add tag v1_9_3_426

git-svn-id: svn+ssh://ci.ruby-lang.org/ruby/tags/v1_9_3_426@40733 b2dd03c8-39d4-4d8f-98ff-823fe69b080e
author: usa <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> 2013-05-14 11:27:23 +0000
committer: usa <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> 2013-05-14 11:27:23 +0000
commit: aa6e98139c8e1ea442fb2182341aaa08ff55b529 (patch)
tree: a509eb830418991995bfe3b840d4bf270ff7f0e2 /ruby_1_9_3/benchmark
parent: 9e9d191cf367caa17776231a2d0fad0da47b160a (diff)
113 files changed, 3357 insertions, 0 deletions
diff --git a/ruby_1_9_3/benchmark/bm_app_answer.rb b/ruby_1_9_3/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/ruby_1_9_3/benchmark/bm_app_erb.rb b/ruby_1_9_3/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/ruby_1_9_3/benchmark/bm_app_factorial.rb b/ruby_1_9_3/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/ruby_1_9_3/benchmark/bm_app_fib.rb b/ruby_1_9_3/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/ruby_1_9_3/benchmark/bm_app_mandelbrot.rb b/ruby_1_9_3/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..89069db7ab
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i+=1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/ruby_1_9_3/benchmark/bm_app_pentomino.rb b/ruby_1_9_3/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/ruby_1_9_3/benchmark/bm_app_raise.rb b/ruby_1_9_3/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..01d2ae3219
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i=0
+while i<300000
+  i+=1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/ruby_1_9_3/benchmark/bm_app_strconcat.rb b/ruby_1_9_3/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7b2f2da5a7
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i=0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_app_tak.rb b/ruby_1_9_3/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/ruby_1_9_3/benchmark/bm_app_tarai.rb b/ruby_1_9_3/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/ruby_1_9_3/benchmark/bm_app_uri.rb b/ruby_1_9_3/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/ruby_1_9_3/benchmark/bm_io_file_create.rb b/ruby_1_9_3/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/ruby_1_9_3/benchmark/bm_io_file_read.rb b/ruby_1_9_3/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/ruby_1_9_3/benchmark/bm_io_file_write.rb b/ruby_1_9_3/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/ruby_1_9_3/benchmark/bm_io_select.rb b/ruby_1_9_3/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/ruby_1_9_3/benchmark/bm_io_select2.rb b/ruby_1_9_3/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..7b167af774
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_io_select2.rb
@@ -0,0 +1,18 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_io_select3.rb b/ruby_1_9_3/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..fcdbb96e0e
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_io_select3.rb
@@ -0,0 +1,17 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_loop_for.rb b/ruby_1_9_3/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/ruby_1_9_3/benchmark/bm_loop_generator.rb b/ruby_1_9_3/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/ruby_1_9_3/benchmark/bm_loop_times.rb b/ruby_1_9_3/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/ruby_1_9_3/benchmark/bm_loop_whileloop.rb b/ruby_1_9_3/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..43d35e1131
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i=0
+while i<30_000_000 # benchmark loop 1
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_loop_whileloop2.rb b/ruby_1_9_3/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..e514989661
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i=0
+while i< 6_000_000 # benchmark loop 2
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_so_ackermann.rb b/ruby_1_9_3/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/ruby_1_9_3/benchmark/bm_so_array.rb b/ruby_1_9_3/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/ruby_1_9_3/benchmark/bm_so_binary_trees.rb b/ruby_1_9_3/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..6a26465578
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,57 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+def STDOUT.write_ *args
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 12 # 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
diff --git a/ruby_1_9_3/benchmark/bm_so_concatenate.rb b/ruby_1_9_3/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..56b9410632
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i=0
+while i<10
+  i+=1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/ruby_1_9_3/benchmark/bm_so_count_words.rb b/ruby_1_9_3/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/ruby_1_9_3/benchmark/bm_so_exception.rb b/ruby_1_9_3/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..d8b461290c
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i+=1
+  some_function(i+1)
+end
diff --git a/ruby_1_9_3/benchmark/bm_so_fannkuch.rb b/ruby_1_9_3/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/ruby_1_9_3/benchmark/bm_so_fasta.rb b/ruby_1_9_3/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/ruby_1_9_3/benchmark/bm_so_k_nucleotide.rb b/ruby_1_9_3/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/ruby_1_9_3/benchmark/bm_so_lists.rb b/ruby_1_9_3/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..f8d26797aa
