] = -1 + } + end + end + end +end + +mkpieces +mkboard +$p[4] = [$p[4][0]] +$pnum = (0...$p.length).to_a +setpiece([],0) + + +__END__ + +# original + +NP = 5 +ROW = 8 + NP +COL = 8 + +$p = [] +$b = [] +$no = 0 + +def piece(n,a,nb) + for x in nb + a[n] = x + if n == NP-1 + $p << [a.sort] + else + nbc=nb.dup + for d in [-ROW, -1, 1, ROW] + if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d) + nbc << x+d + end + end + nbc.delete x + piece(n+1,a[0..n],nbc) + end + end +end + +def kikaku(a) + a.collect {|x| x - a[0]} +end +def ud(a) + kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort) +end +def rl(a) + kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort) +end +def xy(a) + kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort) +end + +def mkpieces + piece(0,[],[0]) + $p.each do |a| + a0 = a[0] + a[1] = ud(a0) + a[2] = rl(a0) + a[3] = ud(rl(a0)) + a[4] = xy(a0) + a[5] = ud(xy(a0)) + a[6] = rl(xy(a0)) + a[7] = ud(rl(xy(a0))) + a.sort! + a.uniq! + end + $p.uniq!.sort! {|x,y| x[0] <=> y[0] } +end + +def mkboard + for i in 0...ROW*COL + if i % ROW >= ROW-NP + $b[i] = -2 + else + $b[i] = -1 + end + $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2 + end +end + +def pboard + print "No. #$no\n" + for i in 0...COL + print "|" + for j in 0...ROW-NP + x = $b[i*ROW+j] + if x < 0 + print "..|" + else + printf "%2d|",x+1 + end + end + print "\n" + end + print "\n" +end + +$pnum=[] +def setpiece(a,pos) + if a.length == $p.length then + $no += 1 + pboard + return + end + while $b[pos] != -1 + pos += 1 + end + ($pnum - a).each do |i| + $p[i].each do |x| + f = 0 + for s in x do + if $b[pos+s] != -1 + f=1 + break + end + end + if f == 0 then + for s in x do + $b[pos+s] = i + end + a << i + setpiece(a.dup, pos) + a.pop + for s in x do + $b[pos+s] = -1 + end + end + end + end +end + +mkpieces +mkboard +$p[4] = [$p[4][0]] +$pnum = (0...$p.length).to_a +setpiece([],0) diff --git a/trunk/benchmark/bm_app_raise.rb b/trunk/benchmark/bm_app_raise.rb new file mode 100644 index 0000000000..01d2ae3219 --- /dev/null +++ b/trunk/benchmark/bm_app_raise.rb @@ -0,0 +1,8 @@ +i=0 +while i<300000 + i+=1 + begin + raise + rescue + end +end diff --git a/trunk/benchmark/bm_app_strconcat.rb b/trunk/benchmark/bm_app_strconcat.rb new file mode 100644 index 0000000000..c6ef817263 --- /dev/null +++ b/trunk/benchmark/bm_app_strconcat.rb @@ -0,0 +1,5 @@ +i=0 +while i<500000 + "#{1+1} #{1+1} #{1+1}" + i+=1 +end diff --git a/trunk/benchmark/bm_app_tak.rb b/trunk/benchmark/bm_app_tak.rb new file mode 100644 index 0000000000..efe5380f4e --- /dev/null +++ b/trunk/benchmark/bm_app_tak.rb @@ -0,0 +1,13 @@ + +def tak x, y, z + unless y < x + z + else + tak( tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) + end +end + +tak(18, 9, 0) + diff --git a/trunk/benchmark/bm_app_tarai.rb b/trunk/benchmark/bm_app_tarai.rb new file mode 100644 index 0000000000..4c146f5ccf --- /dev/null +++ b/trunk/benchmark/bm_app_tarai.rb @@ -0,0 +1,10 @@ +def tarai( x, y, z ) + if x <= y + then y + else tarai(tarai(x-1, y, z), + tarai(y-1, z, x), + tarai(z-1, x, y)) + end +end + +tarai(12, 6, 0) diff --git a/trunk/benchmark/bm_app_uri.rb b/trunk/benchmark/bm_app_uri.rb new file mode 100644 index 0000000000..586edfd5dc --- /dev/null +++ b/trunk/benchmark/bm_app_uri.rb @@ -0,0 +1,8 @@ +require 'uri' + +100_000.times{ + uri = URI.parse('http://www.ruby-lang.org') + uri.scheme + uri.host + uri.port +} diff --git a/trunk/benchmark/bm_io_file_create.rb b/trunk/benchmark/bm_io_file_create.rb new file mode 100644 index 0000000000..7adbe9ea5e --- /dev/null +++ b/trunk/benchmark/bm_io_file_create.rb @@ -0,0 +1,13 @@ +# +# Create files +# + +max = 50_000 +file = './tmpfile_of_bm_io_file_create' + +max.times{ + f = open(file, 'w') + f.close#(true) +} +File.unlink(file) + diff --git a/trunk/benchmark/bm_io_file_read.rb b/trunk/benchmark/bm_io_file_read.rb new file mode 100644 index 0000000000..2b4212db76 --- /dev/null +++ b/trunk/benchmark/bm_io_file_read.rb @@ -0,0 +1,15 @@ +# +# Seek and Read file. +# + +require 'tempfile' + +max = 20_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') +f.write str + +max.times{ + f.seek 0 + f.read +} diff --git a/trunk/benchmark/bm_io_file_write.rb b/trunk/benchmark/bm_io_file_write.rb new file mode 100644 index 0000000000..3cec58c6ae --- /dev/null +++ b/trunk/benchmark/bm_io_file_write.rb @@ -0,0 +1,14 @@ +# +# Seek and Write file. +# + +require 'tempfile' + +max = 20_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') + +max.times{ + f.seek 0 + f.write str +} diff --git a/trunk/benchmark/bm_loop_generator.rb b/trunk/benchmark/bm_loop_generator.rb new file mode 100644 index 0000000000..d3375c744c --- /dev/null +++ b/trunk/benchmark/bm_loop_generator.rb @@ -0,0 +1,14 @@ +max = 600000 + +if defined? Fiber + gen = (1..max).each + loop do + gen.next + end +else + require 'generator' + gen = Generator.new((0..max)) + while gen.next? + gen.next + end +end diff --git a/trunk/benchmark/bm_loop_times.rb b/trunk/benchmark/bm_loop_times.rb new file mode 100644 index 0000000000..c5317b8228 --- /dev/null +++ b/trunk/benchmark/bm_loop_times.rb @@ -0,0 +1 @@ +30000000.times{|e|} diff --git a/trunk/benchmark/bm_loop_whileloop.rb b/trunk/benchmark/bm_loop_whileloop.rb new file mode 100644 index 0000000000..43d35e1131 --- /dev/null +++ b/trunk/benchmark/bm_loop_whileloop.rb @@ -0,0 +1,4 @@ +i=0 +while i<30_000_000 # benchmark loop 1 + i+=1 +end diff --git a/trunk/benchmark/bm_loop_whileloop2.rb b/trunk/benchmark/bm_loop_whileloop2.rb new file mode 100644 index 0000000000..e514989661 --- /dev/null +++ b/trunk/benchmark/bm_loop_whileloop2.rb @@ -0,0 +1,4 @@ +i=0 +while i< 6_000_000 # benchmark loop 2 + i+=1 +end diff --git a/trunk/benchmark/bm_so_ackermann.rb b/trunk/benchmark/bm_so_ackermann.rb new file mode 100644 index 0000000000..7db5be9050 --- /dev/null +++ b/trunk/benchmark/bm_so_ackermann.rb @@ -0,0 +1,19 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +NUM = 9 +ack(3, NUM) + + diff --git a/trunk/benchmark/bm_so_array.rb b/trunk/benchmark/bm_so_array.rb new file mode 100644 index 0000000000..2b8fce8f99 --- /dev/null +++ b/trunk/benchmark/bm_so_array.rb @@ -0,0 +1,23 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Paul Brannan and Mark Hubbart + +n = 9000 # Integer(ARGV.shift || 1) + +x = Array.new(n) +y = Array.new(n, 0) + +n.times{|bi| + x[bi] = bi + 1 +} + +(0 .. 999).each do |e| + (n-1).step(0,-1) do |bi| + y[bi] += x.at(bi) + end +end +# puts "#{y.first} #{y.last}" + + diff --git a/trunk/benchmark/bm_so_binary_trees.rb b/trunk/benchmark/bm_so_binary_trees.rb new file mode 100644 index 0000000000..6a26465578 --- /dev/null +++ b/trunk/benchmark/bm_so_binary_trees.rb @@ -0,0 +1,57 @@ +# The Computer Language Shootout Benchmarks +# http://shootout.alioth.debian.org +# +# contributed by Jesse Millikan + +# disable output +def STDOUT.write_ *args +end + +def item_check(tree) + if tree[0] == nil + tree[1] + else + tree[1] + item_check(tree[0]) - item_check(tree[2]) + end +end + +def bottom_up_tree(item, depth) + if depth > 0 + item_item = 2 * item + depth -= 1 + [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)] + else + [nil, item, nil] + end +end + +max_depth = 12 # 16 # ARGV[0].to_i +min_depth = 4 + +max_depth = min_depth + 2 if min_depth + 2 > max_depth + +stretch_depth = max_depth + 1 +stretch_tree = bottom_up_tree(0, stretch_depth) + +puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}" +stretch_tree = nil + +long_lived_tree = bottom_up_tree(0, max_depth) + +min_depth.step(max_depth + 1, 2) do |depth| + iterations = 2**(max_depth - depth + min_depth) + + check = 0 + + for i in 1..iterations + temp_tree = bottom_up_tree(i, depth) + check += item_check(temp_tree) + + temp_tree = bottom_up_tree(-i, depth) + check += item_check(temp_tree) + end + + puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}" +end + +puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}" diff --git a/trunk/benchmark/bm_so_concatenate.rb b/trunk/benchmark/bm_so_concatenate.rb new file mode 100644 index 0000000000..82629688b7 --- /dev/null +++ b/trunk/benchmark/bm_so_concatenate.rb @@ -0,0 +1,18 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# based on code from Aristarkh A Zagorodnikov and Dat Nguyen + +STUFF = "hello\n" +i=0 +while i<10 + i+=1 + hello = '' + 400000.times do |e| + hello << STUFF + end +end +# puts hello.length + + diff --git a/trunk/benchmark/bm_so_count_words.rb b/trunk/benchmark/bm_so_count_words.rb new file mode 100644 index 0000000000..65f6337a4a --- /dev/null +++ b/trunk/benchmark/bm_so_count_words.rb @@ -0,0 +1,19 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Paul Brannan + +input = open(File.join(File.dirname($0), 'wc.input'), 'rb') + +nl = nw = nc = 0 +while true + tmp = input.read(4096) or break + data = tmp << (input.gets || "") + nc += data.length + nl += data.count("\n") + ((data.strip! || data).tr!