From 3293322a39f9c9de11c54f9e9e78c55061ac2ce9 Mon Sep 17 00:00:00 2001
From: k0kubun <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
Date: Sun, 8 Jul 2018 14:38:05 +0000
Subject: benchmark: introduce benchmark_driver.gem

Makefile.in: Clone benchmark-driver repository in benchmark/benchmark-driver
  `make update-benchmark-driver`, like simplecov.
win32/Makefile.sub: Roughly do the same thing.
.gitignore: Ignore the cloned repository.
common.mk: Trigger `make update-benchmark-driver` to run `make benchmark`
  and adjust arguments for benchmark_driver.gem.

benchmark/require.yml: renamed from benchmark/bm_require.rb, benchmark/prepare_require.rb
benchmark/require_thread.yml: renamed from benchmark/bm_require_thread.rb, benchmark/prepare_require_thread.rb
benchmark/so_count_words.yml: renamed from benchmark/bm_so_count_words.rb, benchmark/prepare_so_count_words.rb,
  benchmark/wc.input.base
benchmark/so_k_nucleotide.yml: renamed from benchmark/bm_so_k_nucleotide.rb, benchmark/prepare_so_k_nucleotide.rb,
  benchmark/make_fasta_output.rb
benchmark/so_reverse_complement.yml: renamed from benchmark/bm_so_reverse_complement.rb, benchmark/prepare_so_reverse_complement.rb,
  benchmark/make_fasta_output.rb

I'm sorry but I made some duplications between benchmark/require.yml and benchmark/require_thread.yml,
and between benchmark/so_k_nucleotide.yml and benchmark/so_reverse_complement.yml.

If you're not comfortable with it, please combine these YAMLs to share
the same prelude. One YAML file can have multiple benchmark definitions
sharing prelude.

benchmark/driver.rb: Replace its core feature with benchmark_driver.gem.
  Some old features are gone for now, but I'll add them again later.

[Misc #14902]

git-svn-id: svn+ssh://ci.ruby-lang.org/ruby/trunk@63888 b2dd03c8-39d4-4d8f-98ff-823fe69b080e
---
 benchmark/so_reverse_complement.yml | 137 ++++++++++++++++++++++++++++++++++++
 1 file changed, 137 insertions(+)
 create mode 100644 benchmark/so_reverse_complement.yml

(limited to 'benchmark/so_reverse_complement.yml')

diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_reverse_complement
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(2_500_000)
+    script: |
+      # The Great Computer Language Shootout
+      # http://shootout.alioth.debian.org/
+      #
+      # Contributed by Peter Bjarke Olsen
+      # Modified by Doug King
+
+      seq=Array.new
+
+      def revcomp(seq)
+        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+        stringlen=seq.length
+        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+      while input.gets
+        if $_ =~ />/
+          if seq.length != 0
+            revcomp(seq.join)
+            seq=Array.new
+          end
+          puts $_
+        else
+          $_.sub(/\n/,'')
+          seq.push $_
+        end
+      end
+      revcomp(seq.join)
+    loop_count: 1
-- 
cgit v1.2.3