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i+=1
+  result = test_lists()
+end
+
+result
diff --git a/ruby_1_9_3/benchmark/bm_so_mandelbrot.rb b/ruby_1_9_3/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/ruby_1_9_3/benchmark/bm_so_matrix.rb b/ruby_1_9_3/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/ruby_1_9_3/benchmark/bm_so_meteor_contest.rb b/ruby_1_9_3/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..99cf6a91cc
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values ( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop accross the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the curent row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a muliple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # follwing reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is acheived via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/ruby_1_9_3/benchmark/bm_so_nbody.rb b/ruby_1_9_3/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/ruby_1_9_3/benchmark/bm_so_nested_loop.rb b/ruby_1_9_3/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/ruby_1_9_3/benchmark/bm_so_nsieve.rb b/ruby_1_9_3/benchmark/bm_so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/ruby_1_9_3/benchmark/bm_so_nsieve_bits.rb b/ruby_1_9_3/benchmark/bm_so_nsieve_bits.rb
new file mode 100644
index 0000000000..019b8b6382
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_nsieve_bits.rb
@@ -0,0 +1,42 @@
+#!/usr/bin/ruby
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_so_object.rb b/ruby_1_9_3/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_so_partial_sums.rb b/ruby_1_9_3/benchmark/bm_so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/ruby_1_9_3/benchmark/bm_so_pidigits.rb b/ruby_1_9_3/benchmark/bm_so_pidigits.rb
new file mode 100644
index 0000000000..c7d6fbfb4d
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize (q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_so_random.rb b/ruby_1_9_3/benchmark/bm_so_random.rb
new file mode 100644
index 0000000000..57f700b863
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+  (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i=0
+while i<N
+  i+=1
+  gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/ruby_1_9_3/benchmark/bm_so_reverse_complement.rb b/ruby_1_9_3/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/ruby_1_9_3/benchmark/bm_so_sieve.rb b/ruby_1_9_3/benchmark/bm_so_sieve.rb
new file mode 100644
index 0000000000..3f1b138bd1
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+  k+=1
+  count = 0
+  flags = flags0.dup
+  i = 2
+  while i<8192
+    i+=1
+    if flags[i]
+      # remove all multiples of prime: i
+      j = i*i
+      while j < 8192
+        j += i
+        flags[j] = nil
+      end
+      count += 1
+    end
+  end
+end
+count
diff --git a/ruby_1_9_3/benchmark/bm_so_spectralnorm.rb b/ruby_1_9_3/benchmark/bm_so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/ruby_1_9_3/benchmark/bm_vm1_block.rb b/ruby_1_9_3/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..0a97883974
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  m{
+  }
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_const.rb b/ruby_1_9_3/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..066916dc31
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i+= 1
+  j = Const
+  k = Const
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_ensure.rb b/ruby_1_9_3/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..b1948f7621
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i=0
+while i<30_000_000 # benchmark loop 1
+  i+=1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm1_ivar.rb b/ruby_1_9_3/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..3ba56427f4
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i+= 1
+  j = @a
+  k = @a
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_ivar_set.rb b/ruby_1_9_3/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..c8076c6ab6
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i+= 1
+  @a = 1
+  @b = 2
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_length.rb b/ruby_1_9_3/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..ccb773278f
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  a.length
+  b.length
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm1_neq.rb b/ruby_1_9_3/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..9254a0ca9b
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i+= 1
+  obj1 != obj2
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_not.rb b/ruby_1_9_3/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..ee9d0f3605
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i+= 1
+  !obj
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_rescue.rb b/ruby_1_9_3/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..3af12bb0f3
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  begin
+  rescue
+  end
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm1_simplereturn.rb b/ruby_1_9_3/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..8e9bcb0129
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  m