("\n", " ") || data).squeeze! + nw += data.count(" ") + 1 +end +# STDERR.puts "#{nl} #{nw} #{nc}" + diff --git a/trunk/benchmark/bm_so_exception.rb b/trunk/benchmark/bm_so_exception.rb new file mode 100644 index 0000000000..d8b461290c --- /dev/null +++ b/trunk/benchmark/bm_so_exception.rb @@ -0,0 +1,61 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +$HI = 0 +$LO = 0 +NUM = 250000 # Integer(ARGV[0] || 1) + + +class Lo_Exception < Exception + def initialize(num) + @value = num + end +end + +class Hi_Exception < Exception + def initialize(num) + @value = num + end +end + +def some_function(num) + begin + hi_function(num) + rescue + print "We shouldn't get here, exception is: #{$!.type}\n" + end +end + +def hi_function(num) + begin + lo_function(num) + rescue Hi_Exception + $HI = $HI + 1 + end +end + +def lo_function(num) + begin + blowup(num) + rescue Lo_Exception + $LO = $LO + 1 + end +end + +def blowup(num) + if num % 2 == 0 + raise Lo_Exception.new(num) + else + raise Hi_Exception.new(num) + end +end + + +i = 1 +max = NUM+1 +while i < max + i+=1 + some_function(i+1) +end diff --git a/trunk/benchmark/bm_so_fannkuch.rb b/trunk/benchmark/bm_so_fannkuch.rb new file mode 100644 index 0000000000..a214f2e205 --- /dev/null +++ b/trunk/benchmark/bm_so_fannkuch.rb @@ -0,0 +1,45 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura +# Modified by Ryan Williams + +def fannkuch(n) + maxFlips, m, r, check = 0, n-1, n, 0 + count = (1..n).to_a + perm = (1..n).to_a + + while true + if check < 30 + puts "#{perm}" + check += 1 + end + + while r != 1 + count[r-1] = r + r -= 1 + end + + if perm[0] != 1 and perm[m] != n + perml = perm.clone #.dup + flips = 0 + while (k = perml.first ) != 1 + perml = perml.slice!(0, k).reverse + perml + flips += 1 + end + maxFlips = flips if flips > maxFlips + end + while true + if r==n then return maxFlips end + perm.insert r,perm.shift + break if (count[r] -= 1) > 0 + r += 1 + end + end +end + +def puts *args +end + +N = 10 # (ARGV[0] || 1).to_i +puts "Pfannkuchen(#{N}) = #{fannkuch(N)}" + diff --git a/trunk/benchmark/bm_so_fasta.rb b/trunk/benchmark/bm_so_fasta.rb new file mode 100644 index 0000000000..3f759ba7ae --- /dev/null +++ b/trunk/benchmark/bm_so_fasta.rb @@ -0,0 +1,81 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +$last = 42.0 +def gen_random (max,im=139968,ia=3877,ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im +end + +alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + +iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], +] +homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], +] + +def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) +end + +def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end +end + + +n = (ARGV[0] or 250_000).to_i + +make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) +make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) +make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + diff --git a/trunk/benchmark/bm_so_k_nucleotide.rb b/trunk/benchmark/bm_so_k_nucleotide.rb new file mode 100644 index 0000000000..dadab3e79c --- /dev/null +++ b/trunk/benchmark/bm_so_k_nucleotide.rb @@ -0,0 +1,48 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# contributed by jose fco. gonzalez +# modified by Sokolov Yura + +seq = String.new + +def frecuency( seq,length ) + n, table = seq.length - length + 1, Hash.new(0) + f, i = nil, nil + (0 ... length).each do |f| + (f ... n).step(length) do |i| + table[seq[i,length]] += 1 + end + end + [n,table] + +end + +def sort_by_freq( seq,length ) + n,table = frecuency( seq,length ) + a, b, v = nil, nil, nil + table.sort{|a,b| b[1] <=> a[1]}.each do |v| + puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] + end + puts +end + +def find_seq( seq,s ) + n,table = frecuency( seq,s.length ) + puts "#{table[s].to_s}\t#{s.upcase}" +end + +input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') + +line = input.gets while line !~ /^>THREE/ +line = input.gets + +while (line !~ /^>/) & line do + seq << line.chomp + line = input.gets +end + +[1,2].each {|i| sort_by_freq( seq,i ) } + +%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } + diff --git a/trunk/benchmark/bm_so_lists.rb b/trunk/benchmark/bm_so_lists.rb new file mode 100644 index 0000000000..3652288881 --- /dev/null +++ b/trunk/benchmark/bm_so_lists.rb @@ -0,0 +1,47 @@ +#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby + +NUM = 100 +SIZE = 10000 + +def test_lists() + # create a list of integers (Li1) from 1 to SIZE + li1 = (1..SIZE).to_a + # copy the list to li2 (not by individual items) + li2 = li1.dup + # remove each individual item from left side of li2 and + # append to right side of li3 (preserving order) + li3 = Array.new + while (not li2.empty?) + li3.push(li2.shift) + end + # li2 must now be empty + # remove each individual item from right side of li3 and + # append to right side of li2 (reversing list) + while (not li3.empty?) + li2.push(li3.pop) + end + # li3 must now be empty + # reverse li1 in place + li1.reverse! + # check that first item is now SIZE + if li1[0] != SIZE then + p "not SIZE" + 0 + else + # compare li1 and li2 for equality + if li1 != li2 then + return(0) + else + # return the length of the list + li1.length + end + end +end + +i = 0 +while i<NUM + i+=1 + result = test_lists() +end + +result diff --git a/trunk/benchmark/bm_so_mandelbrot.rb b/trunk/benchmark/bm_so_mandelbrot.rb new file mode 100644 index 0000000000..76331c64b8 --- /dev/null +++ b/trunk/benchmark/bm_so_mandelbrot.rb @@ -0,0 +1,57 @@ +# The Computer Language Benchmarks Game +# http://shootout.alioth.debian.org/ +# +# contributed by Karl von Laudermann +# modified by Jeremy Echols + +size = 600 # ARGV[0].to_i + +puts "P4\n#{size} #{size}" + +ITER = 49 # Iterations - 1 for easy for..in looping +LIMIT_SQUARED = 4.0 # Presquared limit + +byte_acc = 0 +bit_num = 0 + +count_size = size - 1 # Precomputed size for easy for..in looping + +# For..in loops are faster than .upto, .downto, .times, etc. +for y in 0..count_size + for x in 0..count_size + zr = 0.0 + zi = 0.0 + cr = (2.0*x/size)-1.5 + ci = (2.0*y/size)-1.0 + escape = false + + # To make use of the for..in code, we use a dummy variable, + # like one would in C + for dummy in 0..ITER + tr = zr*zr - zi*zi + cr + ti = 2*zr*zi + ci + zr, zi = tr, ti + + if (zr*zr+zi*zi) > LIMIT_SQUARED + escape = true + break + end + end + + byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1) + bit_num += 1 + + # Code is very similar for these cases, but using separate blocks + # ensures we skip the shifting when it's unnecessary, which is most cases. + if (bit_num == 8) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + elsif (x == count_size) + byte_acc <<= (8 - bit_num) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + end + end +end diff --git a/trunk/benchmark/bm_so_matrix.rb b/trunk/benchmark/bm_so_matrix.rb new file mode 100644 index 0000000000..0f274ad06c --- /dev/null +++ b/trunk/benchmark/bm_so_matrix.rb @@ -0,0 +1,48 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ + +n = 60 #Integer(ARGV.shift || 1) + +size = 30 + +def mkmatrix(rows, cols) + count = 1 + mx = Array.new(rows) + (0 .. (rows - 1)).each do |bi| + row = Array.new(cols, 0) + (0 .. (cols - 1)).each do |j| + row[j] = count + count += 1 + end + mx[bi] = row + end + mx +end + +def mmult(rows, cols, m1, m2) + m3 = Array.new(rows) + (0 .. (rows - 1)).each do |bi| + row = Array.new(cols, 0) + (0 .. (cols - 1)).each do |j| + val = 0 + (0 .. (cols - 1)).each do |k| + val += m1.at(bi).at(k) * m2.at(k).at(j) + end + row[j] = val + end + m3[bi] = row + end + m3 +end + +m1 = mkmatrix(size, size) +m2 = mkmatrix(size, size) +mm = Array.new +n.times do + mm = mmult(size, size, m1, m2) +end +# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}" + + diff --git a/trunk/benchmark/bm_so_meteor_contest.rb b/trunk/benchmark/bm_so_meteor_contest.rb new file mode 100644 index 0000000000..99cf6a91cc --- /dev/null +++ b/trunk/benchmark/bm_so_meteor_contest.rb @@ -0,0 +1,564 @@ +#!/usr/bin/env ruby +# +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# contributed by Kevin Barnes (Ruby novice) + +# PROGRAM: the main body is at the bottom. +# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# 2) see how I represent a board as a bitmask by reading the blank_board comments +# 3) read as your mental paths take you + +def print *args +end + +# class to represent all information about a particular rotation of a particular piece +class Rotation + # an array (by location) containing a bit mask for how the piece maps at the given location. + # if the rotation is invalid at that location the mask will contain false + attr_reader :start_masks + + # maps a direction to a relative location. these differ depending on whether it is an even or + # odd row being mapped from + @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 } + @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 } + + def initialize( directions ) + @even_offsets, @odd_offsets = normalize_offsets( get_values( directions )) + + @even_mask = mask_for_offsets( @even_offsets) + @odd_mask = mask_for_offsets( @odd_offsets) + + @start_masks = Array.new(60) + + # create the rotational masks by placing the base mask at the location and seeing if + # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these + # is true the piece cannot be placed + 0.upto(59) do | offset | + mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset) + if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then + imask = compute_required( mask, offset) + @start_masks[offset] = [ mask, imask, imask | mask ] + else + @start_masks[offset] = false + end + end + end + + def compute_required( mask, offset ) + board = blank_board + 0.upto(offset) { | i | board |= 1 << i } + board |= mask + return 0 if (!prunable(board | mask, offset)) + board = flood_fill(board,58) + count = 0 + imask = 0 + 0.upto(59) do | i | + if (board[i] == 0) then + imask |= (1 << i) + count += 1 + end + end + (count > 0 && count < 5) ? imask : 0 + end + + def flood_fill( board, location) + return board if (board[location] == 1) + board |= 1 << location + row, col = location.divmod(6) + board = flood_fill( board, location - 1) if (col > 0) + board = flood_fill( board, location + 1) if (col < 4) + if (row % 2 == 0) then + board = flood_fill( board, location - 7) if (col > 0 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 5) if (col > 0 && row < 9) + else + board = flood_fill( board, location - 5) if (col < 4 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 7) if (col < 4 && row < 9) + end + board + end + + # given a location, produces a list of relative locations covered by the piece at this rotation + def offsets( location) + if is_even( location) then + @even_offsets.collect { | value | value + location } + else + @odd_offsets.collect { | value | value + location } + end + end + + # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows) + # this is hard to explain. imagine we have this partial board: + # 0 0 0 0 0 x [positions 0-5] + # 0 0 1 1 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 1 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # The top-left of the piece is at position 8, the + # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that + # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained + # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row: + # 0 0 0 1 1 x [positions 0-5] + # 0 0 1 0 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 0 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the + # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what + # this function would return + def normalize_offsets( values) + min = values.min + even_min = is_even(min) + other_min = even_min ? min + 6 : min + 7 + other_values = values.collect do | value | + if is_even(value) then + value + 6 - other_min + else + value + 7 - other_min + end + end + values.collect! { | value | value - min } + + if even_min then + [values, other_values] + else + [other_values, values] + end + end + + # produce a bitmask representation of an array of offset locations + def mask_for_offsets( offsets ) + mask = 0 + offsets.each { | value | mask = mask + ( 1 << value ) } + mask + end + + # finds a "safe" position that a position as described by a list of directions can be placed + # without falling off any edge of the board. the values returned a location to place the first piece + # at so it will fit after making the described moves + def start_adjust( directions ) + south = east = 0; + directions.each do | direction | + east += 1 if ( direction == :sw || direction == :nw || direction == :west ) + south += 1 if ( direction == :nw || direction == :ne ) + end + south * 6 + east + end + + # given a set of directions places the piece (as defined by a set of directions) on the board at + # a location that will not take it off the edge + def get_values ( directions ) + start = start_adjust(directions) + values = [ start ] + directions.each do | direction | + if (start % 12 >= 6) then + start += @@rotation_odd_adder[direction] + else + start += @@rotation_even_adder[direction] + end + values += [ start ] + end + + # some moves take you back to an existing location, we'll strip duplicates + values.uniq + end +end + +# describes a piece and caches information about its rotations to as to be efficient for iteration +# ATTRIBUTES: +# rotations -- all the rotations of the piece +# type -- a numeic "name" of the piece +# masks -- an array by location of all legal rotational masks (a n inner array) for that location +# placed -- the mask that this piece was last placed at (not a location, but the actual mask used) +class Piece + attr_reader :rotations, :type, :masks + attr_accessor :placed + + # transform hashes that change one direction into another when you either flip or rotate a set of directions + @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne } + @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw } + + def initialize( directions, type ) + @type = type + @rotations = Array.new(); + @map = {} + + generate_rotations( directions ) + directions.collect! { | value | @@flip_converter[value] } + generate_rotations( directions ) + + # creates the masks AND a map that returns [location, rotation] for any given mask + # this is used when a board is found and we want to draw it, otherwise the map is unused + @masks = Array.new(); + 0.upto(59) do | i | + even = true + @masks[i] = @rotations.collect do | rotation | + mask = rotation.start_masks[i] + @map[mask[0]] = [ i, rotation ] if (mask) + mask || nil + end + @masks[i].compact! + end + end + + # rotates a set of directions through all six angles and adds a Rotation to the list for each one + def generate_rotations( directions ) + 6.times do + rotations.push( Rotation.new(directions)) + directions.collect! { | value | @@rotate_converter[value] } + end + end + + # given a board string, adds this piece to the board at whatever location/rotation + # important: the outbound board string is 5 wide, the normal location notation is six wide (padded) + def fill_string( board_string) + location, rotation = @map[@placed] + rotation.offsets(location).each do | offset | + row, col = offset.divmod(6) + board_string[ row*5 + col, 1 ] = @type.to_s + end + end +end + +# a blank bit board having this form: +# +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 1 1 1 1 1 1 +# +# where left lest significant bit is the top left and the most significant is the lower right +# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running +# off the edges or bottom +def blank_board + 0b111111100000100000100000100000100000100000100000100000100000100000 +end + +def full_board + 0b111111111111111111111111111111111111111111111111111111111111111111 +end + +# determines if a location (bit position) is in an even row +def is_even( location) + (location % 12) < 6 +end + +# support function that create three utility maps: +# $converter -- for each row an array that maps a five bit row (via array mapping) +# to the a a five bit representation of the bits below it +# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row +# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays +# a region array has three values the first is a mask of bits in the region, +# the second is the count of those bits and the third is identical to the first +# examples: +# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001] +# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001] +# 0b10001 => [ 0b01110, 3, 0b01110 ] +def create_collector_support + odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000] + even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000] + + all_odds = Array.new(0b100000) + all_evens = Array.new(0b100000) + bit_counts = Array.new(0b100000) + new_regions = Array.new(0b100000) + 0.upto(0b11111) do | i | + bit_count = odd = even = 0 + 0.upto(4) do | bit | + if (i[bit] == 1) then + bit_count += 1 + odd |= odd_map[bit] + even |= even_map[bit] + end + end + all_odds[i] = odd + all_evens[i] = even + bit_counts[i] = bit_count + new_regions[i] = create_regions( i) + end + + $converter = [] + 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) } + $bit_counts = bit_counts + $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } } +end + +# determines if a board is punable, meaning that there is no possibility that it +# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces +# that are not a multiple of five. The following board is an example of a prunable board: +# 0 0 1 0 0 +# 0 1 0 0 0 +# 1 1 0 0 0 +# 0 1 0 0 0 +# 0 0 0 0 0 +# ... +# +# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it +# parameters: +# board -- an initial bit board (6 bit padded rows, see blank_board for format) +# location -- starting location, everything above and to the left is already full +# slotting -- set to true only when testing initial pieces, when filling normally +# additional assumptions are possible +# +# Algorithm: +# The algorithm starts at the top row (as determined by location) and iterates a row at a time +# maintainng counts of active open areas (kept in the collector array) each collector contains +# three values at the start of an iteration: +# 0: mask of bits that would be adjacent to the collector in this row +# 1: the number of bits collected so far +# 2: a scratch space starting as zero, but used during the computation to represent +# the empty bits in the new row that are adjacent (position 0) +# The exact procedure is described in-code +def prunable( board, location, slotting = false) + collectors = [] + # loop accross the rows + (location / 6).to_i.upto(9) do | row_on | + # obtain a set of regions representing the bits of the curent row. + regions = $regions[(board >> (row_on * 6)) & 0b11111] + converter = $converter[row_on] + + # track the number of collectors at the start of the cycle so that + # we don't compute against newly created collectors, only existing collectors + initial_collector_count = collectors.length + + # loop against the regions. For each region of the row + # we will see if it connects to one or more existing collectors. + # if it connects to 1 collector, the bits from the region are added to the + # bits of the collector and the mask is placed in collector[2] + # If the region overlaps more than one collector then all the collectors + # it overlaps with are merged into the first one (the others are set to nil in the array) + # if NO collectors are found then the region is copied as a new collector + regions.each do | region | + collector_found = nil + region_mask = region[2] + initial_collector_count.