diff options
author | nobu <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> | 2007-11-16 01:30:29 +0000 |
---|---|---|
committer | nobu <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e> | 2007-11-16 01:30:29 +0000 |
commit | 75feee0968c9345e7ffd2bda9835fcd60b4c0880 (patch) | |
tree | fa4216d535d8b5dcc45f39c19c64385172e710bf /benchmark | |
parent | 501407d3af04a2a7c4b4d49168d512fb89327b6b (diff) |
* set eol-style.
git-svn-id: svn+ssh://ci.ruby-lang.org/ruby/trunk@13944 b2dd03c8-39d4-4d8f-98ff-823fe69b080e
Diffstat (limited to 'benchmark')
25 files changed, 1644 insertions, 1644 deletions
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb index c4fcfac887..e58b7a34a1 100644 --- a/benchmark/bm_app_erb.rb +++ b/benchmark/bm_app_erb.rb @@ -1,26 +1,26 @@ -#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 5_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
+# +# Create many HTML strings with ERB. +# + +require 'erb' + +data = DATA.read +max = 5_000 +title = "hello world!" +content = "hello world!\n" * 10 + +max.times{ + ERB.new(data).result(binding) +} + +__END__ + +<html> + <head> <%= title %> </head> + <body> + <h1> <%= title %> </h1> + <p> + <%= content %> + </p> + </body> +</html> diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb index 49fe5a81a8..586edfd5dc 100644 --- a/benchmark/bm_app_uri.rb +++ b/benchmark/bm_app_uri.rb @@ -1,8 +1,8 @@ -require 'uri'
-
-100_000.times{
- uri = URI.parse('http://www.ruby-lang.org')
- uri.scheme
- uri.host
- uri.port
-}
+require 'uri' + +100_000.times{ + uri = URI.parse('http://www.ruby-lang.org') + uri.scheme + uri.host + uri.port +} diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb index db4e4dedd2..7adbe9ea5e 100644 --- a/benchmark/bm_io_file_create.rb +++ b/benchmark/bm_io_file_create.rb @@ -1,13 +1,13 @@ -#
-# Create files
-#
-
-max = 50_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
- f = open(file, 'w')
- f.close#(true)
-}
-File.unlink(file)
-
+# +# Create files +# + +max = 50_000 +file = './tmpfile_of_bm_io_file_create' + +max.times{ + f = open(file, 'w') + f.close#(true) +} +File.unlink(file) + diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb index 488a4e90ad..2b4212db76 100644 --- a/benchmark/bm_io_file_read.rb +++ b/benchmark/bm_io_file_read.rb @@ -1,15 +1,15 @@ -#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 20_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
- f.seek 0
- f.read
-}
+# +# Seek and Read file. +# + +require 'tempfile' + +max = 20_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') +f.write str + +max.times{ + f.seek 0 + f.read +} diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb index 05c7e7e45e..3cec58c6ae 100644 --- a/benchmark/bm_io_file_write.rb +++ b/benchmark/bm_io_file_write.rb @@ -1,14 +1,14 @@ -#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 20_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
- f.seek 0
- f.write str
-}
+# +# Seek and Write file. +# + +require 'tempfile' + +max = 20_000 +str = "Hello world! " * 1000 +f = Tempfile.new('yarv-benchmark') + +max.times{ + f.seek 0 + f.write str +} diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb index 138c5290f5..6a26465578 100644 --- a/benchmark/bm_so_binary_trees.rb +++ b/benchmark/bm_so_binary_trees.rb @@ -1,57 +1,57 @@ -# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-def STDOUT.write_ *args
-end
-
-def item_check(tree)
- if tree[0] == nil
- tree[1]
- else
- tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
- item_item = 2 * item
- depth -= 1
- [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
- [nil, item, nil]
- end
-end
-
-max_depth = 12 # 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
- temp_tree = bottom_up_tree(i, depth)
- check += item_check(temp_tree)
-
- temp_tree = bottom_up_tree(-i, depth)
- check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+# The Computer Language Shootout Benchmarks +# http://shootout.alioth.debian.org +# +# contributed by Jesse Millikan + +# disable output +def STDOUT.write_ *args +end + +def item_check(tree) + if tree[0] == nil + tree[1] + else + tree[1] + item_check(tree[0]) - item_check(tree[2]) + end +end + +def bottom_up_tree(item, depth) + if depth > 0 + item_item = 2 * item + depth -= 1 + [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)] + else + [nil, item, nil] + end +end + +max_depth = 12 # 16 # ARGV[0].to_i +min_depth = 4 + +max_depth = min_depth + 2 if min_depth + 2 > max_depth + +stretch_depth = max_depth + 1 +stretch_tree = bottom_up_tree(0, stretch_depth) + +puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}" +stretch_tree = nil + +long_lived_tree = bottom_up_tree(0, max_depth) + +min_depth.step(max_depth + 1, 2) do |depth| + iterations = 2**(max_depth - depth + min_depth) + + check = 0 + + for i in 1..iterations + temp_tree = bottom_up_tree(i, depth) + check += item_check(temp_tree) + + temp_tree = bottom_up_tree(-i, depth) + check += item_check(temp_tree) + end + + puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}" +end + +puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}" diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb index 23298a8a31..a214f2e205 100644 --- a/benchmark/bm_so_fannkuch.rb +++ b/benchmark/bm_so_fannkuch.rb @@ -1,45 +1,45 @@ -# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
- maxFlips, m, r, check = 0, n-1, n, 0
- count = (1..n).to_a
- perm = (1..n).to_a
-
- while true
- if check < 30
- puts "#{perm}"
- check += 1
- end
-
- while r != 1
- count[r-1] = r
- r -= 1
- end
-
- if perm[0] != 1 and perm[m] != n
- perml = perm.clone #.dup
- flips = 0
- while (k = perml.first ) != 1
- perml = perml.slice!(0, k).reverse + perml
- flips += 1
- end
- maxFlips = flips if flips > maxFlips
- end
- while true
- if r==n then return maxFlips end
- perm.insert r,perm.shift
- break if (count[r] -= 1) > 0
- r += 1
- end
- end
-end
-
-def puts *args
-end
-
-N = 10 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
+# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura +# Modified by Ryan Williams + +def fannkuch(n) + maxFlips, m, r, check = 0, n-1, n, 0 + count = (1..n).to_a + perm = (1..n).to_a + + while true + if check < 30 + puts "#{perm}" + check += 1 + end + + while r != 1 + count[r-1] = r + r -= 1 + end + + if perm[0] != 1 and perm[m] != n + perml = perm.clone #.dup + flips = 0 + while (k = perml.first ) != 1 + perml = perml.slice!(0, k).reverse + perml + flips += 1 + end + maxFlips = flips if flips > maxFlips + end + while true + if r==n then return maxFlips end + perm.insert r,perm.shift + break if (count[r] -= 1) > 0 + r += 1 + end + end +end + +def puts *args +end + +N = 10 # (ARGV[0] || 1).to_i +puts "Pfannkuchen(#{N}) = #{fannkuch(N)}" + diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb index b95f5e9f10..3f759ba7ae 100644 --- a/benchmark/bm_so_fasta.rb +++ b/benchmark/bm_so_fasta.rb @@ -1,81 +1,81 @@ -# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
+# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +$last = 42.0 +def gen_random (max,im=139968,ia=3877,ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im +end + +alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + +iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], +] +homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], +] + +def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) +end + +def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end +end + + +n = (ARGV[0] or 250_000).to_i + +make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) +make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) +make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb index c0a5ba5046..dadab3e79c 100644 --- a/benchmark/bm_so_k_nucleotide.rb +++ b/benchmark/bm_so_k_nucleotide.rb @@ -1,48 +1,48 @@ -# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
+# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# contributed by jose fco. gonzalez +# modified by Sokolov Yura + +seq = String.new + +def frecuency( seq,length ) + n, table = seq.length - length + 1, Hash.new(0) + f, i = nil, nil + (0 ... length).each do |f| + (f ... n).step(length) do |i| + table[seq[i,length]] += 1 + end + end + [n,table] + +end + +def sort_by_freq( seq,length ) + n,table = frecuency( seq,length ) + a, b, v = nil, nil, nil + table.sort{|a,b| b[1] <=> a[1]}.each do |v| + puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] + end + puts +end + +def find_seq( seq,s ) + n,table = frecuency( seq,s.length ) + puts "#{table[s].to_s}\t#{s.upcase}" +end + +input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') + +line = input.gets while line !~ /^>THREE/ +line = input.gets + +while (line !~ /^>/) & line do + seq << line.chomp + line = input.gets +end + +[1,2].each {|i| sort_by_freq( seq,i ) } + +%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } + diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb index 2c05878863..76331c64b8 100644 --- a/benchmark/bm_so_mandelbrot.rb +++ b/benchmark/bm_so_mandelbrot.rb @@ -1,57 +1,57 @@ -# The Computer Language Benchmarks Game
-# http://shootout.alioth.debian.org/
-#
-# contributed by Karl von Laudermann
-# modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49 # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1 # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
- for x in 0..count_size
- zr = 0.0
- zi = 0.0
- cr = (2.0*x/size)-1.5
- ci = (2.0*y/size)-1.0
- escape = false
-
- # To make use of the for..in code, we use a dummy variable,
- # like one would in C
- for dummy in 0..ITER
- tr = zr*zr - zi*zi + cr
- ti = 2*zr*zi + ci
- zr, zi = tr, ti
-
- if (zr*zr+zi*zi) > LIMIT_SQUARED
- escape = true
- break
- end
- end
-
- byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
- bit_num += 1
-
- # Code is very similar for these cases, but using separate blocks
- # ensures we skip the shifting when it's unnecessary, which is most cases.
- if (bit_num == 8)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- elsif (x == count_size)
- byte_acc <<= (8 - bit_num)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- end
- end
-end
+# The Computer Language Benchmarks Game +# http://shootout.alioth.debian.org/ +# +# contributed by Karl von Laudermann +# modified by Jeremy Echols + +size = 600 # ARGV[0].to_i + +puts "P4\n#{size} #{size}" + +ITER = 49 # Iterations - 1 for easy for..in looping +LIMIT_SQUARED = 4.0 # Presquared limit + +byte_acc = 0 +bit_num = 0 + +count_size = size - 1 # Precomputed size for easy for..in looping + +# For..in loops are faster than .upto, .downto, .times, etc. +for y in 0..count_size + for x in 0..count_size + zr = 0.0 + zi = 0.0 + cr = (2.0*x/size)-1.5 + ci = (2.0*y/size)-1.0 + escape = false + + # To make use of the for..in code, we use a dummy variable, + # like one would in C + for dummy in 0..ITER + tr = zr*zr - zi*zi + cr + ti = 2*zr*zi + ci + zr, zi = tr, ti + + if (zr*zr+zi*zi) > LIMIT_SQUARED + escape = true + break + end + end + + byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1) + bit_num += 1 + + # Code is very similar for these cases, but using separate blocks + # ensures we skip the shifting when it's unnecessary, which is most cases. + if (bit_num == 8) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + elsif (x == count_size) + byte_acc <<= (8 - bit_num) + print byte_acc.chr + byte_acc = 0 + bit_num = 0 + end + end +end diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb index 5dd720c340..30b99715af 100644 --- a/benchmark/bm_so_meteor_contest.rb +++ b/benchmark/bm_so_meteor_contest.rb @@ -1,564 +1,564 @@ -#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is illegal at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values ( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop accross the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the curent row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # follwing reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is acheived via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
+#!/usr/bin/env ruby +# +# The Computer Language Shootout +# http://shootout.alioth.debian.org +# contributed by Kevin Barnes (Ruby novice) + +# PROGRAM: the main body is at the bottom. +# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# 2) see how I represent a board as a bitmask by reading the blank_board comments +# 3) read as your mental paths take you + +def print *args +end + +# class to represent all information about a particular rotation of a particular piece +class Rotation + # an array (by location) containing a bit mask for how the piece maps at the given location. + # if the rotation is illegal at that location the mask will contain false + attr_reader :start_masks + + # maps a direction to a relative location. these differ depending on whether it is an even or + # odd row being mapped from + @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 } + @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 } + + def initialize( directions ) + @even_offsets, @odd_offsets = normalize_offsets( get_values( directions )) + + @even_mask = mask_for_offsets( @even_offsets) + @odd_mask = mask_for_offsets( @odd_offsets) + + @start_masks = Array.new(60) + + # create the rotational masks by placing the base mask at the location and seeing if + # 1) it overlaps the boundries and 2) it produces a prunable board. if either of these + # is true the piece cannot be placed + 0.upto(59) do | offset | + mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset) + if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then + imask = compute_required( mask, offset) + @start_masks[offset] = [ mask, imask, imask | mask ] + else + @start_masks[offset] = false + end + end + end + + def compute_required( mask, offset ) + board = blank_board + 0.upto(offset) { | i | board |= 1 << i } + board |= mask + return 0 if (!prunable(board | mask, offset)) + board = flood_fill(board,58) + count = 0 + imask = 0 + 0.upto(59) do | i | + if (board[i] == 0) then + imask |= (1 << i) + count += 1 + end + end + (count > 0 && count < 5) ? imask : 0 + end + + def flood_fill( board, location) + return board if (board[location] == 1) + board |= 1 << location + row, col = location.divmod(6) + board = flood_fill( board, location - 1) if (col > 0) + board = flood_fill( board, location + 1) if (col < 4) + if (row % 2 == 0) then + board = flood_fill( board, location - 7) if (col > 0 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 5) if (col > 0 && row < 9) + else + board = flood_fill( board, location - 5) if (col < 4 && row > 0) + board = flood_fill( board, location - 6) if (row > 0) + board = flood_fill( board, location + 6) if (row < 9) + board = flood_fill( board, location + 7) if (col < 4 && row < 9) + end + board + end + + # given a location, produces a list of relative locations covered by the piece at this rotation + def offsets( location) + if is_even( location) then + @even_offsets.collect { | value | value + location } + else + @odd_offsets.collect { | value | value + location } + end + end + + # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows) + # this is hard to explain. imagine we have this partial board: + # 0 0 0 0 0 x [positions 0-5] + # 0 0 1 1 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 1 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # The top-left of the piece is at position 8, the + # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that + # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained + # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row: + # 0 0 0 1 1 x [positions 0-5] + # 0 0 1 0 0 x [positions 6-11] + # 0 0 1 0 0 x [positions 12-17] + # 0 1 0 0 0 x [positions 18-23] + # 0 0 0 0 0 x [positions 24-29] + # 0 0 0 0 0 x [positions 30-35] + # ... + # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the + # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what + # this function would return + def normalize_offsets( values) + min = values.min + even_min = is_even(min) + other_min = even_min ? min + 6 : min + 7 + other_values = values.collect do | value | + if is_even(value) then + value + 6 - other_min + else + value + 7 - other_min + end + end + values.collect! { | value | value - min } + + if even_min then + [values, other_values] + else + [other_values, values] + end + end + + # produce a bitmask representation of an array of offset locations + def mask_for_offsets( offsets ) + mask = 0 + offsets.each { | value | mask = mask + ( 1 << value ) } + mask + end + + # finds a "safe" position that a position as described by a list of directions can be placed + # without falling off any edge of the board. the values returned a location to place the first piece + # at so it will fit after making the described moves + def start_adjust( directions ) + south = east = 0; + directions.each do | direction | + east += 1 if ( direction == :sw || direction == :nw || direction == :west ) + south += 1 if ( direction == :nw || direction == :ne ) + end + south * 6 + east + end + + # given a set of directions places the piece (as defined by a set of directions) on the board at + # a location that will not take it off the edge + def get_values ( directions ) + start = start_adjust(directions) + values = [ start ] + directions.each do | direction | + if (start % 12 >= 6) then + start += @@rotation_odd_adder[direction] + else + start += @@rotation_even_adder[direction] + end + values += [ start ] + end + + # some moves take you back to an existing location, we'll strip duplicates + values.uniq + end +end + +# describes a piece and caches information about its rotations to as to be efficient for iteration +# ATTRIBUTES: +# rotations -- all the rotations of the piece +# type -- a numeic "name" of the piece +# masks -- an array by location of all legal rotational masks (a n inner array) for that location +# placed -- the mask that this piece was last placed at (not a location, but the actual mask used) +class Piece + attr_reader :rotations, :type, :masks + attr_accessor :placed + + # transform hashes that change one direction into another when you either flip or rotate a set of directions + @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne } + @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw } + + def initialize( directions, type ) + @type = type + @rotations = Array.new(); + @map = {} + + generate_rotations( directions ) + directions.collect! { | value | @@flip_converter[value] } + generate_rotations( directions ) + + # creates the masks AND a map that returns [location, rotation] for any given mask + # this is used when a board is found and we want to draw it, otherwise the map is unused + @masks = Array.new(); + 0.upto(59) do | i | + even = true + @masks[i] = @rotations.collect do | rotation | + mask = rotation.start_masks[i] + @map[mask[0]] = [ i, rotation ] if (mask) + mask || nil + end + @masks[i].compact! + end + end + + # rotates a set of directions through all six angles and adds a Rotation to the list for each one + def generate_rotations( directions ) + 6.times do + rotations.push( Rotation.new(directions)) + directions.collect! { | value | @@rotate_converter[value] } + end + end + + # given a board string, adds this piece to the board at whatever location/rotation + # important: the outbound board string is 5 wide, the normal location notation is six wide (padded) + def fill_string( board_string) + location, rotation = @map[@placed] + rotation.offsets(location).each do | offset | + row, col = offset.divmod(6) + board_string[ row*5 + col, 1 ] = @type.to_s + end + end +end + +# a blank bit board having this form: +# +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 0 0 0 0 0 1 +# 1 1 1 1 1 1 +# +# where left lest significant bit is the top left and the most significant is the lower right +# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running +# off the edges or bottom +def blank_board + 0b111111100000100000100000100000100000100000100000100000100000100000 +end + +def full_board + 0b111111111111111111111111111111111111111111111111111111111111111111 +end + +# determines if a location (bit position) is in an even row +def is_even( location) + (location % 12) < 6 +end + +# support function that create three utility maps: +# $converter -- for each row an array that maps a five bit row (via array mapping) +# to the a a five bit representation of the bits below it +# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row +# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays +# a region array has three values the first is a mask of bits in the region, +# the second is the count of those bits and the third is identical to the first +# examples: +# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001] +# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001] +# 0b10001 => [ 0b01110, 3, 0b01110 ] +def create_collector_support + odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000] + even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000] + + all_odds = Array.new(0b100000) + all_evens = Array.new(0b100000) + bit_counts = Array.new(0b100000) + new_regions = Array.new(0b100000) + 0.upto(0b11111) do | i | + bit_count = odd = even = 0 + 0.upto(4) do | bit | + if (i[bit] == 1) then + bit_count += 1 + odd |= odd_map[bit] + even |= even_map[bit] + end + end + all_odds[i] = odd + all_evens[i] = even + bit_counts[i] = bit_count + new_regions[i] = create_regions( i) + end + + $converter = [] + 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) } + $bit_counts = bit_counts + $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } } +end + +# determines if a board is punable, meaning that there is no possibility that it +# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces +# that are not a multiple of five. The following board is an example of a prunable board: +# 0 0 1 0 0 +# 0 1 0 0 0 +# 1 1 0 0 0 +# 0 1 0 0 0 +# 0 0 0 0 0 +# ... +# +# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it +# parameters: +# board -- an initial bit board (6 bit padded rows, see blank_board for format) +# location -- starting location, everything above and to the left is already full +# slotting -- set to true only when testing initial pieces, when filling normally +# additional assumptions are possible +# +# Algorithm: +# The algorithm starts at the top row (as determined by location) and iterates a row at a time +# maintainng counts of active open areas (kept in the collector array) each collector contains +# three values at the start of an iteration: +# 0: mask of bits that would be adjacent to the collector in this row +# 1: the number of bits collected so far +# 2: a scratch space starting as zero, but used during the computation to represent +# the empty bits in the new row that are adjacent (position 0) +# The exact procedure is described in-code +def prunable( board, location, slotting = false) + collectors = [] + # loop accross the rows + (location / 6).to_i.upto(9) do | row_on | + # obtain a set of regions representing the bits of the curent row. + regions = $regions[(board >> (row_on * 6)) & 0b11111] + converter = $converter[row_on] + + # track the number of collectors at the start of the cycle so that + # we don't compute against newly created collectors, only existing collectors + initial_collector_count = collectors.length + + # loop against the regions. For each region of the row + # we will see if it connects to one or more existing collectors. + # if it connects to 1 collector, the bits from the region are added to the + # bits of the collector and the mask is placed in collector[2] + # If the region overlaps more than one collector then all the collectors + # it overlaps with are merged into the first one (the others are set to nil in the array) + # if NO collectors are found then the region is copied as a new collector + regions.each do | region | + collector_found = nil + region_mask = region[2] + initial_collector_count.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + collector_mask = collector[0] + if (collector_mask & region_mask != 0) then + if (collector_found) then + collector_found[0] |= collector_mask + collector_found[1] += collector[1] + collector_found[2] |= collector[2] + collectors[collector_num] = nil + else + collector_found = collector + collector[1] += region[1] + collector[2] |= region_mask + end + end + end + end + if (collector_found == nil) then + collectors.push(Array.new(region)) + end + end + + # check the existing collectors, if any collector overlapped no bits in the region its [2] value will + # be zero. The size of any such reaason is tested if it is not a muliple of five true is returned since + # the board is prunable. if it is a multiple of five it is removed. + # Collector that are still active have a new adjacent value [0] set based n the matched bits + # and have [2] cleared out for the next cycle. + collectors.length.times do | collector_num | + collector = collectors[collector_num] + if (collector) then + if (collector[2] == 0) then + return true if (collector[1] % 5 != 0) + collectors[collector_num] = nil + else + # if a collector matches all bits in the row then we can return unprunable early for the + # follwing reasons: + # 1) there can be no more unavailable bits bince we fill from the top left downward + # 2) all previous regions have been closed or joined so only this region can fail + # 3) this region must be good since there can never be only 1 region that is nuot + # a multiple of five + # this rule only applies when filling normally, so we ignore the rule if we are "slotting" + # in pieces to see what configurations work for them (the only other time this algorithm is used). + return false if (collector[2] == 0b11111 && !slotting) + collector[0] = converter[collector[2]] + collector[2] = 0 + end + end + end + + # get rid of all the empty converters for the next round + collectors.compact! + end + return false if (collectors.length <= 1) # 1 collector or less and the region is fine + collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size +end + +# creates a region given a row mask. see prunable for what a "region" is +def create_regions( value ) + regions = [] + cur_region = 0 + 5.times do | bit | + if (value[bit] == 0) then + cur_region |= 1 << bit + else + if (cur_region != 0 ) then + regions.push( cur_region) + cur_region = 0; + end + end + end + regions.push(cur_region) if (cur_region != 0) + regions +end + +# find up to the counted number of solutions (or all solutions) and prints the final result +def find_all + find_top( 1) + find_top( 0) + print_results +end + +# show the board +def print_results + print "#{@boards_found} solutions found\n\n" + print_full_board( @min_board) + print "\n" + print_full_board( @max_board) + print "\n" +end + +# finds solutions. This special version of the main function is only used for the top level +# the reason for it is basically to force a particular ordering on how the rotations are tested for +# the first piece. It is called twice, first looking for placements of the odd rotations and then +# looking for placements of the even locations. +# +# WHY? +# Since any found solution has an inverse we want to maximize finding solutions that are not already found +# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away +# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier +# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will +# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces +# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the +# maximum number +def find_top( rotation_skip) + board = blank_board + (@pieces.length-1).times do + piece = @pieces.shift + piece.masks[0].each do | mask, imask, cmask | + if ((rotation_skip += 1) % 2 == 0) then + piece.placed = mask + find( 1, 1, board | mask) + end + end + @pieces.push(piece) + end + piece = @pieces.shift + @pieces.push(piece) +end + +# the normail find routine, iterates through the available pieces, checks all rotations at the current location +# and adds any boards found. depth is acheived via recursion. the overall approach is described +# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/ +# parameters: +# start_location -- where to start looking for place for the next piece at +# placed -- number of pieces placed +# board -- current