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm1_swap.rb b/ruby_1_9_3/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..611baf6b99
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i=0
+while i<30_000_000 # while loop 1
+  i+=1
+  a, b = b, a
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm2_array.rb b/ruby_1_9_3/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..7713ae9f25
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_case.rb b/ruby_1_9_3/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..cd09788a85
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i=0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i+=1
+  end
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm2_defined_method.rb b/ruby_1_9_3/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..06c0d01baa
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_eval.rb b/ruby_1_9_3/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..e72b4661ac
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  eval("1")
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm2_method.rb b/ruby_1_9_3/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..f92e39a73f
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_mutex.rb b/ruby_1_9_3/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..01b1c478cb
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m.synchronize{}
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_poly_method.rb b/ruby_1_9_3/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..921457d817
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_poly_method_ov.rb b/ruby_1_9_3/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..bf09837dd7
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_proc.rb b/ruby_1_9_3/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..3f51056bf9
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+  b
+end
+
+pr = m{
+  a = 1
+}
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  pr.call
+end
+
diff --git a/ruby_1_9_3/benchmark/bm_vm2_regexp.rb b/ruby_1_9_3/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..428099e55a
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i=0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+  /hoge/ =~ str
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_send.rb b/ruby_1_9_3/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..37c79fb1c3
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+  def m
+  end
+end
+
+o = C.new
+
+i=0
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  o.__send__ :m
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_super.rb b/ruby_1_9_3/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..d4f0b647de
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+  def m
+    1
+  end
+end
+
+class CC < C
+  def m
+    super()
+  end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  obj.m
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_unif1.rb b/ruby_1_9_3/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..775f4d37e6
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+  i+=1
+  m 100, 200
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm2_zsuper.rb b/ruby_1_9_3/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..7e90df1822
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+  def m a
+    1
+  end
+end
+
+class CC < C
+  def m a
+    super
+  end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+  obj.m 10
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm3_clearmethodcache.rb b/ruby_1_9_3/benchmark/bm_vm3_clearmethodcache.rb
new file mode 100644
index 0000000000..a25c372f06
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm3_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i=0
+while i<200_000
+  i+=1
+
+  Class.new{
+    def m; end
+  }
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm3_gc.rb b/ruby_1_9_3/benchmark/bm_vm3_gc.rb
new file mode 100755
index 0000000000..7db9829d44
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm3_gc.rb
@@ -0,0 +1,7 @@
+#! /usr/bin/ruby
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_alive_check1.rb b/ruby_1_9_3/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+  t = Thread.new{}
+  while t.alive?
+    Thread.pass
+  end
+}
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_create_join.rb b/ruby_1_9_3/benchmark/bm_vm_thread_create_join.rb
new file mode 100644
index 0000000000..325a66d587
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_create_join.rb
@@ -0,0 +1,6 @@
+i=0
+while i<100_000 # benchmark loop 3
+  i+=1
+  Thread.new{
+  }.join
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_mutex1.rb b/ruby_1_9_3/benchmark/bm_vm_thread_mutex1.rb
new file mode 100644
index 0000000000..588506e87c
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i=0
+    while i<lmax
+      i+=1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_mutex2.rb b/ruby_1_9_3/benchmark/bm_vm_thread_mutex2.rb
new file mode 100644
index 0000000000..d700b146d4
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i=0
+    while i<lmax
+      i+=1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_mutex3.rb b/ruby_1_9_3/benchmark/bm_vm_thread_mutex3.rb
new file mode 100644
index 0000000000..f502b6ac84
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i=0
+    while i<max