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + collector_mask = collector[0] + if (collector_mask & region_mask != 0) then + if (collector_found) then + collector_found[0] |= collector_mask + collector_found[1] += collector[1] + collector_found[2] |= collector[2] + collectors[collector_num] = nil + else + collector_found = collector + collector[1] += region[1] + collector[2] |= region_mask + end + end + end + end + if (collector_found == nil) then + collectors.push(Array.new(region)) + end + end + + # check the existing collectors, if any collector overlapped no bits in the region its [2] value will + # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since + # the board is prunable. if it is a multiple of five it is removed. + # Collector that are still active have a new adjacent value [0] set based n the matched bits + # and have [2] cleared out for the next cycle. + collectors.length.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + if (collector[2] == 0) then + return true if (collector[1] % 5 != 0) + collectors[collector_num] = nil + else + # if a collector matches all bits in the row then we can return unprunable early for the + # follwing reasons: + # 1) there can be no more unavailable bits bince we fill from the top left downward + # 2) all previous regions have been closed or joined so only this region can fail + # 3) this region must be good since there can never be only 1 region that is nuot + # a multiple of five + # this rule only applies when filling normally, so we ignore the rule if we are "slotting" + # in pieces to see what configurations work for them (the only other time this algorithm is used). + return false if (collector[2] == 0b11111 && !slotting) + collector[0] = converter[collector[2]] + collector[2] = 0 + end + end + end + + # get rid of all the empty converters for the next round + collectors.compact! + end + return false if (collectors.length <= 1) # 1 collector or less and the region is fine + collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size +end + +# creates a region given a row mask. see prunable for what a "region" is +def create_regions( value ) + regions = [] + cur_region = 0 + 5.times do | bit | + if (value[bit] == 0) then + cur_region |= 1 << bit + else + if (cur_region != 0 ) then + regions.push( cur_region) + cur_region = 0; + end + end + end + regions.push(cur_region) if (cur_region != 0) + regions +end + +# find up to the counted number of solutions (or all solutions) and prints the final result +def find_all + find_top( 1) + find_top( 0) + print_results +end + +# show the board +def print_results + print "#{@boards_found} solutions found\n\n" + print_full_board( @min_board) + print "\n" + print_full_board( @max_board) + print "\n" +end + +# finds solutions. This special version of the main function is only used for the top level +# the reason for it is basically to force a particular ordering on how the rotations are tested for +# the first piece. It is called twice, first looking for placements of the odd rotations and then +# looking for placements of the even locations. +# +# WHY? +# Since any found solution has an inverse we want to maximize finding solutions that are not already found +# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away +# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier +# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will +# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces +# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the +# maximum number +def find_top( rotation_skip) + board = blank_board + (@pieces.length-1).times do + piece = @pieces.shift + piece.masks[0].each do | mask, imask, cmask | + if ((rotation_skip += 1) % 2 == 0) then + piece.placed = mask + find( 1, 1, board | mask) + end + end + @pieces.push(piece) + end + piece = @pieces.shift + @pieces.push(piece) +end + +# the normail find routine, iterates through the available pieces, checks all rotations at the current location +# and adds any boards found. depth is acheived via recursion. the overall approach is described +# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# parameters: +# start_location -- where to start looking for place for the next piece at +# placed -- number of pieces placed +# board -- current state of the board +# +# see in-code comments +def find( start_location, placed, board) + # find the next location to place a piece by looking for an empty bit + while board[start_location] == 1 + start_location += 1 + end + + @pieces.length.times do + piece = @pieces.shift + piece.masks[start_location].each do | mask, imask, cmask | + if ( board & cmask == imask) then + piece.placed = mask + if (placed == 9) then + add_board + else + find( start_location + 1, placed + 1, board | mask) + end + end + end + @pieces.push(piece) + end +end + +# print the board +def print_full_board( board_string) + 10.times do | row | + print " " if (row % 2 == 1) + 5.times do | col | + print "#{board_string[row*5 + col,1]} " + end + print "\n" + end +end + +# when a board is found we "draw it" into a string and then flip that string, adding both to +# the list (hash) of solutions if they are unique. +def add_board + board_string = "99999999999999999999999999999999999999999999999999" + @all_pieces.each { | piece | piece.fill_string( board_string ) } + save( board_string) + save( board_string.reverse) +end + +# adds a board string to the list (if new) and updates the current best/worst board +def save( board_string) + if (@all_boards[board_string] == nil) then + @min_board = board_string if (board_string < @min_board) + @max_board = board_string if (board_string > @max_board) + @all_boards.store(board_string,true) + @boards_found += 1 + + # the exit motif is a time saver. Ideally the function should return, but those tests + # take noticable time (performance). + if (@boards_found == @stop_count) then + print_results + exit(0) + end + end +end + + +## +## MAIN BODY :) +## +create_collector_support +@pieces = [ + Piece.new( [ :nw, :ne, :east, :east ], 2), + Piece.new( [ :ne, :se, :east, :ne ], 7), + Piece.new( [ :ne, :east, :ne, :nw ], 1), + Piece.new( [ :east, :sw, :sw, :se ], 6), + Piece.new( [ :east, :ne, :se, :ne ], 5), + Piece.new( [ :east, :east, :east, :se ], 0), + Piece.new( [ :ne, :nw, :se, :east, :se ], 4), + Piece.new( [ :se, :se, :se, :west ], 9), + Piece.new( [ :se, :se, :east, :se ], 8), + Piece.new( [ :east, :east, :sw, :se ], 3) + ]; + +@all_pieces = Array.new( @pieces) + +@min_board = "99999999999999999999999999999999999999999999999999" +@max_board = "00000000000000000000000000000000000000000000000000" +@stop_count = ARGV[0].to_i || 2089 +@all_boards = {} +@boards_found = 0 + +find_all ######## DO IT!!! + diff --git a/trunk/benchmark/bm_so_nbody.rb b/trunk/benchmark/bm_so_nbody.rb new file mode 100644 index 0000000000..d6c5bb9e61 --- /dev/null +++ b/trunk/benchmark/bm_so_nbody.rb @@ -0,0 +1,148 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# Optimized for Ruby by Jesse Millikan +# From version ported by Michael Neumann from the C gcc version, +# which was written by Christoph Bauer. + +SOLAR_MASS = 4 * Math::PI**2 +DAYS_PER_YEAR = 365.24 + +def _puts *args +end + +class Planet + attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass + + def initialize(x, y, z, vx, vy, vz, mass) + @x, @y, @z = x, y, z + @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR + @mass = mass * SOLAR_MASS + end + + def move_from_i(bodies, nbodies, dt, i) + while i < nbodies + b2 = bodies[i] + dx = @x - b2.x + dy = @y - b2.y + dz = @z - b2.z + + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + mag = dt / (distance * distance * distance) + b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag + + @vx -= dx * b2_mass_mag + @vy -= dy * b2_mass_mag + @vz -= dz * b2_mass_mag + b2.vx += dx * b_mass_mag + b2.vy += dy * b_mass_mag + b2.vz += dz * b_mass_mag + i += 1 + end + + @x += dt * @vx + @y += dt * @vy + @z += dt * @vz + end +end + +def energy(bodies) + e = 0.0 + nbodies = bodies.size + + for i in 0 ... nbodies + b = bodies[i] + e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz) + for j in (i + 1) ... nbodies + b2 = bodies[j] + dx = b.x - b2.x + dy = b.y - b2.y + dz = b.z - b2.z + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + e -= (b.mass * b2.mass) / distance + end + end + e +end + +def offset_momentum(bodies) + px, py, pz = 0.0, 0.0, 0.0 + + for b in bodies + m = b.mass + px += b.vx * m + py += b.vy * m + pz += b.vz * m + end + + b = bodies[0] + b.vx = - px / SOLAR_MASS + b.vy = - py / SOLAR_MASS + b.vz = - pz / SOLAR_MASS +end + +BODIES = [ + # sun + Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0), + + # jupiter + Planet.new( + 4.84143144246472090e+00, + -1.16032004402742839e+00, + -1.03622044471123109e-01, + 1.66007664274403694e-03, + 7.69901118419740425e-03, + -6.90460016972063023e-05, + 9.54791938424326609e-04), + + # saturn + Planet.new( + 8.34336671824457987e+00, + 4.12479856412430479e+00, + -4.03523417114321381e-01, + -2.76742510726862411e-03, + 4.99852801234917238e-03, + 2.30417297573763929e-05, + 2.85885980666130812e-04), + + # uranus + Planet.new( + 1.28943695621391310e+01, + -1.51111514016986312e+01, + -2.23307578892655734e-01, + 2.96460137564761618e-03, + 2.37847173959480950e-03, + -2.96589568540237556e-05, + 4.36624404335156298e-05), + + # neptune + Planet.new( + 1.53796971148509165e+01, + -2.59193146099879641e+01, + 1.79258772950371181e-01, + 2.68067772490389322e-03, + 1.62824170038242295e-03, + -9.51592254519715870e-05, + 