state of the board +# +# see in-code comments +def find( start_location, placed, board) + # find the next location to place a piece by looking for an empty bit + while board[start_location] == 1 + start_location += 1 + end + + @pieces.length.times do + piece = @pieces.shift + piece.masks[start_location].each do | mask, imask, cmask | + if ( board & cmask == imask) then + piece.placed = mask + if (placed == 9) then + add_board + else + find( start_location + 1, placed + 1, board | mask) + end + end + end + @pieces.push(piece) + end +end + +# print the board +def print_full_board( board_string) + 10.times do | row | + print " " if (row % 2 == 1) + 5.times do | col | + print "#{board_string[row*5 + col,1]} " + end + print "\n" + end +end + +# when a board is found we "draw it" into a string and then flip that string, adding both to +# the list (hash) of solutions if they are unique. +def add_board + board_string = "99999999999999999999999999999999999999999999999999" + @all_pieces.each { | piece | piece.fill_string( board_string ) } + save( board_string) + save( board_string.reverse) +end + +# adds a board string to the list (if new) and updates the current best/worst board +def save( board_string) + if (@all_boards[board_string] == nil) then + @min_board = board_string if (board_string < @min_board) + @max_board = board_string if (board_string > @max_board) + @all_boards.store(board_string,true) + @boards_found += 1 + + # the exit motif is a time saver. Ideally the function should return, but those tests + # take noticable time (performance). + if (@boards_found == @stop_count) then + print_results + exit(0) + end + end +end + + +## +## MAIN BODY :) +## +create_collector_support +@pieces = [ + Piece.new( [ :nw, :ne, :east, :east ], 2), + Piece.new( [ :ne, :se, :east, :ne ], 7), + Piece.new( [ :ne, :east, :ne, :nw ], 1), + Piece.new( [ :east, :sw, :sw, :se ], 6), + Piece.new( [ :east, :ne, :se, :ne ], 5), + Piece.new( [ :east, :east, :east, :se ], 0), + Piece.new( [ :ne, :nw, :se, :east, :se ], 4), + Piece.new( [ :se, :se, :se, :west ], 9), + Piece.new( [ :se, :se, :east, :se ], 8), + Piece.new( [ :east, :east, :sw, :se ], 3) + ]; + +@all_pieces = Array.new( @pieces) + +@min_board = "99999999999999999999999999999999999999999999999999" +@max_board = "00000000000000000000000000000000000000000000000000" +@stop_count = ARGV[0].to_i || 2089 +@all_boards = {} +@boards_found = 0 + +find_all ######## DO IT!!! + diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb index 709d58b7ff..d6c5bb9e61 100644 --- a/benchmark/bm_so_nbody.rb +++ b/benchmark/bm_so_nbody.rb @@ -1,148 +1,148 @@ -# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
- end
-
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
-end
-
-def energy(bodies)
- e = 0.0
- nbodies = bodies.size
-
- for i in 0 ... nbodies
- b = bodies[i]
- e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
- for j in (i + 1) ... nbodies
- b2 = bodies[j]
- dx = b.x - b2.x
- dy = b.y - b2.y
- dz = b.z - b2.z
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- e -= (b.mass * b2.mass) / distance
- end
- end
- e
-end
-
-def offset_momentum(bodies)
- px, py, pz = 0.0, 0.0, 0.0
-
- for b in bodies
- m = b.mass
- px += b.vx * m
- py += b.vy * m
- pz += b.vz * m
- end
-
- b = bodies[0]
- b.vx = - px / SOLAR_MASS
- b.vy = - py / SOLAR_MASS
- b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
- # sun
- Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
- # jupiter
- Planet.new(
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03,
- 7.69901118419740425e-03,
- -6.90460016972063023e-05,
- 9.54791938424326609e-04),
-
- # saturn
- Planet.new(
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03,
- 4.99852801234917238e-03,
- 2.30417297573763929e-05,
- 2.85885980666130812e-04),
-
- # uranus
- Planet.new(
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03,
- 2.37847173959480950e-03,
- -2.96589568540237556e-05,
- 4.36624404335156298e-05),
-
- # neptune
- Planet.new(
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03,
- 1.62824170038242295e-03,
- -9.51592254519715870e-05,
- 5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
- i = 0
- while i < nbodies
- b = BODIES[i]
- b.move_from_i(BODIES, nbodies, dt, i + 1)
- i += 1
- end
-end
-
-puts "%.9f" % energy(BODIES)
+# The Computer Language Shootout +# http://shootout.alioth.debian.org +# +# Optimized for Ruby by Jesse Millikan +# From version ported by Michael Neumann from the C gcc version, +# which was written by Christoph Bauer. + +SOLAR_MASS = 4 * Math::PI**2 +DAYS_PER_YEAR = 365.24 + +def _puts *args +end + +class Planet + attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass + + def initialize(x, y, z, vx, vy, vz, mass) + @x, @y, @z = x, y, z + @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR + @mass = mass * SOLAR_MASS + end + + def move_from_i(bodies, nbodies, dt, i) + while i < nbodies + b2 = bodies[i] + dx = @x - b2.x + dy = @y - b2.y + dz = @z - b2.z + + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + mag = dt / (distance * distance * distance) + b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag + + @vx -= dx * b2_mass_mag + @vy -= dy * b2_mass_mag + @vz -= dz * b2_mass_mag + b2.vx += dx * b_mass_mag + b2.vy += dy * b_mass_mag + b2.vz += dz * b_mass_mag + i += 1 + end + + @x += dt * @vx + @y += dt * @vy + @z += dt * @vz + end +end + +def energy(bodies) + e = 0.0 + nbodies = bodies.size + + for i in 0 ... nbodies + b = bodies[i] + e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz) + for j in (i + 1) ... nbodies + b2 = bodies[j] + dx = b.x - b2.x + dy = b.y - b2.y + dz = b.z - b2.z + distance = Math.sqrt(dx * dx + dy * dy + dz * dz) + e -= (b.mass * b2.mass) / distance + end + end + e +end + +def offset_momentum(bodies) + px, py, pz = 0.0, 0.0, 0.0 + + for b in bodies + m = b.mass + px += b.vx * m + py += b.vy * m + pz += b.vz * m + end + + b = bodies[0] + b.vx = - px / SOLAR_MASS + b.vy = - py / SOLAR_MASS + b.vz = - pz / SOLAR_MASS +end + +BODIES = [ + # sun + Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0), + + # jupiter + Planet.new( + 4.84143144246472090e+00, + -1.16032004402742839e+00, + -1.03622044471123109e-01, + 1.66007664274403694e-03, + 7.69901118419740425e-03, + -6.90460016972063023e-05, + 9.54791938424326609e-04), + + # saturn + Planet.new( + 8.34336671824457987e+00, + 4.12479856412430479e+00, + -4.03523417114321381e-01, + -2.76742510726862411e-03, + 4.99852801234917238e-03, + 2.30417297573763929e-05, + 2.85885980666130812e-04), + + # uranus + Planet.new( + 1.28943695621391310e+01, + -1.51111514016986312e+01, + -2.23307578892655734e-01, + 2.96460137564761618e-03, + 2.37847173959480950e-03, + -2.96589568540237556e-05, + 4.36624404335156298e-05), + + # neptune + Planet.new( + 1.53796971148509165e+01, + -2.59193146099879641e+01, + 1.79258772950371181e-01, + 2.68067772490389322e-03, + 1.62824170038242295e-03, + -9.51592254519715870e-05, + 5.15138902046611451e-05) +] + +init = 200_000 # ARGV[0] +n = Integer(init) + +offset_momentum(BODIES) + +puts "%.9f" % energy(BODIES) + +nbodies = BODIES.size +dt = 0.01 + +n.times do + i = 0 + while i < nbodies + b = BODIES[i] + b.move_from_i(BODIES, nbodies, dt, i + 1) + i += 1 + end +end + +puts "%.9f" % energy(BODIES) diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb index 59aead5893..a65cc78233 100644 --- a/benchmark/bm_so_nsieve.rb +++ b/benchmark/bm_so_nsieve.rb @@ -1,35 +1,35 @@ -# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Glenn Parker, March 2005