+      i+=1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_pass.rb b/ruby_1_9_3/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_pass_flood.rb b/ruby_1_9_3/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..56b5b0a956
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,8 @@
+1000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i=0
+while i<10000
+  i += 1
+end
diff --git a/ruby_1_9_3/benchmark/bm_vm_thread_pipe.rb b/ruby_1_9_3/benchmark/bm_vm_thread_pipe.rb
new file mode 100644
index 0000000000..272d231eba
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bm_vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Mesure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+  lmax.times{
+    w.write('a')
+  }
+  p "w:exit"
+}, Thread.new{
+  lmax.times{
+    r.read(1)
+  }
+  p "r:exit"
+}].each{|t| t.join}
+
diff --git a/ruby_1_9_3/benchmark/bmx_temp.rb b/ruby_1_9_3/benchmark/bmx_temp.rb
new file mode 100644
index 0000000000..0b4b219ca2
--- /dev/null
+++ b/ruby_1_9_3/benchmark/bmx_temp.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i=0
+while i<800000 # benchmark loop 2
+  i+=1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/ruby_1_9_3/benchmark/driver.rb b/ruby_1_9_3/benchmark/driver.rb
new file mode 100644
index 0000000000..7dab292a15
--- /dev/null
+++ b/ruby_1_9_3/benchmark/driver.rb
@@ -0,0 +1,270 @@
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+  require 'optparse'
+rescue LoadError
+  if first
+    first = false
+    $:.unshift File.join(File.dirname(__FILE__), '../lib')
+    retry
+  else
+    raise
+  end
+end
+
+require 'benchmark'
+require 'pp'
+
+class BenchmarkDriver
+  def self.benchmark(opt)
+    driver = self.new(opt[:execs], opt[:dir], opt)
+    begin
+      driver.run
+    ensure
+      driver.show_results
+    end
+  end
+
+  def output *args
+    puts(*args)
+    @output and @output.puts(*args)
+  end
+
+  def message *args
+    output(*args) if @verbose
+  end
+
+  def message_print *args
+    if @verbose
+      print(*args)
+      STDOUT.flush
+      @output and @output.print(*args)
+    end
+  end
+
+  def progress_message *args
+    unless STDOUT.tty?
+      STDERR.print(*args)
+      STDERR.flush
+    end
+  end
+
+  def initialize execs, dir, opt = {}
+    @execs = execs.map{|e|
+      e.strip!
+      next if e.empty?
+
+      if /(.+)::(.+)/ =~ e
+        # ex) ruby-a::/path/to/ruby-a
+        v = $1.strip
+        e = $2
+      else
+        v =  `#{e} -v`.chomp
+        v.sub!(/ patchlevel \d+/, '')
+      end
+      [e, v]
+    }.compact
+
+    @dir = dir
+    @repeat = opt[:repeat] || 1
+    @repeat = 1 if @repeat < 1
+    @pattern = opt[:pattern] || nil
+    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+    @output = opt[:output] ? open(opt[:output], 'w') : nil
+    @loop_wl1 = @loop_wl2 = nil
+    @opt = opt
+
+    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+    @results = []
+
+    if @verbose
+      @start_time = Time.now
+      message @start_time
+      @execs.each_with_index{|(e, v), i|
+        message "target #{i}: #{v}"
+      }
+    end
+  end
+
+  def average results
+    results.inject(:+) / results.length
+  end
+
+  def show_results
+    output
+
+    if @verbose
+      message '-----------------------------------------------------------'
+      message 'raw data:'
+      message
+      message PP.pp(@results, "", 79)
+      message
+      message "Elapesed time: #{Time.now - @start_time} (sec)"
+    end
+
+    output '-----------------------------------------------------------'
+    output 'benchmark results:'
+
+    if @verbose and @repeat > 1
+      output "minimum results in each #{@repeat} measurements."
+    end
+
+    difference = "\taverage difference" if @execs.length == 2
+    total_difference = 0
+
+    output "name\t#{@execs.map{|(e, v)| v}.join("\t")}#{difference}"
+    @results.each{|v, result|
+      rets = []
+      s = nil
+      result.each_with_index{|e, i|
+        r = e.min
+        case v
+        when /^vm1_/
+          if @loop_wl1
+            r -= @loop_wl1[i]
+            s = '*'
+          end
+        when /^vm2_/
+          if @loop_wl2
+            r -= @loop_wl2[i]
+            s = '*'
+          end
+        end
+        rets << sprintf("%.3f", r)
+      }
+
+      if difference
+        diff = average(result.last) - average(result.first)
+        total_difference += diff
+        rets << sprintf("%.3f", diff)
+      end
+
+      output "#{v}#{s}\t#{rets.join("\t")}"
+    }
+
+    if difference and @verbose
+      output '-----------------------------------------------------------'
+      output "average total difference is #{total_difference}"
+    end
+  end
+
+  def files
+    flag = {}
+    vm1 = vm2 = wl1 = wl2 = false
+    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+      next if @pattern && /#{@pattern}/ !~ File.basename(file)
+      case file
+      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+        flag[$1] = true
+      end
+      file
+    }.compact
+
+    if flag['vm1'] && !flag['whileloop']
+      @files << File.join(@dir, 'bm_loop_whileloop.rb')
+    elsif flag['vm2'] && !flag['whileloop2']
+      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+    end
+
+    @files.sort!