5.15138902046611451e-05) +] + +init = 200_000 # ARGV[0] +n = Integer(init) + +offset_momentum(BODIES) + +puts "%.9f" % energy(BODIES) + +nbodies = BODIES.size +dt = 0.01 + +n.times do + i = 0 + while i < nbodies + b = BODIES[i] + b.move_from_i(BODIES, nbodies, dt, i + 1) + i += 1 + end +end + +puts "%.9f" % energy(BODIES) diff --git a/trunk/benchmark/bm_so_nested_loop.rb b/trunk/benchmark/bm_so_nested_loop.rb new file mode 100644 index 0000000000..a0513f8c47 --- /dev/null +++ b/trunk/benchmark/bm_so_nested_loop.rb @@ -0,0 +1,24 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# from Avi Bryant + +n = 16 # Integer(ARGV.shift || 1) +x = 0 +n.times do + n.times do + n.times do + n.times do + n.times do + n.times do + x += 1 + end + end + end + end + end +end +# puts x + + diff --git a/trunk/benchmark/bm_so_nsieve.rb b/trunk/benchmark/bm_so_nsieve.rb new file mode 100644 index 0000000000..a65cc78233 --- /dev/null +++ b/trunk/benchmark/bm_so_nsieve.rb @@ -0,0 +1,35 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Glenn Parker, March 2005 +# modified by Evan Phoenix, Sept 2006 + +def sieve(m) + flags = Flags.dup[0,m] + count = 0 + pmax = m - 1 + p = 2 + while p <= pmax + unless flags[p].zero? + count += 1 + mult = p + while mult <= pmax + flags[mult] = 0 + mult += p + end + end + p += 1 + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*") + +n.downto(n-2) do |exponent| + break if exponent < 0 + m = (1 << exponent) * 10_000 + # m = (2 ** exponent) * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end diff --git a/trunk/benchmark/bm_so_nsieve_bits.rb b/trunk/benchmark/bm_so_nsieve_bits.rb new file mode 100644 index 0000000000..019b8b6382 --- /dev/null +++ b/trunk/benchmark/bm_so_nsieve_bits.rb @@ -0,0 +1,42 @@ +#!/usr/bin/ruby +# +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# nsieve-bits in Ruby +# Contributed by Glenn Parker, March 2005 + +CharExponent = 3 +BitsPerChar = 1 << CharExponent +LowMask = BitsPerChar - 1 + +def sieve(m) + items = "\xFF" * ((m / BitsPerChar) + 1) + masks = "" + BitsPerChar.times do |b| + masks << (1 << b).chr + end + + count = 0 + pmax = m - 1 + 2.step(pmax, 1) do |p| + if items[p >> CharExponent][p & LowMask] == 1 + count += 1 + p.step(pmax, p) do |mult| + a = mult >> CharExponent + b = mult & LowMask + items[a] -= masks[b] if items[a][b] != 0 + end + end + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +n.step(n - 2, -1) do |exponent| + break if exponent < 0 + m = 2 ** exponent * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end + diff --git a/trunk/benchmark/bm_so_object.rb b/trunk/benchmark/bm_so_object.rb new file mode 100644 index 0000000000..e8607c7199 --- /dev/null +++ b/trunk/benchmark/bm_so_object.rb @@ -0,0 +1,56 @@ +#!/usr/bin/ruby +# -*- mode: ruby -*- +# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $ +# http://www.bagley.org/~doug/shootout/ +# with help from Aristarkh Zagorodnikov + +class Toggle + def initialize(start_state) + @bool = start_state + end + + def value + @bool + end + + def activate + @bool = !@bool + self + end +end + +class NthToggle < Toggle + def initialize(start_state, max_counter) + super start_state + @count_max = max_counter + @counter = 0 + end + + def activate + @counter += 1 + if @counter >= @count_max + @bool = !@bool + @counter = 0 + end + self + end +end + +n = 1500000 # (ARGV.shift || 1).to_i + +toggle = Toggle.new 1 +5.times do + toggle.activate.value ? 'true' : 'false' +end +n.times do + toggle = Toggle.new 1 +end + +ntoggle = NthToggle.new 1, 3 +8.times do + ntoggle.activate.value ? 'true' : 'false' +end +n.times do + ntoggle = NthToggle.new 1, 3 +end + diff --git a/trunk/benchmark/bm_so_partial_sums.rb b/trunk/benchmark/bm_so_partial_sums.rb new file mode 100644 index 0000000000..630b45cb8d --- /dev/null +++ b/trunk/benchmark/bm_so_partial_sums.rb @@ -0,0 +1,31 @@ +n = 2_500_000 # (ARGV.shift || 1).to_i + +alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0 + +1.upto(n) do |d| + d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d) + + s0 += (2.0 / 3.0) ** (d - 1.0) + s1 += 1.0 / Math.sqrt(d) + s2 += 1.0 / (d * (d + 1.0)) + s3 += 1.0 / (d3 * ds * ds) + s4 += 1.0 / (d3 * dc * dc) + s5 += 1.0 / d + s6 += 1.0 / d2 + s7 += alt / d + s8 += alt / (2.0 * d - 1.0) + + alt = -alt +end + +if false + printf("%.9f\t(2/3)^k\n", s0) + printf("%.9f\tk^-0.5\n", s1) + printf("%.9f\t1/k(k+1)\n", s2) + printf("%.9f\tFlint Hills\n", s3) + printf("%.9f\tCookson Hills\n", s4) + printf("%.9f\tHarmonic\n", s5) + printf("%.9f\tRiemann Zeta\n", s6) + printf("%.9f\tAlternating Harmonic\n", s7) + printf("%.9f\tGregory\n", s8) +end diff --git a/trunk/benchmark/bm_so_pidigits.rb b/trunk/benchmark/bm_so_pidigits.rb new file mode 100644 index 0000000000..c7d6fbfb4d --- /dev/null +++ b/trunk/benchmark/bm_so_pidigits.rb @@ -0,0 +1,92 @@ +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Gabriele Renzi + +class PiDigitSpigot + + def initialize() + @z = Transformation.new 1,0,0,1 + @x = Transformation.new 0,0,0,0 + @inverse = Transformation.new 0,0,0,0 + end + + def next! + @y = @z.extract(3) + if safe? @y + @z = produce(@y) + @y + else + @z = consume @x.next!() + next!() + end + end + + def safe?(digit) + digit == @z.extract(4) + end + + def produce(i) + @inverse.qrst(10,-10*i,0,1).compose(@z) + end + + def consume(a) + @z.compose(a) + end +end + + +class Transformation + attr_reader :q, :r, :s, :t + def initialize (q, r, s, t) + @q,@r,@s,@t,@k = q,r,s,t,0 + end + + def next!() + @q = @k = @k + 1 + @r = 4 * @k + 2 + @s = 0 + @t = 2 * @k + 1 + self + end + + def extract(j) + (@q * j + @r) / (@s * j + @t) + end + + def compose(a) + self.class.new( @q * a.q, + @q * a.r + r * a.t, + @s * a.q + t * a.s, + @s * a.r + t * a.t + ) + end + + def qrst *args + initialize *args + self + end + + +end + + +WIDTH = 10 +n = 2_500 # Integer(ARGV[0]) +j = 0 + +digits = PiDigitSpigot.new + +while n > 0 + if n >= WIDTH + WIDTH.times {print digits.next!} + j += WIDTH + else + n.times {print digits.next!} + (WIDTH-n).times {print " "} + j += n + end + puts "\t:"+j.to_s + n -= WIDTH +end + diff --git a/trunk/benchmark/bm_so_random.rb b/trunk/benchmark/bm_so_random.rb new file mode 100644 index 0000000000..83c0d6d380 --- /dev/null +++ b/trunk/benchmark/bm_so_random.rb @@ -0,0 +1,20 @@ +# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby + +IM = 139968.0 +IA = 3877.0 +IC = 29573.0 + +$last = 42.0 + +def gen_random(max) + (max * ($last = ($last * IA + IC) % IM)) / IM +end + +N = 1000000 + +i=0 +while i<N + i+=1 + gen_random(100.0) +end +# "%.9f" % gen_random(100.0) diff --git a/trunk/benchmark/bm_so_reverse_complement.rb b/trunk/benchmark/bm_so_reverse_complement.rb new file mode 100644 index 0000000000..82ea666994 --- /dev/null +++ b/trunk/benchmark/bm_so_reverse_complement.rb @@ -0,0 +1,30 @@ +#!/usr/bin/ruby +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# Contributed by Peter Bjarke Olsen +# Modified by Doug King + +seq=Array.new + +def revcomp(seq) + seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN') + stringlen=seq.length + 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"} +end + +input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb') + +while input.gets + if $_ =~ />/ + if seq.length != 0 + revcomp(seq.join) + seq=Array.new + end + puts $_ + else + $_.sub(/\n/,'') + seq.push $_ + end +end +revcomp(seq.join) diff --git a/trunk/benchmark/bm_so_sieve.rb b/trunk/benchmark/bm_so_sieve.rb new file mode 100644 index 0000000000..dbe2bfa63d --- /dev/null +++ b/trunk/benchmark/bm_so_sieve.rb @@ -0,0 +1,24 @@ +# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby +num = 40 +count = i = j = 0 +flags0 = Array.new(8192,1) +k = 0 +while k < num + k+=1 + count = 0 + flags = flags0.dup + i = 2 + while i<8192 + i+=1 + if flags[i] + # remove all multiples of prime: i + j = i*i + while j < 8192 + j += i + flags[j] = nil + end + count += 1 + end + end +end +count diff --git a/trunk/benchmark/bm_so_spectralnorm.rb b/trunk/benchmark/bm_so_spectralnorm.rb new file mode 100644 index 0000000000..6b97206689 --- /dev/null +++ b/trunk/benchmark/bm_so_spectralnorm.rb @@ -0,0 +1,50 @@ +# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +def eval_A(i,j) + return 1.0/((i+j)*(i+j+1)/2+i+1) +end + +def eval_A_times_u(u) + v, i = nil, nil + (0..u.length-1).collect { |i| + v = 0 + for j in 0..u.length-1 + v += eval_A(i,j)*u[j] + end + v + } +end + +def eval_At_times_u(u) + v, i = nil, nil + (0..u.length-1).collect{|i| + v = 0 + for j in 0..u.length-1 + v += eval_A(j,i)*u[j] + end + v + } +end + +def eval_AtA_times_u(u) + return eval_At_times_u(eval_A_times_u(u)) +end + +n = 500 # ARGV[0].to_i + +u=[1]*n +for i in 1..10 + v=eval_AtA_times_u(u) + u=eval_AtA_times_u(v) +end +vBv=0 +vv=0 +for i in 0..n-1 + vBv += u[i]*v[i] + vv += v[i]*v[i] +end + +str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n" +# print str diff --git a/trunk/benchmark/bm_vm1_block.rb b/trunk/benchmark/bm_vm1_block.rb new file mode 100644 index 0000000000..2dc4e72be5 --- /dev/null +++ b/trunk/benchmark/bm_vm1_block.rb @@ -0,0 +1,10 @@ +def m + yield +end + +i=0 +while i<30000000 # while loop 1 + i+=1 + m{ + } +end