-# modified by Evan Phoenix, Sept 2006
-
-def sieve(m)
- flags = Flags.dup[0,m]
- count = 0
- pmax = m - 1
- p = 2
- while p <= pmax
- unless flags[p].zero?
- count += 1
- mult = p
- while mult <= pmax
- flags[mult] = 0
- mult += p
- end
- end
- p += 1
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
-
-n.downto(n-2) do |exponent|
- break if exponent < 0
- m = (1 << exponent) * 10_000
- # m = (2 ** exponent) * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
+# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Glenn Parker, March 2005 +# modified by Evan Phoenix, Sept 2006 + +def sieve(m) + flags = Flags.dup[0,m] + count = 0 + pmax = m - 1 + p = 2 + while p <= pmax + unless flags[p].zero? + count += 1 + mult = p + while mult <= pmax + flags[mult] = 0 + mult += p + end + end + p += 1 + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*") + +n.downto(n-2) do |exponent| + break if exponent < 0 + m = (1 << exponent) * 10_000 + # m = (2 ** exponent) * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb index 693b2f246d..019b8b6382 100644 --- a/benchmark/bm_so_nsieve_bits.rb +++ b/benchmark/bm_so_nsieve_bits.rb @@ -1,42 +1,42 @@ -#!/usr/bin/ruby
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
- items = "\xFF" * ((m / BitsPerChar) + 1)
- masks = ""
- BitsPerChar.times do |b|
- masks << (1 << b).chr
- end
-
- count = 0
- pmax = m - 1
- 2.step(pmax, 1) do |p|
- if items[p >> CharExponent][p & LowMask] == 1
- count += 1
- p.step(pmax, p) do |mult|
- a = mult >> CharExponent
- b = mult & LowMask
- items[a] -= masks[b] if items[a][b] != 0
- end
- end
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
- break if exponent < 0
- m = 2 ** exponent * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
-
+#!/usr/bin/ruby +# +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# nsieve-bits in Ruby +# Contributed by Glenn Parker, March 2005 + +CharExponent = 3 +BitsPerChar = 1 << CharExponent +LowMask = BitsPerChar - 1 + +def sieve(m) + items = "\xFF" * ((m / BitsPerChar) + 1) + masks = "" + BitsPerChar.times do |b| + masks << (1 << b).chr + end + + count = 0 + pmax = m - 1 + 2.step(pmax, 1) do |p| + if items[p >> CharExponent][p & LowMask] == 1 + count += 1 + p.step(pmax, p) do |mult| + a = mult >> CharExponent + b = mult & LowMask + items[a] -= masks[b] if items[a][b] != 0 + end + end + end + count +end + +n = 9 # (ARGV[0] || 2).to_i +n.step(n - 2, -1) do |exponent| + break if exponent < 0 + m = 2 ** exponent * 10_000 + count = sieve(m) + printf "Primes up to %8d %8d\n", m, count +end + diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb index 41f0a5fb87..630b45cb8d 100644 --- a/benchmark/bm_so_partial_sums.rb +++ b/benchmark/bm_so_partial_sums.rb @@ -1,31 +1,31 @@ -n = 2_500_000 # (ARGV.shift || 1).to_i
-
-alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
-
-1.upto(n) do |d|
- d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
-
- s0 += (2.0 / 3.0) ** (d - 1.0)
- s1 += 1.0 / Math.sqrt(d)
- s2 += 1.0 / (d * (d + 1.0))
- s3 += 1.0 / (d3 * ds * ds)
- s4 += 1.0 / (d3 * dc * dc)
- s5 += 1.0 / d
- s6 += 1.0 / d2
- s7 += alt / d
- s8 += alt / (2.0 * d - 1.0)
-
- alt = -alt
-end
-
-if false
- printf("%.9f\t(2/3)^k\n", s0)
- printf("%.9f\tk^-0.5\n", s1)
- printf("%.9f\t1/k(k+1)\n", s2)
- printf("%.9f\tFlint Hills\n", s3)
- printf("%.9f\tCookson Hills\n", s4)
- printf("%.9f\tHarmonic\n", s5)
- printf("%.9f\tRiemann Zeta\n", s6)
- printf("%.9f\tAlternating Harmonic\n", s7)
- printf("%.9f\tGregory\n", s8)
-end
+n = 2_500_000 # (ARGV.shift || 1).to_i + +alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0 + +1.upto(n) do |d| + d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d) + + s0 += (2.0 / 3.0) ** (d - 1.0) + s1 += 1.0 / Math.sqrt(d) + s2 += 1.0 / (d * (d + 1.0)) + s3 += 1.0 / (d3 * ds * ds) + s4 += 1.0 / (d3 * dc * dc) + s5 += 1.0 / d + s6 += 1.0 / d2 + s7 += alt / d + s8 += alt / (2.0 * d - 1.0) + + alt = -alt +end + +if false + printf("%.9f\t(2/3)^k\n", s0) + printf("%.9f\tk^-0.5\n", s1) + printf("%.9f\t1/k(k+1)\n", s2) + printf("%.9f\tFlint Hills\n", s3) + printf("%.9f\tCookson Hills\n", s4) + printf("%.9f\tHarmonic\n", s5) + printf("%.9f\tRiemann Zeta\n", s6) + printf("%.9f\tAlternating Harmonic\n", s7) + printf("%.9f\tGregory\n", s8) +end diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb index acffe71ae7..c7d6fbfb4d 100644 --- a/benchmark/bm_so_pidigits.rb +++ b/benchmark/bm_so_pidigits.rb @@ -1,92 +1,92 @@ -# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
- def initialize()
- @z = Transformation.new 1,0,0,1
- @x = Transformation.new 0,0,0,0
- @inverse = Transformation.new 0,0,0,0
- end
-
- def next!
- @y = @z.extract(3)
- if safe? @y
- @z = produce(@y)
- @y
- else
- @z = consume @x.next!()
- next!()
- end
- end
-
- def safe?(digit)
- digit == @z.extract(4)
- end
-
- def produce(i)
- @inverse.qrst(10,-10*i,0,1).compose(@z)
- end
-
- def consume(a)
- @z.compose(a)
- end
-end
-
-
-class Transformation
- attr_reader :q, :r, :s, :t
- def initialize (q, r, s, t)
- @q,@r,@s,@t,@k = q,r,s,t,0
- end
-
- def next!()
- @q = @k = @k + 1
- @r = 4 * @k + 2
- @s = 0
- @t = 2 * @k + 1
- self
- end
-
- def extract(j)
- (@q * j + @r) / (@s * j + @t)
- end
-
- def compose(a)
- self.class.new( @q * a.q,
- @q * a.r + r * a.t,
- @s * a.q + t * a.s,
- @s * a.r + t * a.t
- )
- end
-
- def qrst *args
- initialize *args
- self
- end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
- if n >= WIDTH
- WIDTH.times {print digits.next!}
- j += WIDTH
- else
- n.times {print digits.next!}
- (WIDTH-n).times {print " "}
- j += n
- end
- puts "\t:"+j.to_s
- n -= WIDTH
-end
-
+# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# contributed by Gabriele Renzi + +class PiDigitSpigot + + def initialize() + @z = Transformation.new 1,0,0,1 + @x = Transformation.new 0,0,0,0 + @inverse = Transformation.new 0,0,0,0 + end + + def next! + @y = @z.extract(3) + if safe? @y + @z = produce(@y) + @y + else + @z = consume @x.next!() + next!() + end + end + + def safe?(digit) + digit == @z.extract(4) + end + + def produce(i) + @inverse.qrst(10,-10*i,0,1).compose(@z) + end + + def consume(a) + @z.compose(a) + end +end + + +class Transformation + attr_reader :q, :r, :s, :t + def initialize (q, r, s, t) + @q,@r,@s,@t,@k = q,r,s,t,0 + end + + def next!() + @q = @k = @k + 1 + @r = 4 * @k + 2 + @s = 0 + @t = 2 * @k + 1 + self + end + + def extract(j) + (@q * j + @r) / (@s * j + @t) + end + + def compose(a) + self.class.new( @q * a.q, + @q * a.r + r * a.t, + @s * a.q + t * a.s, + @s * a.r + t * a.t + ) + end + + def qrst *args + initialize *args + self + end + + +end + + +WIDTH = 10 +n = 2_500 # Integer(ARGV[0]) +j = 0 + +digits = PiDigitSpigot.new + +while n > 0 + if n >= WIDTH + WIDTH.times {print digits.next!} + j += WIDTH + else + n.times {print digits.next!} + (WIDTH-n).times {print " "} + j += n + end + puts "\t:"+j.to_s + n -= WIDTH +end + diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb index 5cf1a86ada..82ea666994 100644 --- a/benchmark/bm_so_reverse_complement.rb +++ b/benchmark/bm_so_reverse_complement.rb @@ -1,30 +1,30 @@ -#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