+    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+    @files
+  end
+
+  def run
+    files.each_with_index{|file, i|
+      @i = i
+      r = measure_file(file)
+
+      if /bm_loop_whileloop.rb/ =~ file
+        @loop_wl1 = r[1].map{|e| e.min}
+      elsif /bm_loop_whileloop2.rb/ =~ file
+        @loop_wl2 = r[1].map{|e| e.min}
+      end
+    }
+  end
+
+  def measure_file file
+    name = File.basename(file, '.rb').sub(/^bm_/, '')
+    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+    load prepare_file if FileTest.exist?(prepare_file)
+
+    if @verbose
+      output
+      output '-----------------------------------------------------------'
+      output name
+      output
+      output File.read(file)
+      output
+    end
+
+    result = [name]
+    result << @execs.map{|(e, v)|
+      (0...@repeat).map{
+        message_print "#{v}\t"
+        progress_message '.'
+
+        m = measure(e, file)
+        message "#{m}"
+        m
+      }
+    }
+    @results << result
+    result
+  end
+
+  def measure executable, file
+    cmd = "#{executable} #{file}"
+    m = Benchmark.measure{
+      `#{cmd}`
+    }
+
+    if $? != 0
+      raise "\`#{cmd}\' exited with abnormal status (#{$?})"
+    end
+
+    m.real
+  end
+end
+
+if __FILE__ == $0
+  opt = {
+    :execs => ['ruby'],
+    :dir => './',
+    :repeat => 1,
+    :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}",
+  }
+
+  parser = OptionParser.new{|o|
+    o.on('-e', '--executables [EXECS]',
+         "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e|
+      opt[:execs] = e.split(/;/)
+    }
+    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+      opt[:dir] = d
+    }
+    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+      opt[:pattern] = p
+    }
+    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+      opt[:repeat] = n.to_i
+    }
+    o.on('-o', '--output-file [FILE]', "Output file"){|o|
+      opt[:output] = o
+    }
+    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+      opt[:quiet] = q
+    }
+    o.on('-v', '--verbose'){|v|
+      opt[:verbose] = v
+    }
+  }
+
+  parser.parse!(ARGV)
+  BenchmarkDriver.benchmark(opt)
+end
+
diff --git a/ruby_1_9_3/benchmark/make_fasta_output.rb b/ruby_1_9_3/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/ruby_1_9_3/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/ruby_1_9_3/benchmark/other-lang/ack.pl b/ruby_1_9_3/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+		    : Ack($_[0]-1, 1))
+	: $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/ruby_1_9_3/benchmark/other-lang/ack.py b/ruby_1_9_3/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+    if (not M):
+        return( N + 1 )
+    if (not N):
+        return( Ack(M-1, 1) )
+    return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+    NUM = 9
+    sys.setrecursionlimit(10000)
+    Ack(3, NUM)
+
+main()
diff --git a/ruby_1_9_3/benchmark/other-lang/ack.rb b/ruby_1_9_3/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/ruby_1_9_3/benchmark/other-lang/ack.scm b/ruby_1_9_3/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+  (cond ((zero? m) (+ n 1))
+	((zero? n) (ack (- m 1) 1))
+	(else      (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/ruby_1_9_3/benchmark/other-lang/eval.rb b/ruby_1_9_3/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+  loop
+  ack
+  fib
+  tak
+  fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+  ruby-cyg
+  ../../../test6/miniruby
+  perl
+  python