\ No newline at end of file diff --git a/trunk/benchmark/bm_vm1_const.rb b/trunk/benchmark/bm_vm1_const.rb new file mode 100644 index 0000000000..3e395d9478 --- /dev/null +++ b/trunk/benchmark/bm_vm1_const.rb @@ -0,0 +1,8 @@ +Const = 1 + +i = 0 +while i<30000000 # while loop 1 + i+= 1 + j = Const + k = Const +end diff --git a/trunk/benchmark/bm_vm1_ensure.rb b/trunk/benchmark/bm_vm1_ensure.rb new file mode 100644 index 0000000000..c3b71ead5a --- /dev/null +++ b/trunk/benchmark/bm_vm1_ensure.rb @@ -0,0 +1,11 @@ +i=0 +while i<30000000 # benchmark loop 1 + i+=1 + begin + begin + ensure + end + ensure + end +end + diff --git a/trunk/benchmark/bm_vm1_ivar.rb b/trunk/benchmark/bm_vm1_ivar.rb new file mode 100644 index 0000000000..4de833a316 --- /dev/null +++ b/trunk/benchmark/bm_vm1_ivar.rb @@ -0,0 +1,8 @@ +@a = 1 + +i = 0 +while i<30000000 # while loop 1 + i+= 1 + j = @a + k = @a +end diff --git a/trunk/benchmark/bm_vm1_ivar_set.rb b/trunk/benchmark/bm_vm1_ivar_set.rb new file mode 100644 index 0000000000..c8076c6ab6 --- /dev/null +++ b/trunk/benchmark/bm_vm1_ivar_set.rb @@ -0,0 +1,6 @@ +i = 0 +while i<30_000_000 # while loop 1 + i+= 1 + @a = 1 + @b = 2 +end diff --git a/trunk/benchmark/bm_vm1_length.rb b/trunk/benchmark/bm_vm1_length.rb new file mode 100644 index 0000000000..2d7d7f0b52 --- /dev/null +++ b/trunk/benchmark/bm_vm1_length.rb @@ -0,0 +1,9 @@ +a = 'abc' +b = [1, 2, 3] +i=0 +while i<30000000 # while loop 1 + i+=1 + a.length + b.length +end + diff --git a/trunk/benchmark/bm_vm1_neq.rb b/trunk/benchmark/bm_vm1_neq.rb new file mode 100644 index 0000000000..212f056c6e --- /dev/null +++ b/trunk/benchmark/bm_vm1_neq.rb @@ -0,0 +1,8 @@ +i = 0 +obj1 = Object.new +obj2 = Object.new + +while i<30000000 # while loop 1 + i+= 1 + obj1 != obj2 +end diff --git a/trunk/benchmark/bm_vm1_not.rb b/trunk/benchmark/bm_vm1_not.rb new file mode 100644 index 0000000000..f139fed8be --- /dev/null +++ b/trunk/benchmark/bm_vm1_not.rb @@ -0,0 +1,7 @@ +i = 0 +obj = Object.new + +while i<30000000 # while loop 1 + i+= 1 + !obj +end diff --git a/trunk/benchmark/bm_vm1_rescue.rb b/trunk/benchmark/bm_vm1_rescue.rb new file mode 100644 index 0000000000..0c98d00e0d --- /dev/null +++ b/trunk/benchmark/bm_vm1_rescue.rb @@ -0,0 +1,7 @@ +i=0 +while i<30000000 # while loop 1 + i+=1 + begin + rescue + end +end diff --git a/trunk/benchmark/bm_vm1_simplereturn.rb b/trunk/benchmark/bm_vm1_simplereturn.rb new file mode 100644 index 0000000000..c843ee3d97 --- /dev/null +++ b/trunk/benchmark/bm_vm1_simplereturn.rb @@ -0,0 +1,9 @@ +def m + return 1 +end +i=0 +while i<30000000 # while loop 1 + i+=1 + m +end + diff --git a/trunk/benchmark/bm_vm1_swap.rb b/trunk/benchmark/bm_vm1_swap.rb new file mode 100644 index 0000000000..a565b6f6dc --- /dev/null +++ b/trunk/benchmark/bm_vm1_swap.rb @@ -0,0 +1,8 @@ +a = 1 +b = 2 +i=0 +while i<30000000 # while loop 1 + i+=1 + a, b = b, a +end + diff --git a/trunk/benchmark/bm_vm2_array.rb b/trunk/benchmark/bm_vm2_array.rb new file mode 100644 index 0000000000..e29c11200f --- /dev/null +++ b/trunk/benchmark/bm_vm2_array.rb @@ -0,0 +1,5 @@ +i=0 +while i<6000000 # benchmark loop 2 + i+=1 + a = [1,2,3,4,5,6,7,8,9,10] +end diff --git a/trunk/benchmark/bm_vm2_case.rb b/trunk/benchmark/bm_vm2_case.rb new file mode 100644 index 0000000000..1ec34ad692 --- /dev/null +++ b/trunk/benchmark/bm_vm2_case.rb @@ -0,0 +1,14 @@ +i=0 +while i<6000000 # while loop 2 + case :foo + when :bar + raise + when :baz + raise + when :boo + raise + when :foo + i+=1 + end +end + diff --git a/trunk/benchmark/bm_vm2_eval.rb b/trunk/benchmark/bm_vm2_eval.rb new file mode 100644 index 0000000000..375dccc00e --- /dev/null +++ b/trunk/benchmark/bm_vm2_eval.rb @@ -0,0 +1,6 @@ +i=0 +while i<6000000 # benchmark loop 2 + i+=1 + eval("1") +end + diff --git a/trunk/benchmark/bm_vm2_method.rb b/trunk/benchmark/bm_vm2_method.rb new file mode 100644 index 0000000000..cc94b8ab3d --- /dev/null +++ b/trunk/benchmark/bm_vm2_method.rb @@ -0,0 +1,9 @@ +def m + nil +end + +i=0 +while i<6000000 # benchmark loop 2 + i+=1 + m; m; m; m; m; m; m; m; +end diff --git a/trunk/benchmark/bm_vm2_mutex.rb b/trunk/benchmark/bm_vm2_mutex.rb new file mode 100644 index 0000000000..9ec1a0f136 --- /dev/null +++ b/trunk/benchmark/bm_vm2_mutex.rb @@ -0,0 +1,9 @@ +require 'thread' + +m = Mutex.new + +i=0 +while i<6000000 # benchmark loop 2 + i+=1 + m.synchronize{} +end diff --git a/trunk/benchmark/bm_vm2_poly_method.rb b/trunk/benchmark/bm_vm2_poly_method.rb new file mode 100644 index 0000000000..ac9953ce5f --- /dev/null +++ b/trunk/benchmark/bm_vm2_poly_method.rb @@ -0,0 +1,20 @@ +class C1 + def m + 1 + end +end +class C2 + def m + 2 + end +end + +o1 = C1.new +o2 = C2.new + +i=0 +while i<6000000 # benchmark loop 2 + o = (i % 2 == 0) ? o1 : o2 + o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i+=1 +end diff --git a/trunk/benchmark/bm_vm2_poly_method_ov.rb b/trunk/benchmark/bm_vm2_poly_method_ov.rb new file mode 100644 index 0000000000..856ba9b161 --- /dev/null +++ b/trunk/benchmark/bm_vm2_poly_method_ov.rb @@ -0,0 +1,20 @@ +class C1 + def m + 1 + end +end +class C2 + def m + 2 + end +end + +o1 = C1.new +o2 = C2.new + +i=0 +while i<6000000 # benchmark loop 2 + o = (i % 2 == 0) ? o1 : o2 +# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m + i+=1 +end diff --git a/trunk/benchmark/bm_vm2_proc.rb b/trunk/benchmark/bm_vm2_proc.rb new file mode 100644 index 0000000000..0bd05b9544 --- /dev/null +++ b/trunk/benchmark/bm_vm2_proc.rb @@ -0,0 +1,14 @@ +def m &b + b +end + +pr = m{ + a = 1 +} + +i=0 +while i<6000000 # benchmark loop 2 + i+=1 + pr.call +end + diff --git a/trunk/benchmark/bm_vm2_regexp.rb b/trunk/benchmark/bm_vm2_regexp.rb new file mode 100644 index 0000000000..44f6ed402e --- /dev/null +++ b/trunk/benchmark/bm_vm2_regexp.rb @@ -0,0 +1,6 @@ +i=0 +str = 'xxxhogexxx' +while i<6000000 # benchmark loop 2 + /hoge/ =~ str + i+=1 +end diff --git a/trunk/benchmark/bm_vm2_send.rb b/trunk/benchmark/bm_vm2_send.rb new file mode 100644 index 0000000000..c20dbdd26c --- /dev/null +++ b/trunk/benchmark/bm_vm2_send.rb @@ -0,0 +1,12 @@ +class C + def m + end +end + +o = C.new + +i=0 +while i<6000000 # benchmark loop 2 + i+=1 + o.__send__ :m +end diff --git a/trunk/benchmark/bm_vm2_super.rb b/trunk/benchmark/bm_vm2_super.rb new file mode 100644 index 0000000000..70c86b376f --- /dev/null +++ b/trunk/benchmark/bm_vm2_super.rb @@ -0,0 +1,20 @@ + +class C + def m + 1 + end +end + +class CC < C + def m + super() + end +end + +obj = CC.new + +i = 0 +while i<6000000 # benchmark loop 2 + obj.m + i+=1 +end diff --git a/trunk/benchmark/bm_vm2_unif1.rb b/trunk/benchmark/bm_vm2_unif1.rb new file mode 100644 index 0000000000..e12bd2ade0 --- /dev/null +++ b/trunk/benchmark/bm_vm2_unif1.rb @@ -0,0 +1,8 @@ +i = 0 +def m a, b +end + +while i<6000000 # benchmark loop 2 + i+=1 + m 100, 200 +end diff --git a/trunk/benchmark/bm_vm2_zsuper.rb b/trunk/benchmark/bm_vm2_zsuper.rb new file mode 100644 index 0000000000..3a75960403 --- /dev/null +++ b/trunk/benchmark/bm_vm2_zsuper.rb @@ -0,0 +1,20 @@ +i = 0 + +class C + def m a + 1 + end +end + +class CC < C + def m a + super + end +end + +obj = CC.new + +while i<6000000 # benchmark loop 2 + obj.m 10 + i+=1 +end diff --git a/trunk/benchmark/bm_vm3_gc.rb b/trunk/benchmark/bm_vm3_gc.rb new file mode 100755 index 0000000000..7db9829d44 --- /dev/null +++ b/trunk/benchmark/bm_vm3_gc.rb @@ -0,0 +1,7 @@ +#! /usr/bin/ruby +5000.times do + 100.times do + {"xxxx"=>"yyyy"} + end + GC.start +end diff --git a/trunk/benchmark/bm_vm3_thread_create_join.rb b/trunk/benchmark/bm_vm3_thread_create_join.rb new file mode 100644 index 0000000000..325a66d587 --- /dev/null +++ b/trunk/benchmark/bm_vm3_thread_create_join.rb @@ -0,0 +1,6 @@ +i=0 +while i<100_000 # benchmark loop 3 + i+=1 + Thread.new{ + }.join +end diff --git a/trunk/benchmark/bm_vm3_thread_mutex.rb b/trunk/benchmark/bm_vm3_thread_mutex.rb new file mode 100644 index 0000000000..649f1fddac --- /dev/null +++ b/trunk/benchmark/bm_vm3_thread_mutex.rb @@ -0,0 +1,18 @@ +require 'thread' +m = Mutex.new +r = 0 +max = 1000 +(1..max).map{ + Thread.new{ + i=0 + while i<max + i+=1 + m.synchronize{ + r += 1 + } + end + } +}.each{|e| + e.join +} +raise r.to_s if r != max * max diff --git a/trunk/benchmark/bmx_temp.rb b/trunk/benchmark/bmx_temp.rb new file mode 100644 index 0000000000..0b4b219ca2 --- /dev/null +++ b/trunk/benchmark/bmx_temp.rb @@ -0,0 +1,9 @@ +def m + nil +end + +i=0 +while i<800000 # benchmark loop 2 + i+=1 + m; m; m; m; m; m; m; m; +end diff --git a/trunk/benchmark/driver.rb b/trunk/benchmark/driver.rb new file mode 100644 index 0000000000..4a1afe360b --- /dev/null +++ b/trunk/benchmark/driver.rb @@ -0,0 +1,253 @@ +# +# Ruby Benchmark driver +# + +first = true + +p RUBY_VERSION + +begin + require 'optparse' +rescue LoadError + if first + first = false + $:.unshift File.join(File.dirname(__FILE__), '../lib') + retry + else + raise + end +end + +require 'benchmark' +require 'pp' + +class BenchmarkDriver + def self.benchmark(opt) + driver = self.new(opt[:execs], opt[:dir], opt) + begin + driver.run + ensure + driver.show_results + end + end + + def output *args + puts(*args) + @output and @output.puts(*args) + end + + def message *args + output(*args) if @verbose + end + + def message_print *args + if @verbose + print(*args) + STDOUT.flush + @output and @output.print(*args) + end + end + + def progress_message *args + unless STDOUT.tty? + STDERR.print(*args) + STDERR.flush + end + end + + def initialize execs, dir, opt = {} + @execs = execs.map{|e| + e.strip! + next if e.empty? + + if /(.+)::(.+)/ =~ e + # ex) ruby-a::/path/to/ruby-a + v = $1.strip + e = $2 + else + v = `#{e} -v`.chomp + v.sub!