+#!/usr/bin/ruby +# The Great Computer Language Shootout +# http://shootout.alioth.debian.org/ +# +# Contributed by Peter Bjarke Olsen +# Modified by Doug King + +seq=Array.new + +def revcomp(seq) + seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN') + stringlen=seq.length + 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"} +end + +input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb') + +while input.gets + if $_ =~ />/ + if seq.length != 0 + revcomp(seq.join) + seq=Array.new + end + puts $_ + else + $_.sub(/\n/,'') + seq.push $_ + end +end +revcomp(seq.join) diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb index 3617da5236..6b97206689 100644 --- a/benchmark/bm_so_spectralnorm.rb +++ b/benchmark/bm_so_spectralnorm.rb @@ -1,50 +1,50 @@ -# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-def eval_A(i,j)
- return 1.0/((i+j)*(i+j+1)/2+i+1)
-end
-
-def eval_A_times_u(u)
- v, i = nil, nil
- (0..u.length-1).collect { |i|
- v = 0
- for j in 0..u.length-1
- v += eval_A(i,j)*u[j]
- end
- v
- }
-end
-
-def eval_At_times_u(u)
- v, i = nil, nil
- (0..u.length-1).collect{|i|
- v = 0
- for j in 0..u.length-1
- v += eval_A(j,i)*u[j]
- end
- v
- }
-end
-
-def eval_AtA_times_u(u)
- return eval_At_times_u(eval_A_times_u(u))
-end
-
-n = 500 # ARGV[0].to_i
-
-u=[1]*n
-for i in 1..10
- v=eval_AtA_times_u(u)
- u=eval_AtA_times_u(v)
-end
-vBv=0
-vv=0
-for i in 0..n-1
- vBv += u[i]*v[i]
- vv += v[i]*v[i]
-end
-
-str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
-# print str
+# The Computer Language Shootout +# http://shootout.alioth.debian.org/ +# Contributed by Sokolov Yura + +def eval_A(i,j) + return 1.0/((i+j)*(i+j+1)/2+i+1) +end + +def eval_A_times_u(u) + v, i = nil, nil + (0..u.length-1).collect { |i| + v = 0 + for j in 0..u.length-1 + v += eval_A(i,j)*u[j] + end + v + } +end + +def eval_At_times_u(u) + v, i = nil, nil + (0..u.length-1).collect{|i| + v = 0 + for j in 0..u.length-1 + v += eval_A(j,i)*u[j] + end + v + } +end + +def eval_AtA_times_u(u) + return eval_At_times_u(eval_A_times_u(u)) +end + +n = 500 # ARGV[0].to_i + +u=[1]*n +for i in 1..10 + v=eval_AtA_times_u(u) + u=eval_AtA_times_u(v) +end +vBv=0 +vv=0 +for i in 0..n-1 + vBv += u[i]*v[i] + vv += v[i]*v[i] +end + +str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n" +# print str diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb index 023e397e92..c8076c6ab6 100644 --- a/benchmark/bm_vm1_ivar_set.rb +++ b/benchmark/bm_vm1_ivar_set.rb @@ -1,6 +1,6 @@ -i = 0
-while i<30_000_000 # while loop 1
- i+= 1
- @a = 1
- @b = 2
-end
+i = 0 +while i<30_000_000 # while loop 1 + i+= 1 + @a = 1 + @b = 2 +end diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb index 9ab781edd4..375dccc00e 100644 --- a/benchmark/bm_vm2_eval.rb +++ b/benchmark/bm_vm2_eval.rb @@ -1,6 +1,6 @@ -i=0
-while i<6000000 # benchmark loop 2
- i+=1
- eval("1")
-end
-
+i=0 +while i<6000000 # benchmark loop 2 + i+=1 + eval("1") +end + diff --git a/benchmark/driver.rb b/benchmark/driver.rb index dd6e1bf597..861d54f904 100644 --- a/benchmark/driver.rb +++ b/benchmark/driver.rb @@ -1,238 +1,238 @@ -#
-# Ruby Benchmark driver
-#
-
-require 'optparse'
-require 'benchmark'
-require 'pp'
-
-class BenchmarkDriver
- def self.benchmark(opt)
- driver = self.new(opt[:execs], opt[:dir], opt)
- begin
- driver.run
- ensure
- driver.show_results
- end
- end
-
- def output *args
- puts(*args)
- @output and @output.puts(*args)
- end
-
- def message *args
- output(*args) if @verbose
- end
-
- def message_print *args
- if @verbose
- print(*args)
- STDOUT.flush
- @output and @output.print(*args)
- end
- end
-
- def progress_message *args
- unless STDOUT.tty?
- STDERR.print(*args)
- STDERR.flush
- end
- end
-
- def initialize execs, dir, opt = {}
- @execs = execs.map{|e|
- e.strip!
- next if e.empty?
-
- if /(.+)::(.+)/ =~ e
- # ex) ruby-a::/path/to/ruby-a
- v = $1.strip
- e = $2
- else
- v = `#{e} -v`.chomp
- v.sub!(/ patchlevel \d+/, '')
- end
- [e, v]
- }.compact
-
- @dir = dir
- @repeat = opt[:repeat] || 1
- @repeat = 1 if @repeat < 1
- @pattern = opt[:pattern] || nil
- @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
- @output = opt[:output] ? open(opt[:output], 'w') : nil
- @loop_wl1 = @loop_wl2 = nil
- @opt = opt
-
- # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
- @results = []
-
- if @verbose
- @start_time = Time.now
- message @start_time
- @execs.each_with_index{|(e, v), i|
- message "target #{i}: #{v}"
- }
- end
- end
-
- def show_results
- output
-
- if @verbose
- message '-----------------------------------------------------------'
- message 'raw data:'
- message
- message PP.pp(@results, "", 79)
- message
- message "Elapesed time: #{Time.now - @start_time} (sec)"
- end
-
- output '-----------------------------------------------------------'
- output 'benchmark results:'
-
- if @verbose and @repeat > 1
- output "minimum results in each #{@repeat} measurements."
- end
-
- output "name\t#{@execs.map{|(e, v)| v}.join("\t")}"
- @results.each{|v, result|
- rets = []
- s = nil
- result.each_with_index{|e, i|
- r = e.min
- case v
- when /^vm1_/
- if @loop_wl1
- r -= @loop_wl1[i]
- s = '*'
- end
- when /^vm2_/
- if @loop_wl2
- r -= @loop_wl2[i]
- s = '*'
- end
- end
- rets << sprintf("%.3f", r)
- }
- output "#{v}#{s}\t#{rets.join("\t")}"
- }
- end
-
- def files
- flag = {}
- vm1 = vm2 = wl1 = wl2 = false
- @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
- next if @pattern && /#{@pattern}/ !~ File.basename(file)
- case file
- when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
- flag[$1] = true
- end
- file
- }.compact
-
- if flag['vm1'] && !flag['whileloop']
- @files << File.join(@dir, 'bm_loop_whileloop.rb')
- elsif flag['vm2'] && !flag['whileloop2']
- @files << File.join(@dir, 'bm_loop_whileloop2.rb')
- end
-
- @files.sort!
- progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
- @files
- end
-
- def run
- files.each_with_index{|file, i|
- @i = i
- r = measure_file(file)
-
- if /bm_loop_whileloop.rb/ =~ file
- @loop_wl1 = r[1].map{|e| e.min}
- elsif /bm_loop_whileloop2.rb/ =~ file
- @loop_wl2 = r[1].map{|e| e.min}
- end
- }
- end
-
- def measure_file file
- name = File.basename(file, '.rb').sub(/^bm_/, '')
- prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
- load prepare_file if FileTest.exist?(prepare_file)
-
- if @verbose
- output
- output '-----------------------------------------------------------'
- output name
- output
- output File.read(file)
- output
- end
-
- result = [name]
- result << @execs.map{|(e, v)|
- (0...@repeat).map{
- message_print "#{v}\t"
- progress_message '.'