+  gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+  .rb
+  .rb
+  .pl
+  .py
+  .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+  m = Benchmark.measure{
+    #p cmd
+    system(cmd)
+  }
+  [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+  r = []
+  Lang.each_with_index{|l, idx|
+    cmd = "#{l} #{b}#{Ext[idx]}"
+    r << bench(cmd)
+  }
+  Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/ruby_1_9_3/benchmark/other-lang/fact.pl b/ruby_1_9_3/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+  my $n = @_[0];
+  if($n < 2){
+    return 1;
+  }
+  else{
+    return $n * fact($n-1);
+  }
+}
+
+for($i=0; $i<10000; $i++){
+  &fact(100);
+}
diff --git a/ruby_1_9_3/benchmark/other-lang/fact.py b/ruby_1_9_3/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..01593965d9
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+	r = 1
+	for x in range(2, n):
+		r *= x
+	return r
+
+def factR(n):
+	if n < 2:
+		return 1
+	else:
+		return n * factR(n-1)
+
+for i in range(10000):
+	factR(100)
+
diff --git a/ruby_1_9_3/benchmark/other-lang/fact.rb b/ruby_1_9_3/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..7e97b22b39
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+  if n < 2
+    1
+  else
+    n * fact(n-1)
+  end
+end
+
+i=0
+while i<10000
+  i+=1
+  fact(100)
+end
diff --git a/ruby_1_9_3/benchmark/other-lang/fact.scm b/ruby_1_9_3/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+        (if (< n 2)
+            1
+          (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+  (fact 100))
+
diff --git a/ruby_1_9_3/benchmark/other-lang/fib.pl b/ruby_1_9_3/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+  my $n = $_[0];
+  if($n < 3){
+    return 1;
+  }
+  else{
+    return fib($n-1) + fib($n-2);
+  }
+};
+
+&fib(34);
diff --git a/ruby_1_9_3/benchmark/other-lang/fib.py b/ruby_1_9_3/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+  if n < 3:
+    return 1
+  else:
+    return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/ruby_1_9_3/benchmark/other-lang/fib.rb b/ruby_1_9_3/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
diff --git a/ruby_1_9_3/benchmark/other-lang/fib.scm b/ruby_1_9_3/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+        (if (< n 3)
+            1
+          (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/ruby_1_9_3/benchmark/other-lang/loop.pl b/ruby_1_9_3/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/ruby_1_9_3/benchmark/other-lang/loop.py b/ruby_1_9_3/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+	pass
diff --git a/ruby_1_9_3/benchmark/other-lang/loop.rb b/ruby_1_9_3/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..d43cef61f3
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i=0
+while i<30000000
+  i+=1
+end
diff --git a/ruby_1_9_3/benchmark/other-lang/loop.scm b/ruby_1_9_3/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/ruby_1_9_3/benchmark/other-lang/loop2.rb b/ruby_1_9_3/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/ruby_1_9_3/benchmark/other-lang/tak.pl b/ruby_1_9_3/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+    local($x, $y, $z) = @_;
+    if (!($y < $x)) {
+	return $z;
+    } else {
+	return &tak(&tak($x - 1, $y, $z),
+		    &tak($y - 1, $z, $x),
+		    &tak($z - 1, $x, $y));
+    }
+}
+&tak(18, 9, 0);
diff --git a/ruby_1_9_3/benchmark/other-lang/tak.py b/ruby_1_9_3/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+	if not(y<x):
+		return z
+	else:
+		return tak(tak(x-1, y, z),
+		           tak(y-1, z, x),
+		           tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/ruby_1_9_3/benchmark/other-lang/tak.rb b/ruby_1_9_3/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/ruby_1_9_3/benchmark/other-lang/tak.scm b/ruby_1_9_3/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/ruby_1_9_3/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+        (if (not (< y x))
+            z
+          (tak (tak (- x 1) y z)
+               (tak (- y 1) z x)
+               (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/ruby_1_9_3/benchmark/prepare_so_count_words.rb b/ruby_1_9_3/benchmark/prepare_so_count_words.rb
new file mode 100644
index 0000000000..ee2138cdb2
--- /dev/null
+++ b/ruby_1_9_3/benchmark/prepare_so_count_words.rb
@@ -0,0 +1,15 @@
+# prepare 'wc.input'
+
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
diff --git a/ruby_1_9_3/benchmark/prepare_so_k_nucleotide.rb b/ruby_1_9_3/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..f28f4460a1
--- /dev/null
+++ b/ruby_1_9_3/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require File.join(File.dirname(__FILE__), 'make_fasta_output')
+prepare_fasta_output(100_000)
diff --git a/ruby_1_9_3/benchmark/prepare_so_reverse_complement.rb b/ruby_1_9_3/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..7f089109de
--- /dev/null
+++ b/ruby_1_9_3/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require File.join(File.dirname(__FILE__), 'make_fasta_output')
+prepare_fasta_output(2_500_000)
diff --git a/ruby_1_9_3/benchmark/report.rb b/ruby_1_9_3/benchmark/report.rb
new file mode 100644
index 0000000000..d2dc56b1e1
--- /dev/null
+++ b/ruby_1_9_3/benchmark/report.rb
@@ -0,0 +1,79 @@
+#
+# YARV benchmark driver
+#
+
+require 'yarvutil'
+require 'benchmark'
+require 'rbconfig'
+
+def exec_command type, file, w
+  <<-EOP
+  $DRIVER_PATH = '#{File.dirname($0)}'
+  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
+  require 'benchmark'
+  require 'yarvutil'
+#  print '#{type}'
+  begin
+    puts Benchmark.measure{
+      #{w}('#{file}')
+    }.utime
+  rescue Exception => exec_command_error_variable
+    puts "\t" + exec_command_error_variable.message
+  end
+  EOP
+end
+
+def benchmark cmd
+  rubybin = ENV['RUBY'] || RbConfig.ruby
+
+  IO.popen(rubybin, 'r+'){|io|
+    io.write cmd
+    io.close_write
+    return io.gets
+  }
+end
+
+def ruby_exec file
+  prog = exec_command 'ruby', file, 'load'
+  benchmark prog
+end
+
+def yarv_exec file
+  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
+  benchmark prog
+end
+
+$wr = $wy = nil
+
+def measure bench
+  file = File.dirname($0) + "/bm_#{bench}.rb"
+  r = ruby_exec(file).to_f
+  y = yarv_exec(file).to_f
+  puts "#{bench}\t#{r}\t#{y}"
+end
+
+def measure2
+  r = ruby_exec.to_f
+  y = yarv_exec.to_f
+  puts r/y
+end
+
+if $0 == __FILE__
+  %w{
+    whileloop
+    whileloop2
+    times
+    const
+    method
+    poly_method
+    block
+    rescue
+    rescue2
+  }.each{|bench|
+    measure bench
+  }
+end
+
+
+
+
diff --git a/ruby_1_9_3/benchmark/run.rb b/ruby_1_9_3/benchmark/run.rb
new file mode 100644
index 0000000000..0cd2363849
--- /dev/null
+++ b/ruby_1_9_3/benchmark/run.rb
@@ -0,0 +1,127 @@
+#
+# Ruby benchmark driver
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$matzrubyonly = false
+$rubyonly = false
+
+$results  = []
+
+# prepare 'wc.input'
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
+
+def bm file
+  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
+  return if prog.empty?
+
+  /[a-z]+_(.+)\.rb/ =~ file
+  bm_name = $1
+  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
+  puts "#{bm_name}: "
+
+
+puts <<EOS unless $matzrubyonly || $rubyonly
+#{prog}
+--
+EOS
+  begin
+    result = [bm_name]
+    result << matzruby_exec(file) unless $rubyonly
+    result << ruby_exec(file) unless $matzrubyonly
+    $results << result
+
+  rescue Exception => e
+    puts
+    puts "** benchmark failure: #{e}"
+    puts e.backtrace
+  end
+end
+
+def benchmark file, bin
+  m = Benchmark.measure{
+    `#{bin} #{$opts} #{file}`
+  }
+  sec = '%.3f' % m.real
+  puts " #{sec}"
+  sec
+end
+
+def ruby_exec file
+  print 'ruby'
+  benchmark file, $ruby_program
+end
+
+def matzruby_exec file
+  print 'matz'
+  rubylib = ENV['RUBYLIB']
+  ENV['RUBYLIB'] = ''
+  r = benchmark file, $matzruby_program
+  ENV['RUBYLIB'] = rubylib
+  r
+end
+
+if $0 == __FILE__
+  ARGV.each{|arg|
+    case arg
+    when /\A--ruby=(.+)/
+      $ruby_program = $1
+    when /\A--matzruby=(.+)/
+      $matzruby_program = $1
+    when /\A--opts=(.+)/
+      $opts = $1
+    when /\A(-r|--only-ruby)\z/
+      $rubyonly = true
+    when /\A(-m|--only-matzruby)\z/
+      $matzrubyonly = true
+    end
+  }
+  ARGV.delete_if{|arg|
+    /\A-/ =~ arg
+  }
+
+  puts "MatzRuby:"
+  system("#{$matzruby_program} -v")
+  puts "Ruby:"
+  system("#{$ruby_program} -v")
+  puts
+
+  if ARGV.empty?
+    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
+      bm file
+    }
+  else
+    ARGV.each{|file|
+      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
+        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
+        bm ef
+      }
+    }
+  end
+
+  puts
+  puts "-- benchmark summary ---------------------------"
+  $results.each{|res|
+    print res.shift, "\t"
+    (res||[]).each{|result|
+      /([\d\.]+)/ =~ result
+      print $1 + "\t" if $1
+    }
+    puts
+  }
+end
+
diff --git a/ruby_1_9_3/benchmark/runc.rb b/ruby_1_9_3/benchmark/runc.rb
new file mode 100644
index 0000000000..97c5cef045
--- /dev/null
+++ b/ruby_1_9_3/benchmark/runc.rb
@@ -0,0 +1,27 @@
+#
+#
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$rubybin = ENV['RUBY'] || RbConfig.ruby
+
+def runfile file
+  puts file
+  file = File.join(File.dirname($0), 'contrib', file)
+  Benchmark.bm{|x|
+    x.report('ruby'){
+      system("#{$rubybin} #{file}")
+    }
+    x.report('yarv'){
+      system("#{$rubybin} -rite -I.. #{file}")
+    }
+  }
+end
+
+ARGV.each{|file|
+  runfile file
+}
+
+
diff --git a/ruby_1_9_3/benchmark/wc.input.base b/ruby_1_9_3/benchmark/wc.input.base
new file mode 100644
index 0000000000..41143fbac0
--- /dev/null
+++ b/ruby_1_9_3/benchmark/wc.input.base
@@ -0,0 +1,25 @@
+Subject:      Re: Who was Izchak Miller?
+From:         "Jane D. Anonymous" <nobody@yale.edu>
+Date:         1996/04/28
+Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+To:           75176.2330@compuserve.com
+Content-Type: text/plain; charset=us-ascii
+Organization: Yale University
+X-Url:        news:4lk6vl$gde@ns.oar.net
+Mime-Version: 1.0
+Newsgroups:   rec.games.roguelike.nethack
+X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+Hello there, Izchak Miller was my father.  When I was younger I spent 
+many a night, hunched over the keyboard with a cup of tea, playing 
+nethack with him and my brother.  my dad was a philosopher with a strong 
+weakness for fantasy/sci fi.  I remember when he started to get involved 
+with the Nethack team- my brother's Dungeons and Dragons monster book 
+found a regular place beside my dad's desk. it's nice to see him living 
+on in the game he loved so much :-).  
+                                                                  Tamar Miller
+
+The following is a really long word of 5000 characters:
+
+wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
author	usa <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>	2013-05-14 11:27:23 +0000
committer	usa <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>	2013-05-14 11:27:23 +0000
commit	aa6e98139c8e1ea442fb2182341aaa08ff55b529 (patch)
tree	a509eb830418991995bfe3b840d4bf270ff7f0e2 /ruby_1_9_3/benchmark
parent	9e9d191cf367caa17776231a2d0fad0da47b160a (diff)