(/ patchlevel \d+/, '') + end + [e, v] + }.compact + + @dir = dir + @repeat = opt[:repeat] || 1 + @repeat = 1 if @repeat < 1 + @pattern = opt[:pattern] || nil + @verbose = opt[:quiet] ? false : (opt[:verbose] || false) + @output = opt[:output] ? open(opt[:output], 'w') : nil + @loop_wl1 = @loop_wl2 = nil + @opt = opt + + # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...] + @results = [] + + if @verbose + @start_time = Time.now + message @start_time + @execs.each_with_index{|(e, v), i| + message "target #{i}: #{v}" + } + end + end + + def show_results + output + + if @verbose + message '-----------------------------------------------------------' + message 'raw data:' + message + message PP.pp(@results, "", 79) + message + message "Elapesed time: #{Time.now - @start_time} (sec)" + end + + output '-----------------------------------------------------------' + output 'benchmark results:' + + if @verbose and @repeat > 1 + output "minimum results in each #{@repeat} measurements." + end + + output "name\t#{@execs.map{|(e, v)| v}.join("\t")}" + @results.each{|v, result| + rets = [] + s = nil + result.each_with_index{|e, i| + r = e.min + case v + when /^vm1_/ + if @loop_wl1 + r -= @loop_wl1[i] + s = '*' + end + when /^vm2_/ + if @loop_wl2 + r -= @loop_wl2[i] + s = '*' + end + end + rets << sprintf("%.3f", r) + } + output "#{v}#{s}\t#{rets.join("\t")}" + } + end + + def files + flag = {} + vm1 = vm2 = wl1 = wl2 = false + @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file| + next if @pattern && /#{@pattern}/ !~ File.basename(file) + case file + when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/ + flag[$1] = true + end + file + }.compact + + if flag['vm1'] && !flag['whileloop'] + @files << File.join(@dir, 'bm_loop_whileloop.rb') + elsif flag['vm2'] && !flag['whileloop2'] + @files << File.join(@dir, 'bm_loop_whileloop2.rb') + end + + @files.sort! + progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n" + @files + end + + def run + files.each_with_index{|file, i| + @i = i + r = measure_file(file) + + if /bm_loop_whileloop.rb/ =~ file + @loop_wl1 = r[1].map{|e| e.min} + elsif /bm_loop_whileloop2.rb/ =~ file + @loop_wl2 = r[1].map{|e| e.min} + end + } + end + + def measure_file file + name = File.basename(file, '.rb').sub(/^bm_/, '') + prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb") + load prepare_file if FileTest.exist?(prepare_file) + + if @verbose + output + output '-----------------------------------------------------------' + output name + output + output File.read(file) + output + end + + result = [name] + result << @execs.map{|(e, v)| + (0...@repeat).map{ + message_print "#{v}\t" + progress_message '.' + + m = measure(e, file) + message "#{m}" + m + } + } + @results << result + result + end + + def measure executable, file + cmd = "#{executable} #{file}" + m = Benchmark.measure{ + `#{cmd}` + } + + if $? != 0 + raise "Benchmark process exited with abnormal status (#{$?})" + end + + m.real + end +end + +if __FILE__ == $0 + opt = { + :execs => ['ruby'], + :dir => './', + :repeat => 1, + :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}", + } + + parser = OptionParser.new{|o| + o.on('-e', '--executables [EXECS]', + "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e| + opt[:execs] = e.split(/;/) + } + o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d| + opt[:dir] = d + } + o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p| + opt[:pattern] = p + } + o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n| + opt[:repeat] = n.to_i + } + o.on('-o', '--output-file [FILE]', "Output file"){|o| + opt[:output] = o + } + o.on('-q', '--quiet', "Run without notify information except result table."){|q| + opt[:quiet] = q + } + o.on('-v', '--verbose'){|v| + opt[:verbose] = v + } + } + + parser.parse!(ARGV) + BenchmarkDriver.benchmark(opt) +end + diff --git a/trunk/benchmark/make_fasta_output.rb b/trunk/benchmark/make_fasta_output.rb new file mode 100644 index 0000000000..b6d787ae27 --- /dev/null +++ b/trunk/benchmark/make_fasta_output.rb @@ -0,0 +1,19 @@ +# prepare 'fasta.output' + +def prepare_fasta_output n + filebase = File.join(File.dirname($0), 'fasta.output') + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + file = "#{filebase}.#{n}" + + unless FileTest.exist?(file) + STDERR.puts "preparing #{file}" + + open(file, 'w'){|f| + ARGV[0] = n + $stdout = f + load script + $stdout = STDOUT + } + end +end + diff --git a/trunk/benchmark/other-lang/ack.pl b/trunk/benchmark/other-lang/ack.pl new file mode 100644 index 0000000000..201e22ddfa --- /dev/null +++ b/trunk/benchmark/other-lang/ack.pl @@ -0,0 +1,11 @@ +use integer; + +sub Ack { + return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1)) + : Ack($_[0]-1, 1)) + : $_[1]+1; +} + +my $NUM = 9; +$NUM = 1 if ($NUM < 1); +my $ack = Ack(3, $NUM); diff --git a/trunk/benchmark/other-lang/ack.py b/trunk/benchmark/other-lang/ack.py new file mode 100644 index 0000000000..9968e7cfcf --- /dev/null +++ b/trunk/benchmark/other-lang/ack.py @@ -0,0 +1,16 @@ +import sys +sys.setrecursionlimit(5000000) + +def Ack(M, N): + if (not M): + return( N + 1 ) + if (not N): + return( Ack(M-1, 1) ) + return( Ack(M-1, Ack(M, N-1)) ) + +def main(): + NUM = 9 + sys.setrecursionlimit(10000) + Ack(3, NUM) + +main() diff --git a/trunk/benchmark/other-lang/ack.rb b/trunk/benchmark/other-lang/ack.rb new file mode 100644 index 0000000000..7451bed6c4 --- /dev/null +++ b/trunk/benchmark/other-lang/ack.rb @@ -0,0 +1,12 @@ +def ack(m, n) + if m == 0 then + n + 1 + elsif n == 0 then + ack(m - 1, 1) + else + ack(m - 1, ack(m, n - 1)) + end +end + +NUM = 9 +ack(3, NUM) diff --git a/trunk/benchmark/other-lang/ack.scm b/trunk/benchmark/other-lang/ack.scm new file mode 100644 index 0000000000..a80b73ba55 --- /dev/null +++ b/trunk/benchmark/other-lang/ack.scm @@ -0,0 +1,7 @@ +(define (ack m n) + (cond ((zero? m) (+ n 1)) + ((zero? n) (ack (- m 1) 1)) + (else (ack (- m 1) (ack m (- n 1)))))) + +(ack 3 9) + diff --git a/trunk/benchmark/other-lang/eval.rb b/trunk/benchmark/other-lang/eval.rb new file mode 100644 index 0000000000..3875927389 --- /dev/null +++ b/trunk/benchmark/other-lang/eval.rb @@ -0,0 +1,66 @@ + +Bench = %w( + loop + ack + fib + tak + fact +) + +Lang = <<EOP.map{|l| l.strip} + ruby-cyg + ../../../test6/miniruby + perl + python + gosh +EOP + +Bench.replace ['loop2'] +Lang.replace ['ruby-cyg'] + +Ext = %w( + .rb + .rb + .pl + .py + .scm +) + +p Bench +p Lang + +require 'benchmark' + +def bench cmd + m = Benchmark.measure{ + #p cmd + system(cmd) + } + [m.utime, m.real] +end + +Result = [] +Bench.each{|b| + r = [] + Lang.each_with_index{|l, idx| + cmd = "#{l} #{b}#{Ext[idx]}" + r << bench(cmd) + } + Result << r +} + +require 'pp' +# utime +puts Lang.join("\t") +Bench.each_with_index{|b, bi| + print b, "\t" + puts Result[bi].map{|e| e[0]}.join("\t") +} + +# rtime +puts Lang.join("\t") +Bench.each_with_index{|b, bi| + print b, "\t" + puts Result[bi].map{|e| e[1]}.join("\t") +} + diff --git a/trunk/benchmark/other-lang/fact.pl b/trunk/benchmark/other-lang/fact.pl new file mode 100644 index 0000000000..a9b0b69cdf --- /dev/null +++ b/trunk/benchmark/other-lang/fact.pl @@ -0,0 +1,13 @@ +sub fact{ + my $n = @_[0]; + if($n < 2){ + return 1; + } + else{ + return $n * fact($n-1); + } +} + +for($i=0; $i<10000; $i++){ + &fact(100); +} diff --git a/trunk/benchmark/other-lang/fact.py b/trunk/benchmark/other-lang/fact.py new file mode 100644 index 0000000000..01593965d9 --- /dev/null +++ b/trunk/benchmark/other-lang/fact.py @@ -0,0 +1,18 @@ +#import sys +#sys.setrecursionlimit(1000) + +def factL(n): + r = 1 + for x in range(2, n): + r *= x + return r + +def factR(n): + if n < 2: + return 1 + else: + return n * factR(n-1) + +for i in range(10000): + factR(100) + diff --git a/trunk/benchmark/other-lang/fact.rb b/trunk/benchmark/other-lang/fact.rb new file mode 100644 index 0000000000..7e97b22b39 --- /dev/null +++ b/trunk/benchmark/other-lang/fact.rb @@ -0,0 +1,13 @@ +def fact(n) + if n < 2 + 1 + else + n * fact(n-1) + end +end + +i=0 +while i<10000 + i+=1 + fact(100) +end diff --git a/trunk/benchmark/other-lang/fact.scm b/trunk/benchmark/other-lang/fact.scm new file mode 100644 index 0000000000..c98a7fedd3 --- /dev/null +++ b/trunk/benchmark/other-lang/fact.scm @@ -0,0 +1,8 @@ +(define (fact n) + (if (< n 2) + 1 + (* n (fact (- n 1))))) + +(dotimes (i 10000) + (fact 100)) + diff --git a/trunk/benchmark/other-lang/fib.pl b/trunk/benchmark/other-lang/fib.pl new file mode 100644 index 0000000000..a46f666d1e --- /dev/null +++ b/trunk/benchmark/other-lang/fib.pl @@ -0,0 +1,11 @@ +sub fib{ + my $n = $_[0]; + if($n < 3){ + return 1; + } + else{ + return fib($n-1) + fib($n-2); + } +}; + +&fib(34); diff --git a/trunk/benchmark/other-lang/fib.py b/trunk/benchmark/other-lang/fib.py new file mode 100644 index 0000000000..45f2bceb8d --- /dev/null +++ b/trunk/benchmark/other-lang/fib.py @@ -0,0 +1,7 @@ +def fib(n): + if n < 3: + return 1 + else: + return fib(n-1) + fib(n-2) + +fib(34) diff --git a/trunk/benchmark/other-lang/fib.rb b/trunk/benchmark/other-lang/fib.rb new file mode 100644 index 0000000000..ec587eabe0 --- /dev/null +++ b/trunk/benchmark/other-lang/fib.rb @@ -0,0 +1,9 @@ +def fib n + if n < 3 + 1 + else + fib(n-1) + fib(n-2) + end +end + +fib(34) diff --git a/trunk/benchmark/other-lang/fib.scm b/trunk/benchmark/other-lang/fib.scm new file mode 100644 index 0000000000..2fc4e225bd --- /dev/null +++ b/trunk/benchmark/other-lang/fib.scm @@ -0,0 +1,7 @@ +(define (fib n) + (if (< n 3) + 1 + (+ (fib (- n 1)) (fib (- n 2))))) + +(fib 34) + diff --git a/trunk/benchmark/other-lang/loop.pl b/trunk/benchmark/other-lang/loop.pl new file mode 100644 index 0000000000..2777490aaa --- /dev/null +++ b/trunk/benchmark/other-lang/loop.pl @@ -0,0 +1,3 @@ +for($i=0; $i<30000000; $i++){ +} + diff --git a/trunk/benchmark/other-lang/loop.py b/trunk/benchmark/other-lang/loop.py new file mode 100644 index 0000000000..003749bf3a --- /dev/null +++ b/trunk/benchmark/other-lang/loop.py @@ -0,0 +1,2 @@ +for i in xrange(30000000): + pass diff --git a/trunk/benchmark/other-lang/loop.rb b/trunk/benchmark/other-lang/loop.rb new file mode 100644 index 0000000000..d43cef61f3 --- /dev/null +++ b/trunk/benchmark/other-lang/loop.rb @@ -0,0 +1,4 @@ +i=0 +while i<30000000 + i+=1 +end diff --git a/trunk/benchmark/other-lang/loop.scm b/trunk/benchmark/other-lang/loop.scm new file mode 100644 index 0000000000..3364f7e679 --- /dev/null +++ b/trunk/benchmark/other-lang/loop.scm @@ -0,0 +1 @@ +(dotimes (x 30000000)) diff --git a/trunk/benchmark/other-lang/loop2.rb b/trunk/benchmark/other-lang/loop2.rb new file mode 100644 index 0000000000..df8fffc1ff --- /dev/null +++ b/trunk/benchmark/other-lang/loop2.rb @@ -0,0 +1 @@ +30000000.times{} diff --git a/trunk/benchmark/other-lang/tak.pl b/trunk/benchmark/other-lang/tak.pl new file mode 100644 index 0000000000..7e748a67c6 --- /dev/null +++ b/trunk/benchmark/other-lang/tak.pl @@ -0,0 +1,11 @@ +sub tak { + local($x, $y, $z) = @_; + if (!