-
- m = measure(e, file)
- message "#{m}"
- m
- }
- }
- @results << result
- result
- end
-
- def measure executable, file
- cmd = "#{executable} #{file}"
- m = Benchmark.measure{
- `#{cmd}`
- }
-
- if $? != 0
- raise "Benchmark process exited with abnormal status (#{$?})"
- end
-
- m.real
- end
-end
-
-if __FILE__ == $0
- opt = {
- :execs => ['ruby'],
- :dir => './',
- :repeat => 1,
- :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}",
- }
-
- parser = OptionParser.new{|o|
- o.on('-e', '--executables [EXECS]',
- "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e|
- opt[:execs] = e.split(/;/)
- }
- o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
- opt[:dir] = d
- }
- o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
- opt[:pattern] = p
- }
- o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
- opt[:repeat] = n.to_i
- }
- o.on('-o', '--output-file [FILE]', "Output file"){|o|
- opt[:output] = o
- }
- o.on('-q', '--quiet', "Run without notify information except result table."){|q|
- opt[:quiet] = q
- }
- o.on('-v', '--verbose'){|v|
- opt[:verbose] = v
- }
- }
-
- parser.parse!(ARGV)
- BenchmarkDriver.benchmark(opt)
-end
-
+# +# Ruby Benchmark driver +# + +require 'optparse' +require 'benchmark' +require 'pp' + +class BenchmarkDriver + def self.benchmark(opt) + driver = self.new(opt[:execs], opt[:dir], opt) + begin + driver.run + ensure + driver.show_results + end + end + + def output *args + puts(*args) + @output and @output.puts(*args) + end + + def message *args + output(*args) if @verbose + end + + def message_print *args + if @verbose + print(*args) + STDOUT.flush + @output and @output.print(*args) + end + end + + def progress_message *args + unless STDOUT.tty? + STDERR.print(*args) + STDERR.flush + end + end + + def initialize execs, dir, opt = {} + @execs = execs.map{|e| + e.strip! + next if e.empty? + + if /(.+)::(.+)/ =~ e + # ex) ruby-a::/path/to/ruby-a + v = $1.strip + e = $2 + else + v = `#{e} -v`.chomp + v.sub!(/ patchlevel \d+/, '') + end + [e, v] + }.compact + + @dir = dir + @repeat = opt[:repeat] || 1 + @repeat = 1 if @repeat < 1 + @pattern = opt[:pattern] || nil + @verbose = opt[:quiet] ? false : (opt[:verbose] || false) + @output = opt[:output] ? open(opt[:output], 'w') : nil + @loop_wl1 = @loop_wl2 = nil + @opt = opt + + # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...] + @results = [] + + if @verbose + @start_time = Time.now + message @start_time + @execs.each_with_index{|(e, v), i| + message "target #{i}: #{v}" + } + end + end + + def show_results + output + + if @verbose + message '-----------------------------------------------------------' + message 'raw data:' + message + message PP.pp(@results, "", 79) + message + message "Elapesed time: #{Time.now - @start_time} (sec)" + end + + output '-----------------------------------------------------------' + output 'benchmark results:' + + if @verbose and @repeat > 1 + output "minimum results in each #{@repeat} measurements." + end + + output "name\t#{@execs.map{|(e, v)| v}.join("\t")}" + @results.each{|v, result| + rets = [] + s = nil + result.each_with_index{|e, i| + r = e.min + case v + when /^vm1_/ + if @loop_wl1 + r -= @loop_wl1[i] + s = '*' + end + when /^vm2_/ + if @loop_wl2 + r -= @loop_wl2[i] + s = '*' + end + end + rets << sprintf("%.3f", r) + } + output "#{v}#{s}\t#{rets.join("\t")}" + } + end + + def files + flag = {} + vm1 = vm2 = wl1 = wl2 = false + @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file| + next if @pattern && /#{@pattern}/ !~ File.basename(file) + case file + when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/ + flag[$1] = true + end + file + }.compact + + if flag['vm1'] && !flag['whileloop'] + @files << File.join(@dir, 'bm_loop_whileloop.rb') + elsif flag['vm2'] && !flag['whileloop2'] + @files << File.join(@dir, 'bm_loop_whileloop2.rb') + end + + @files.sort! + progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n" + @files + end + + def run + files.each_with_index{|file, i| + @i = i + r = measure_file(file) + + if /bm_loop_whileloop.rb/ =~ file + @loop_wl1 = r[1].map{|e| e.min} + elsif /bm_loop_whileloop2.rb/ =~ file + @loop_wl2 = r[1].map{|e| e.min} + end + } + end + + def measure_file file + name = File.basename(file, '.rb').sub(/^bm_/, '') + prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb") + load prepare_file if FileTest.exist?(prepare_file) + + if @verbose + output + output '-----------------------------------------------------------' + output name + output + output File.read(file) + output + end + + result = [name] + result << @execs.map{|(e, v)| + (0...@repeat).map{ + message_print "#{v}\t" + progress_message '.' + + m = measure(e, file) + message "#{m}" + m + } + } + @results << result + result + end + + def measure executable, file + cmd = "#{executable} #{file}" + m = Benchmark.measure{ + `#{cmd}` + } + + if $? != 0 + raise "Benchmark process exited with abnormal status (#{$?})" + end + + m.real + end +end + +if __FILE__ == $0 + opt = { + :execs => ['ruby'], + :dir => './', + :repeat => 1, + :output => "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}", + } + + parser = OptionParser.new{|o| + o.on('-e', '--executables [EXECS]', + "Specify benchmark one or more targets. (exec1; exec2; exec3, ...)"){|e| + opt[:execs] = e.split(/;/) + } + o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d| + opt[:dir] = d + } + o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p| + opt[:pattern] = p + } + o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n| + opt[:repeat] = n.to_i + } + o.on('-o', '--output-file [FILE]', "Output file"){|o| + opt[:output] = o + } + o.on('-q', '--quiet', "Run without notify information except result table."){|q| + opt[:quiet] = q + } + o.on('-v', '--verbose'){|v| + opt[:verbose] = v + } + } + + parser.parse!(ARGV) + BenchmarkDriver.benchmark(opt) +end + diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb index 158d8fd161..b6d787ae27 100644 --- a/benchmark/make_fasta_output.rb +++ b/benchmark/make_fasta_output.rb @@ -1,19 +1,19 @@ -# prepare 'fasta.output'
-
-def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
-end
-
+# prepare 'fasta.output' + +def prepare_fasta_output n + filebase = File.join(File.dirname($0), 'fasta.output') + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + file = "#{filebase}.#{n}" + + unless FileTest.exist?(file) + STDERR.puts "preparing #{file}" + + open(file, 'w'){|f| + ARGV[0] = n + $stdout = f + load script + $stdout = STDOUT + } + end +end + diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb index 54ea72b8ed..ee2138cdb2 100644 --- a/benchmark/prepare_so_count_words.rb +++ b/benchmark/prepare_so_count_words.rb @@ -1,15 +1,15 @@ -# prepare 'wc.input'
-
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
+# prepare 'wc.input' + +def prepare_wc_input + wcinput = File.join(File.dirname($0), 'wc.input') + wcbase = File.join(File.dirname($0), 'wc.input.base') + unless FileTest.exist?(wcinput) + data = File.read(wcbase) + 13.times{ + data << data + } + open(wcinput, 'w'){|f| f.write data} + end +end + +prepare_wc_input diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb index 62e0c76fb9..f28f4460a1 100644 --- a/benchmark/prepare_so_k_nucleotide.rb +++ b/benchmark/prepare_so_k_nucleotide.rb @@ -1,2 +1,2 @@ -require File.join(File.dirname(__FILE__), 'make_fasta_output')
-prepare_fasta_output(100_000)
+require File.join(File.dirname(__FILE__), 'make_fasta_output') +prepare_fasta_output(100_000) diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb index b1cd837626..7f089109de 100644 --- a/benchmark/prepare_so_reverse_complement.rb +++ b/benchmark/prepare_so_reverse_complement.rb @@ -1,2 +1,2 @@ -require File.join(File.dirname(__FILE__), 'make_fasta_output')
-prepare_fasta_output(2_500_000)
+require File.join(File.dirname(__FILE__), 'make_fasta_output') +prepare_fasta_output(2_500_000) |