($y < $x)) { + return $z; + } else { + return &tak(&tak($x - 1, $y, $z), + &tak($y - 1, $z, $x), + &tak($z - 1, $x, $y)); + } +} +&tak(18, 9, 0); diff --git a/trunk/benchmark/other-lang/tak.py b/trunk/benchmark/other-lang/tak.py new file mode 100644 index 0000000000..04f3f6829c --- /dev/null +++ b/trunk/benchmark/other-lang/tak.py @@ -0,0 +1,8 @@ +def tak(x, y, z): + if not(y<x): + return z + else: + return tak(tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) +tak(18, 9, 0) diff --git a/trunk/benchmark/other-lang/tak.rb b/trunk/benchmark/other-lang/tak.rb new file mode 100644 index 0000000000..efe5380f4e --- /dev/null +++ b/trunk/benchmark/other-lang/tak.rb @@ -0,0 +1,13 @@ + +def tak x, y, z + unless y < x + z + else + tak( tak(x-1, y, z), + tak(y-1, z, x), + tak(z-1, x, y)) + end +end + +tak(18, 9, 0) + diff --git a/trunk/benchmark/other-lang/tak.scm b/trunk/benchmark/other-lang/tak.scm new file mode 100644 index 0000000000..52a7629ee5 --- /dev/null +++ b/trunk/benchmark/other-lang/tak.scm @@ -0,0 +1,10 @@ +(define (tak x y z) + (if (not (< y x)) + z + (tak (tak (- x 1) y z) + (tak (- y 1) z x) + (tak (- z 1) x y)))) + +(tak 18 9 0) + + diff --git a/trunk/benchmark/prepare_so_count_words.rb b/trunk/benchmark/prepare_so_count_words.rb new file mode 100644 index 0000000000..ee2138cdb2 --- /dev/null +++ b/trunk/benchmark/prepare_so_count_words.rb @@ -0,0 +1,15 @@ +# prepare 'wc.input' + +def prepare_wc_input + wcinput = File.join(File.dirname($0), 'wc.input') + wcbase = File.join(File.dirname($0), 'wc.input.base') + unless FileTest.exist?(wcinput) + data = File.read(wcbase) + 13.times{ + data << data + } + open(wcinput, 'w'){|f| f.write data} + end +end + +prepare_wc_input diff --git a/trunk/benchmark/prepare_so_k_nucleotide.rb b/trunk/benchmark/prepare_so_k_nucleotide.rb new file mode 100644 index 0000000000..f28f4460a1 --- /dev/null +++ b/trunk/benchmark/prepare_so_k_nucleotide.rb @@ -0,0 +1,2 @@ +require File.join(File.dirname(__FILE__), 'make_fasta_output') +prepare_fasta_output(100_000) diff --git a/trunk/benchmark/prepare_so_reverse_complement.rb b/trunk/benchmark/prepare_so_reverse_complement.rb new file mode 100644 index 0000000000..7f089109de --- /dev/null +++ b/trunk/benchmark/prepare_so_reverse_complement.rb @@ -0,0 +1,2 @@ +require File.join(File.dirname(__FILE__), 'make_fasta_output') +prepare_fasta_output(2_500_000) diff --git a/trunk/benchmark/report.rb b/trunk/benchmark/report.rb new file mode 100644 index 0000000000..8305330b45 --- /dev/null +++ b/trunk/benchmark/report.rb @@ -0,0 +1,81 @@ +# +# YARV benchmark driver +# + +require 'yarvutil' +require 'benchmark' +require 'rbconfig' + +def exec_command type, file, w + <<-EOP + $DRIVER_PATH = '#{File.dirname($0)}' + $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect} + require 'benchmark' + require 'yarvutil' +# print '#{type}' + begin + puts Benchmark.measure{ + #{w}('#{file}') + }.utime + rescue Exception => exec_command_error_variable + puts "\t" + exec_command_error_variable.message + end + EOP +end + +def benchmark cmd + rubybin = ENV['RUBY'] || File.join( + Config::CONFIG["bindir"], + Config::CONFIG["ruby_install_name"] + Config::CONFIG["EXEEXT"]) + + IO.popen(rubybin, 'r+'){|io| + io.write cmd + io.close_write + return io.gets + } +end + +def ruby_exec file + prog = exec_command 'ruby', file, 'load' + benchmark prog +end + +def yarv_exec file + prog = exec_command 'yarv', file, 'YARVUtil.load_bm' + benchmark prog +end + +$wr = $wy = nil + +def measure bench + file = File.dirname($0) + "/bm_#{bench}.rb" + r = ruby_exec(file).to_f + y = yarv_exec(file).to_f + puts "#{bench}\t#{r}\t#{y}" +end + +def measure2 + r = ruby_exec.to_f + y = yarv_exec.to_f + puts r/y +end + +if $0 == __FILE__ + %w{ + whileloop + whileloop2 + times + const + method + poly_method + block + rescue + rescue2 + }.each{|bench| + measure bench + } +end + + + + diff --git a/trunk/benchmark/run.rb b/trunk/benchmark/run.rb new file mode 100644 index 0000000000..6ef2943642 --- /dev/null +++ b/trunk/benchmark/run.rb @@ -0,0 +1,127 @@ +# +# Ruby benchmark driver +# + +require 'benchmark' +require 'rbconfig' + +$matzrubyonly = false +$rubyonly = false + +$results = [] + +# prepare 'wc.input' +def prepare_wc_input + wcinput = File.join(File.dirname($0), 'wc.input') + wcbase = File.join(File.dirname($0), 'wc.input.base') + unless FileTest.exist?(wcinput) + data = File.read(wcbase) + 13.times{ + data << data + } + open(wcinput, 'w'){|f| f.write data} + end +end + +prepare_wc_input + +def bm file + prog = File.readlines(file).map{|e| e.rstrip}.join("\n") + return if prog.empty? + + /[a-z]+_(.+)\.rb/ =~ file + bm_name = $1 + puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly + puts "#{bm_name}: " + + +puts <<EOS unless $matzrubyonly || $rubyonly +#{prog} +-- +EOS + begin + result = [bm_name] + result << matzruby_exec(file) unless $rubyonly + result << ruby_exec(file) unless $matzrubyonly + $results << result + + rescue Exception => e + puts + puts "** benchmark failure: #{e}" + puts e.backtrace + end +end + +def benchmark file, bin + m = Benchmark.measure{ + `#{bin} #{$opts} #{file}` + } + sec = '%.3f' % m.real + puts " #{sec}" + sec +end + +def ruby_exec file + print 'ruby' + benchmark file, $ruby_program +end + +def matzruby_exec file + print 'matz' + rubylib = ENV['RUBYLIB'] + ENV['RUBYLIB'] = '' + r = benchmark file, $matzruby_program + ENV['RUBYLIB'] = rubylib + r +end + +if $0 == __FILE__ + ARGV.each{|arg| + case arg + when /\A--ruby=(.+)/ + $ruby_program = $1 + when /\A--matzruby=(.+)/ + $matzruby_program = $1 + when /\A--opts=(.+)/ + $opts = $1 + when /\A(-r|--only-ruby)\z/ + $rubyonly = true + when /\A(-m|--only-matzruby)\z/ + $matzrubyonly = true + end + } + ARGV.delete_if{|arg| + /\A-/ =~ arg + } + + puts "MatzRuby:" + system("#{$matzruby_program} -v") + puts "Ruby:" + system("#{$ruby_program} -v") + puts + + if ARGV.empty? + Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file| + bm file + } + else + ARGV.each{|file| + Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef| + # file = "#{File.dirname(__FILE__)}/#{file}.rb" + bm ef + } + } + end + + puts + puts "-- benchmark summary ---------------------------" + $results.each{|res| + print res.shift, "\t" + (res||[]).each{|result| + /([\d\.]+)/ =~ result + print $1 + "\t" if $1 + } + puts + } +end + diff --git a/trunk/benchmark/runc.rb b/trunk/benchmark/runc.rb new file mode 100644 index 0000000000..14ab171c12 --- /dev/null +++ b/trunk/benchmark/runc.rb @@ -0,0 +1,29 @@ +# +# +# + +require 'benchmark' +require 'rbconfig' + +$rubybin = ENV['RUBY'] || File.join( + Config::CONFIG["bindir"], + Config::CONFIG["ruby_install_name"] + Config::CONFIG["EXEEXT"]) + +def runfile file + puts file + file = File.join(File.dirname($0), 'contrib', file) + Benchmark.bm{|x| + x.report('ruby'){ + system("#{$rubybin} #{file}") + } + x.report('yarv'){ + system("#{$rubybin} -rite -I.. #{file}") + } + } +end + +ARGV.each{|file| + runfile file +} + + diff --git a/trunk/benchmark/wc.input.base b/trunk/benchmark/wc.input.base new file mode 100644 index 0000000000..41143fbac0 --- /dev/null +++ b/trunk/benchmark/wc.input.base @@ -0,0 +1,25 @@ +Subject: Re: Who was Izchak Miller? +From: "Jane D. Anonymous" <nobody@yale.edu> +Date: 1996/04/28 +Message-Id: <4lv7bc$oh@news.ycc.yale.edu> +References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net> +To: 75176.2330@compuserve.com +Content-Type: text/plain; charset=us-ascii +Organization: Yale University +X-Url: news:4lk6vl$gde@ns.oar.net +Mime-Version: 1.0 +Newsgroups: rec.games.roguelike.nethack +X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) + +Hello there, Izchak Miller was my father. When I was younger I spent +many a night, hunched over the keyboard with a cup of tea, playing +nethack with him and my brother. my dad was a philosopher with a strong +weakness for fantasy/sci fi. I remember when he started to get involved +with the Nethack team- my brother's Dungeons and Dragons monster book +found a regular place beside my dad's desk. it's nice to see him living +on in the game he loved so much :-). + Tamar Miller + +The following is a really long word of 5000 characters: + +wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww |